CSV reading on startup

bower.json

@@ -13,6 +13,6 @@
       "purescript-generics" : "^0.7.2",
       "purescript-globals" : "^0.2.2",
       "purescript-random" : "^0.2.3",
-      "purescript-sets" : "^0.5.6",
+      "purescript-sets" : "^0.5.6"
   }
 }

foo.csv

@@ -0,0 +1,4 @@
+genotype,segment,name,acc,year,month,day,country,host,serotype,sequence
+,,11/1666,KR922405,2011,,,Thailand,Human,DENV4,ATGAACCAACGAAAGAAGGTGG 
+,,Br246RR/10,JN983813,2010,9,8,Brazil,Human,DENV4,ATGAACCAACGAAAAAAGGT
+,,D4/Pakistan/150/2009,KF041260,2009,,,Pakistan,Human,DENV4,ATGAACCAAC

src/Form.purs

@@ -1,6 +1,7 @@
 module App.Form where 
 import Control.Monad.Eff (Eff())
 import DOM (DOM)
+import FileReader (FS)
 import  Control.Monad.Eff.Exception (EXCEPTION)
 import Global (encodeURIComponent) --, readInt)
 import Data.Int as Int
@@ -95,7 +96,7 @@ init = { name: Nothing, country: Nothing
 -- In order to give Seq.State an Eq instance, it must be wrapped in NewType
 
 
-type AppEffects = (random :: Rand.RANDOM, dom :: DOM )
+type AppEffects = (fs :: FS, random :: Rand.RANDOM, dom :: DOM )
 
 strToMaybe xs = if (S.null $ S.trim xs) then Nothing else Just xs
 

src/Layout.purs

@@ -10,11 +10,16 @@ import Pux (EffModel, noEffects,  mapEffects, mapState)
 import Unsafe.Coerce
 import Data.Either
 import Data.Maybe
+import FileReader (readFileBlocking)
+import App.Seq as Seq
+import Control.Monad.Eff.Class (liftEff)
+import Control.Monad.Aff.Class (liftAff)
 
 
 data Action
   = Child (Form.Action)
   | PageView Route
+  | LoadFile (Either String (Array Seq.State))
   | DoChildAction Form.Action  
 
 type State =
@@ -28,7 +33,12 @@ init =
 
 
 update :: forall e. Action -> State -> EffModel State Action (Form.AppEffects )
-update (PageView route) state = noEffects $ state { route = route } 
+--update (PageView route) state = noEffects $ state { route = route } 
+update (PageView route) state = { state : state
+                                , effects : [do
+                                               s <- liftEff $ readFileBlocking "foo.csv"
+                                               return $ LoadFile $ Seq.readCSV "," s]}
+update (LoadFile (Right recs))  state = noEffects $ state { form = state.form  { db = recs }}
 update (DoChildAction (Form.RandomState state')) state = noEffects state { form = state' }
 -- simply pass along the child From's actions 
 update (Child action) state = mapEffects DoChildAction

src/Main.purs

@@ -4,13 +4,14 @@ import App.Routes (match)
 import App.Layout (Action(PageView), State, view, update)
 import Control.Bind ((=<<))
 import Control.Monad.Eff (Eff)
-import Prelude (bind, return, ($))
+import Prelude (bind, return, ($), (>>=))
 import Data.Maybe 
 import Pux (App, Config, CoreEffects, fromSimple, renderToDOM)
 import Pux.Router (sampleUrl)
 import Signal ((~>))
 import App.Form (AppEffects)
 import App.Form as Form
+import Control.Monad.Eff.Class (liftEff)
   -- AppEffects must be defined as a closed record with DOM and RANDOM
 
 -- | Entry point for the browser.--
@@ -19,8 +20,9 @@ main state = do
   app <- Pux.start =<< config state
   renderToDOM "#app" app.html
   -- | Used by hot-reloading code in support/index.js
-  return app 
-config :: State ->
+  return app
+
+config :: forall e. State ->
           Eff (CoreEffects (AppEffects ))
             (Config State Action AppEffects)
 config state = do
@@ -29,10 +31,21 @@ config state = do
 
   -- | Map a signal of URL changes to PageView actions.
   let routeSignal = urlSignal ~> \r -> PageView (match r)
-  return { initialState : state { form =  Form.init { name = Just "foo"}  }
+  return { initialState : state { form =  Form.init { name = Just "foo" , db = [] } }
            , update : update
            , view : view
            , inputs : [routeSignal]}
+
+  --recs <- readFileBlocking "foo.csv" 
+  --(readFileBlocking "foo.csv") >>= \recs ->
+--  return { initialState : state
+--              { form =  Form.init
+--                 { name = Just "foo"
+--                 , db = [] } }
+--           , update : update
+--           , view : view
+--           , inputs : [routeSignal]}
+
 
 -- | Entry point for the browser with pux-devtool injected.
 debug :: State -> Eff (CoreEffects AppEffects) (App State (Pux.Devtool.Action Action))

src/Seq.purs

@@ -23,8 +23,7 @@ import Data.String as S
 import Data.Maybe
 import Data.Int as Int 
 --import Data.Eulalie.Parser as P
---import Data.Eulalie.String as S
-
+--import Data.Eulalie.String as S 
 
 data Format = Fasta | CSV
 readFormat = makeRead [Fasta, CSV]
@@ -44,6 +43,8 @@ instance eqFormat :: Eq Format where
 readHost :: String -> Maybe Host
 readHost = makeRead [Human, Mosquito]
 
+
+
 data Host = Human | Mosquito
 derive instance genericHost :: Generic Host
 instance showHost :: Show Host where