Implement nox

.gitignore

@@ -2,10 +2,10 @@
 cli_integration_tests/CRISPResso_on_FANC.Cas9*
 cli_integration_tests/CRISPResso_on_bam*
 cli_integration_tests/CRISPResso_on_params*
-cli_integration_tests/CRISPRessoBatch_on_FANC*
+cli_integration_tests/CRISPRessoBatch_on_batch*
 cli_integration_tests/CRISPRessoPooled_on_Both.Cas9*
-cli_integration_tests/CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome*
-cli_integration_tests/CRISPRessoCompare_on_Cas9_VS_Untreated*
+cli_integration_tests/CRISPRessoWGS_on_wgs*
+cli_integration_tests/CRISPRessoCompare_on_compare*
 cli_integration_tests/CRISPRessoPooled_on_prime.editing*
 cli_integration_tests/CRISPResso_on_basic-write-bam-out*
 cli_integration_tests/CRISPResso_on_basic-write-bam-out-parallel*

README.md

@@ -1,53 +1,87 @@
 # CRISPResso2_tests
 
-A repository for testing that is too large (or too private) to be kept in their respective repositories.
+A repository for testing that is too large to be kept in their respective repositories.
 
 ## `CRISPResso2` Thorough Integration Tests
 
-To run the integration tests for `CRISPResso2` make sure that the `CRISPRESSO2_DIR` variable in the `Makefile` is set to the correct directory where the `CRISPResso2` repository is (by default it is set to `../CRISPResso2`).
-Then to run only the integration tests you can issue `make all test` and it will run the tests and compare the output.
+To run the integration tests for `CRISPResso2` make sure that the `CRISPRESSO2_DIR` variable in the `noxfile.py` is set to the correct directory (or you have a `CRISPRESSO2_DIR` environment variable set) where the `CRISPResso2` repository is (by default it is set to `../CRISPResso2`).
+Then to run only the integration tests you can issue `nox -- test` and it will run the tests and compare the output.
 
 Furthermore, the running times of each integration test will be checked and if there is a difference > 10% in the two times, it will be reported.
 
 For improved diff output, run `pip install ydiff` and the diffs will be colorized and side by side.
 
+## Dependencies
+
+Install the following dependencies to run the tests:
+
+- `nox`
+- `pyyaml`
+- `ydiff` (optional)
+
 ### How can I run a test?
 
 As explained above, to run all of the tests use:
 
 ``` shell
-make all
+nox
 ```
 
 To run all the tests and check all files for differences use the `test` option:
 
 ```shell
-make all test
+nox -- test
 ```
 
 You can also select a single command to run, like this:
 
 ``` shell
-make basic
+nox -s basic
 ```
 
 **Note:** this will only run the CRISPResso command, it will not check the output files for differences.
 
 If you want to run a single command *and* check it for differences, use the `test` option, like this:
 
 ``` shell
-make basic test
+nox -s basic -- test
 ```
 
 By default, tests will only print command output in the case of an error. To force print output for any test use the `print` option, like this:
 
 ``` shell
-make basic print
+nox -s basic -- print
+```
+
+Note that `test` and `print` can be combined, like this:
+
+``` shell
+nox -s basic -- print test
 ```
 
+### Nox conda environments and package version management
+
+Nox will automatically create a number of conda environments based on the parameters of the packages that are specified in the `test_config.yaml` file. This happens if you run `nox`. To make tests run faster, the conda environments are cached (it checks if `samtools` is accessible, and if so it skips installing all of the packages) and there may be times if you need to manually trigger the creation of the conda environments.
+
+To initially create the conda environments you can run:
+
+``` shell
+nox -s conda_env
+```
+
+This will create conda environments with the specified versions in the `.nox` directory. If there are already conda environments and you would like to update them, then you should add the `force` argument like this: `nox -c conda_env -- force`.
+
+If you are running on Apple Silicon, you most likely want to run the above command like `CONDA_SUBDIR="osx-64" nox -s conda_env -- force` so that the x86 versions of the packages are installed.
+
 ### How can I update the expected results for a test?
 
