working CSV parsing string example

src/Form.purs

@@ -9,6 +9,8 @@ import Data.List.Lazy as List
 import Data.Maybe.Unsafe (fromJust)
 import Control.Monad.Eff.Exception.Unsafe (unsafeThrow)
 import Control.Monad.Eff.Class (liftEff)
+import Data.Either.Unsafe (fromRight)
+
 --import Data.Unfoldable (replicateA)
 import Control.Monad.Eff.Random as Rand
 import App.Routes (Route)
@@ -88,7 +90,7 @@ init = { name: Nothing, country: Nothing
        , format : Fasta, genotype : Nothing
        , minDate : Nothing, maxDate : Nothing
        , errors : M.empty
-       , db : seqs
+       , db : fromRightOrError $ Seq.readCSV "," csv
        , hostString : Nothing }
 -- In order to give Seq.State an Eq instance, it must be wrapped in NewType
 
@@ -211,11 +213,11 @@ toCSV :: Array Seq.State -> String
 toCSV xs = header <> "\n" <> (intercalate "\n" $ map toRow xs)
   where
     header = "name,acc,year,segment"
-    toRow x = intercalate "," [x.name, x.acc, (show x.year), (show x.segment)]
+    toRow x = intercalate "," [x.name, x.acc, (show x.year), (fromMaybe "" $ show <$> x.segment)]
 
 
 query :: State -> Array Seq.State
-query q = filter match seqs
+query q = filter match q.db
   where
     match x = (q.acc ==? x.acc) && 
       (q.name ==? x.name) &&
@@ -281,3 +283,10 @@ example3 =  {
        }
 
   -- [ option [label x, value x] []]
+fromRightOrError (Right s) = s
+fromRightOrError (Left s) = unsafeThrow s
+-- TODO: non-normal Host is not okay apparently
+csv = "genotype,segment,name,acc,year,month,day,country,host,serotype,sequence\n" ++ 
+",,11/1666,KR922405,2011,,,Thailand,Human,DENV4,ATGAACCAACGAAAGAAGGTGG\n" ++ 
+",,Br246RR/10,JN983813,2010,9,8,Brazil,Human,DENV4,ATGAACCAACGAAAAAAGGT\n" ++ 
+",,D4/Pakistan/150/2009,KF041260,2009,,,Pakistan,Human,DENV4,ATGAACCAACG"

src/Seq.purs

@@ -122,17 +122,17 @@ readCSV sep s = do
 
 type Error = String        
 process :: Array String -> Array (Array String) -> Either Error (Array State)
-process header rows = sequence $ map process' rows
+process header rows = sequence $ map process' $ A.filter (not <<< A.null) rows
   where
     --process' row | (A.length row) < (A.length columns) = Left ("Row not have expected length " ++ (show $ A.length columns) ++ " found length " ++ (show $ A.length row) )
     process' :: Array String -> Either Error State
     process' row = do
      name <- Right $ row `at` "name"
      acc  <- Right $ row `at` "acc"
      country <- Right $ row `at` "country"
-     year <- toEither "bad year" $ Int.fromString (row `at` "year")
-     host <- toEither "Bad host" $ readHost (row `at` "host")
-     serotype <-  toEither "Bad serotype" $ readSerotype (row `at` "serotype")
+     year <- toField Int.fromString  "year" row
+     host <- toField readHost "host" row
+     serotype <-  toField readSerotype  "serotype" row
      let hostString = (row `at` "host")
      let segment = readSegment $ (row `at` "segement")
      let genotype = readGenotype $ (row `at` "genotype")
@@ -156,9 +156,14 @@ process header rows = sequence $ map process' rows
             , hostString : hostString
            }
       where
-        at xs col = fromMaybe ("Bad column "  ++ col ) $ do
+        at xs col = fromMaybe ("Bad column "  <> col <> " in header " <> (intercalate "," header ) <> "\n" <> "row: " <> (intercalate ","xs))  $ do
           i <- A.elemIndex col header
-          xs A.!! i 
+          xs A.!! i
+        toField :: forall a. (String -> Maybe a) -> String -> Array String -> Either Error a
+        toField f col row = toEither msg $ f x
+          where
+            msg = x ++ " is not a valid " ++ col
+            x = row `at` col
     order row = A.sortBy headerOrder row
     headerOrder x y  = compare (fromMaybe 9999 (A.elemIndex  x header)) (fromMaybe 9999 (A.elemIndex y header))