-If you run a test and there are differences, you can run the command:
+If you run a test and there are differences that you want to update the expected results files, you can run the command:
+
+``` shell
+nox -s basic -- update
+```
+
+Which will run the command:
 
 ```shell
 python test_manager.py update <actual CRISPResso results directory> <expected CRISPResso results directory>

cli_integration_tests/CRISPRessoBatch_on_batch/CRISPResso2Batch_info.json

@@ -0,0 +1,236 @@
+{
+  "running_info": {
+    "version": "2.3.2",
+    "args": {
+      "_type": "argparse.Namespace",
+      "value": {
+        "amplicon_seq": "CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG",
+        "amplicon_name": "Reference",
+        "amplicon_min_alignment_score": "",
+        "default_min_aln_score": 60,
+        "expand_ambiguous_alignments": false,
+        "assign_ambiguous_alignments_to_first_reference": false,
+        "guide_seq": "GGAATCCCTTCTGCAGCACC",
+        "guide_name": "",
+        "flexiguide_seq": "None",
+        "flexiguide_homology": 80,
+        "flexiguide_name": "",
+        "flexiguide_gap_open_penalty": -20,
+        "flexiguide_gap_extend_penalty": -2,
+        "discard_guide_positions_overhanging_amplicon_edge": false,
+        "expected_hdr_amplicon_seq": "",
+        "coding_seq": "",
+        "config_file": "None",
+        "min_average_read_quality": 0,
+        "min_single_bp_quality": 0,
+        "min_bp_quality_or_N": 0,
+        "file_prefix": "",
+        "name": "batch",
+        "suppress_amplicon_name_truncation": false,
+        "output_folder": "",
+        "verbosity": 3,
+        "split_interleaved_input": false,
+        "trim_sequences": false,
+        "trimmomatic_command": "None",
+        "trimmomatic_options_string": "",
+        "flash_command": "None",
+        "fastp_command": "fastp",
+        "fastp_options_string": "",
+        "min_paired_end_reads_overlap": 10,
+        "max_paired_end_reads_overlap": "None",
+        "stringent_flash_merging": false,
+        "force_merge_pairs": false,
+        "quantification_window_size": "1",
+        "quantification_window_center": "-3",
+        "exclude_bp_from_left": 15,
+        "exclude_bp_from_right": 15,
+        "use_legacy_insertion_quantification": false,
+        "ignore_substitutions": false,
+        "ignore_insertions": false,
+        "ignore_deletions": false,
+        "discard_indel_reads": false,
+        "needleman_wunsch_gap_open": -20,
+        "needleman_wunsch_gap_extend": -2,
+        "needleman_wunsch_gap_incentive": 1,
+        "needleman_wunsch_aln_matrix_loc": "EDNAFULL",
+        "aln_seed_count": 5,
+        "aln_seed_len": 10,
+        "aln_seed_min": 2,
+        "plot_histogram_outliers": false,
+        "plot_window_size": 20,
+        "min_frequency_alleles_around_cut_to_plot": 0.2,
+        "expand_allele_plots_by_quantification": false,
+        "allele_plot_pcts_only_for_assigned_reference": false,
+        "quantification_window_coordinates": null,
+        "annotate_wildtype_allele": "",
+        "keep_intermediate": false,
+        "dump": false,
+        "write_detailed_allele_table": false,
+        "fastq_output": false,
+        "bam_output": false,
+        "bowtie2_index": "",
+        "zip_output": false,
+        "max_rows_alleles_around_cut_to_plot": 50,
+        "suppress_report": false,
+        "place_report_in_output_folder": true,
+        "suppress_plots": false,
+        "write_cleaned_report": false,
+        "base_editor_output": true,
+        "conversion_nuc_from": "C",
+        "conversion_nuc_to": "T",
+        "prime_editing_pegRNA_spacer_seq": "",
+        "prime_editing_pegRNA_extension_seq": "",
+        "prime_editing_pegRNA_extension_quantification_window_size": 5,
+        "prime_editing_pegRNA_scaffold_seq": "",
+        "prime_editing_pegRNA_scaffold_min_match_length": 1,
+        "prime_editing_nicking_guide_seq": "",
+        "prime_editing_override_prime_edited_ref_seq": "",
+        "prime_editing_override_sequence_checks": false,
+        "prime_editing_gap_open_penalty": -50,
+        "prime_editing_gap_extend_penalty": 0,
+        "crispresso1_mode": false,
+        "dsODN": "",
+        "auto": false,
+        "debug": true,
+        "no_rerun": false,
+        "n_processes": "1",
+        "bam_input": "",
+        "bam_chr_loc": "",
+        "save_also_png": false,
+        "batch_settings": "inputs/FANC.batch",
+        "skip_failed": false,
+        "min_reads_for_inclusion": 0,
+        "batch_output_folder": "",
+        "suppress_batch_summary_plots": false,
+        "crispresso_command": "CRISPResso",
+        "disable_guardrails": false,
+        "use_matplotlib": false,
+        "halt_on_plot_fail": true
+      }
+    },
+    "log_filename": "CRISPRessoBatch_RUNNING_LOG.txt",
+    "command_used": "/Users/cole/code/edilytics/CRISPResso2_tests/.nox/conda_env-python-3-13-numpy-2-1-1/bin/CRISPRessoBatch -bs inputs/FANC.batch -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --base_editor -n batch --place_report_in_output_folder --halt_on_plot_fail --debug",
+    "report_location": "/Users/cole/code/edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_batch/CRISPResso2Batch_report.html",
+    "report_filename": "CRISPResso2Batch_report.html",
+    "start_time": {
+      "_type": "datetime.datetime",
+      "value": "2024-10-18 14:31:51.473299"
+    },
+    "start_time_string": "2024-10-18 14:31:51",
+    "end_time": {
+      "_type": "datetime.datetime",
+      "value": "2024-10-18 14:32:21.058728"
+    },
+    "end_time_string": "2024-10-18 14:32:21",
+    "running_time": {
+      "_type": "datetime.timedelta",
+      "value": {
+        "days": 0,
+        "seconds": 29,
+        "microseconds": 585429
+      }
+    },
+    "running_time_string": "0:00:29.585429"
+  },
+  "results": {
+    "alignment_stats": {},
+    "general_plots": {
+      "summary_plot_titles": {
+        "Nucleotide_percentage_quilt_around_sgRNA_GGAATCCCTTCTGCAGCACC": "sgRNA: GGAATCCCTTCTGCAGCACC Amplicon: Reference",
+        "Nucleotide_conversion_map_around_sgRNA_GGAATCCCTTCTGCAGCACC": "",
+        "Nucleotide_percentage_quilt": "",
+        "Nucleotide_conversion_map": ""
+      },
+      "summary_plot_labels": {
+        "Nucleotide_percentage_quilt_around_sgRNA_GGAATCCCTTCTGCAGCACC": "Composition of each base around the guide GGAATCCCTTCTGCAGCACC for the amplicon Reference",
+        "Nucleotide_conversion_map_around_sgRNA_GGAATCCCTTCTGCAGCACC": "C->T conversion rates around the guide GGAATCCCTTCTGCAGCACC for the amplicon Reference",
+        "Nucleotide_percentage_quilt": "Composition of each base for the amplicon Reference",
+        "Nucleotide_conversion_map": "C->T conversion rates for the amplicon Reference"
+      },
+      "summary_plot_datas": {
+        "Nucleotide_percentage_quilt_around_sgRNA_GGAATCCCTTCTGCAGCACC": [
+          [
+            "Nucleotide frequencies",
+            "Nucleotide_frequency_summary.txt"
+          ],
+          [
+            "Modification frequencies",
+            "MODIFICATION_FREQUENCY_SUMMARY.txt"
+          ]
+        ],
+        "Nucleotide_conversion_map_around_sgRNA_GGAATCCCTTCTGCAGCACC": [
+          [
+            "Nucleotide frequencies around sgRNA",
+            "Nucleotide_frequency_summary_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt"
+          ],
+          [
+            "Nucleotide percentages around sgRNA",
+            "Nucleotide_percentage_summary_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt"
+          ]
+        ],
+        "Nucleotide_percentage_quilt": [
+          [
+            "Nucleotide frequencies",
+            "Nucleotide_frequency_summary.txt"
+          ],
+          [
+            "Modification frequencies",
+            "MODIFICATION_FREQUENCY_SUMMARY.txt"
+          ]
+        ],
+        "Nucleotide_conversion_map": [
+          [
+            "Nucleotide frequencies",
+            "Nucleotide_frequency_summary.txt"
+          ],
+          [
+            "Modification frequencies",
+            "MODIFICATION_FREQUENCY_SUMMARY.txt"
+          ]
+        ]
+      },
+      "allele_modification_heatmap_plot_names": [],
+      "allele_modification_heatmap_plot_paths": {},
+      "allele_modification_heatmap_plot_titles": {},
+      "allele_modification_heatmap_plot_labels": {},
+      "allele_modification_heatmap_plot_datas": {},
+      "allele_modification_heatmap_plot_divs": {},
+      "allele_modification_line_plot_names": [],
+      "allele_modification_line_plot_paths": {},
+      "allele_modification_line_plot_titles": {},
+      "allele_modification_line_plot_labels": {},
+      "allele_modification_line_plot_datas": {},
+      "allele_modification_line_plot_divs": {},
+      "window_nuc_pct_quilt_plot_names": [
+        "Nucleotide_percentage_quilt_around_sgRNA_GGAATCCCTTCTGCAGCACC"
+      ],
+      "nuc_pct_quilt_plot_names": [
+        "Nucleotide_percentage_quilt"
+      ],
+      "window_nuc_conv_plot_names": [
+        "Nucleotide_conversion_map_around_sgRNA_GGAATCCCTTCTGCAGCACC"
+      ],
+      "nuc_conv_plot_names": [
+        "Nucleotide_conversion_map"
+      ]
+    },
+    "batch_names_arr": [
+      "Untreated",
+      "Cas9"
+    ],
+    "batch_input_names": {
+      "Untreated": "Untreated",
+      "Cas9": "Cas9"
+    },
+    "failed_batch_arr": [],
+    "failed_batch_arr_desc": [],
+    "completed_batch_arr": [
+      "Untreated",
+      "Cas9"
+    ],
+    "nucleotide_frequency_summary_filename": "Nucleotide_frequency_summary.txt",
+    "nucleotide_percentage_summary_filename": "Nucleotide_percentage_summary.txt",
+    "modification_frequency_summary_filename": "MODIFICATION_FREQUENCY_SUMMARY.txt",
+    "modification_percentage_summary_filename": "MODIFICATION_PERCENTAGE_SUMMARY.txt"
+  }
+}

cli_integration_tests/expected_results/CRISPRessoBatch_on_FANC/CRISPResso2Batch_report.html → cli_integration_tests/CRISPRessoBatch_on_batch/CRISPResso2Batch_report.html

@@ -124,7 +124,7 @@
       <div class="row pb-2">
         <div class="col-sm-1"></div>
 
-          <div class="col-sm-3 crispresso_cup"> <a href='https://crispresso2.pinellolab.org'><img class='img-fluid' src="http://crispresso.pinellolab.org/static/imgs/CRISPResso_justcup.png" width="80%"></a>
+          <div class="col-sm-3 crispresso_cup"> <a href='https://crispresso2.pinellolab.org'><img class='img-fluid' src="https://crispresso.pinellolab.partners.org/static/imgs/CRISPResso_justcup.png" width="80%"></a>
 
           </div>
         <div class="col-sm-7" >
@@ -159,7 +159,7 @@ <h3 style="margin-top: -0.5em;padding-right: 2em;">Analysis of genome editing ou
 
             <div class='card text-center mb-2'>
               <div class='card-header'>
-                <h5 id="CRISPResso2_Batch_Output">CRISPResso Batch Output</h5>
+                <h5 id="CRISPResso2_Batch_Output">CRISPResso Batch Output<br/>batch</h5>
               </div>
               <div class='card-body p-0'>
                 <div class="list-group list-group-flush" style="max-height: 25vh; overflow-y: scroll;">

cli_integration_tests/CRISPRessoBatch_on_batch/CRISPRessoBatch_RUNNING_LOG.txt

@@ -0,0 +1,15 @@
+[Command used]:
+/Users/cole/code/edilytics/CRISPResso2_tests/.nox/conda_env-python-3-13-numpy-2-1-1/bin/CRISPRessoBatch -bs inputs/FANC.batch -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --base_editor -n batch --place_report_in_output_folder --halt_on_plot_fail --debug
+
+[Execution log]:
+Running CRISPResso with 1 processes
+Completed 1/2 runs
+Completed 2/2 runs
+Finished all batches
+Reporting summary for amplicon: "Reference"
+All guides are equal. Performing comparison of batches for amplicon 'Reference'
+Plotting nucleotide percentage quilt for amplicon Reference, sgRNA GGAATCCCTTCTGCAGCACC
+Plotting nucleotide conversion map for amplicon Reference, sgRNA GGAATCCCTTCTGCAGCACC
+Plotting nucleotide quilt for Reference
+Plotting nucleotide conversion map for Reference
+Analysis Complete!