Add fulltext indexing to ontology store

packages/jbrowse-plugin-apollo/package.json

@@ -53,15 +53,18 @@
     "@jbrowse/plugin-authentication": "^2.0.1",
     "@jbrowse/plugin-linear-genome-view": "^2.0.1",
     "@mui/icons-material": "^5.8.4",
+    "@types/jsonpath": "^0.2.0",
     "apollo-common": "workspace:^",
     "apollo-mst": "workspace:^",
     "apollo-shared": "workspace:^",
     "autosuggest-highlight": "^3.3.4",
     "bson-objectid": "^2.0.3",
     "clsx": "^1.1.1",
+    "fast-deep-equal": "^3.1.3",
     "file-saver": "^2.0.5",
     "http-proxy-middleware": "^2.0.6",
     "idb": "^7.1.1",
+    "jsonpath": "^1.1.1",
     "nanoid": "^4.0.2",
     "regenerator-runtime": "^0.13.9",
     "socket.io-client": "^4.5.3",
@@ -95,7 +98,7 @@
     "@types/react-dom": "^18",
     "cypress": "^12.17.2",
     "fake-indexeddb": "^4.0.2",
-    "jest": "^29.0.3",
+    "jest": "^29.6.2",
     "jest-fetch-mock": "^3.0.3",
     "mobx": "^6.6.1",
     "mobx-react": "^7.2.1",

packages/jbrowse-plugin-apollo/src/ApolloSequenceAdapter/ApolloSequenceAdapter.test.ts

@@ -51,16 +51,6 @@ describe('ApolloSequenceAdapter', () => {
       {},
     )
     const featuresArray = await features.pipe(toArray()).toPromise()
-    expect(featuresArray).toMatchInlineSnapshot(`
-      [
-        {
-          "end": 30,
-          "refName": "ctgA",
-          "seq": "GCGTGCAACAGACTTTCCATGATGCGAGCT",
-          "start": 0,
-          "uniqueId": "ctgA 0-30",
-        },
-      ]
-    `)
+    expect(featuresArray).toMatchSnapshot()
   })
 })

packages/jbrowse-plugin-apollo/src/ApolloSequenceAdapter/__snapshots__/ApolloSequenceAdapter.test.ts.snap

@@ -0,0 +1,13 @@
+// Jest Snapshot v1, https://goo.gl/fbAQLP
+
+exports[`ApolloSequenceAdapter can get features 1`] = `
+[
+  {
+    "end": 30,
+    "refName": "ctgA",
+    "seq": "GCGTGCAACAGACTTTCCATGATGCGAGCT",
+    "start": 0,
+    "uniqueId": "ctgA 0-30",
+  },
+]
+`;

packages/jbrowse-plugin-apollo/src/OntologyManager/OntologyStore/__snapshots__/fulltext.test.ts.snap

@@ -0,0 +1,208 @@
+// Jest Snapshot v1, https://goo.gl/fbAQLP
+
+exports[`elaborateMatch can do another 1`] = `
+[
+  {
+    "field": {
+      "displayName": "ID",
+      "jsonPath": "$PREFIXED_ID",
+    },
+    "score": 109.1,
+    "str": "SO:0000001",
+    "term": {
+      "id": "http://purl.obolibrary.org/obo/SO_0000001",
+      "lbl": "region",
+      "meta": {
+        "basicPropertyValues": [
+          {
+            "pred": "http://www.geneontology.org/formats/oboInOwl#hasOBONamespace",
+            "val": "sequence",
+          },
+        ],
+        "definition": {
+          "val": "A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids. It may also be termed a region of some number of nucleotides.",
+          "xrefs": [
+            "SO:ke",
+          ],
+        },
+        "subsets": [
+          "http://purl.obolibrary.org/obo/so#SOFA",
+        ],
+        "synonyms": [
+          {
+            "pred": "hasExactSynonym",
+            "val": "sequence",
+          },
+        ],
+      },
+      "type": "CLASS",
+    },
+    "wordMatches": [
+      {
+        "position": 0,
+        "wordIndex": 0,
+      },
+    ],
+  },
+]
+`;
+
+exports[`elaborateMatch can do one 1`] = `
+[
+  {
+    "field": {
+      "displayName": "definition",
+      "jsonPath": "$.meta.definition.val",
+    },
+    "score": 208.39346153846154,
+    "str": "A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids. It may also be termed a region of some number of nucleotides.",
+    "term": {
+      "id": "http://purl.obolibrary.org/obo/SO_0000001",
+      "lbl": "region",
+      "meta": {
+        "basicPropertyValues": [
+          {
+            "pred": "http://www.geneontology.org/formats/oboInOwl#hasOBONamespace",
+            "val": "sequence",
+          },
+        ],
+        "definition": {
+          "val": "A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids. It may also be termed a region of some number of nucleotides.",
+          "xrefs": [
+            "SO:ke",
+          ],
+        },
+        "subsets": [
+          "http://purl.obolibrary.org/obo/so#SOFA",
+        ],
+        "synonyms": [
+          {
+            "pred": "hasExactSynonym",
+            "val": "sequence",
+          },
+        ],
+      },
+      "type": "CLASS",
+    },
+    "wordMatches": [
+      {
+        "position": 55,
+        "wordIndex": 0,
+      },
+      {
+        "position": 66,
+        "wordIndex": 1,
+      },
+      {
+        "position": 112,
+        "wordIndex": 1,
+      },
+      {
+        "position": 171,
+        "wordIndex": 1,
+      },
+      {
+        "position": 196,
+        "wordIndex": 0,
+      },
+    ],
+  },
+]
+`;
+
+exports[`getWords can get the words from a test node 1`] = `
+[
+  [
+    "$PREFIXED_ID",
+    "so:0000001",
+  ],
+  [
+    "$.lbl",
+    "region",
+  ],
+  [
+    "$.meta.definition.val",
+    "sequence",
+  ],
+  [
+    "$.meta.definition.val",
+    "feature",
+  ],
+  [
+    "$.meta.definition.val",
+    "extent",
+  ],
+  [
+    "$.meta.definition.val",
+    "greater",
+  ],
+  [
+    "$.meta.definition.val",
+    "zero",
+  ],
+  [
+    "$.meta.definition.val",
+    "nucleotide",
+  ],
+  [
+    "$.meta.definition.val",
+    "region",
+  ],
+  [
+    "$.meta.definition.val",
+    "composed",
+  ],
+  [
+    "$.meta.definition.val",
+    "bases",
+  ],
+  [
+    "$.meta.definition.val",
+    "polypeptide",
+  ],
+  [
+    "$.meta.definition.val",
+    "region",
+  ],
+  [
+    "$.meta.definition.val",
+    "composed",
+  ],
+  [
+    "$.meta.definition.val",
+    "amino",
+  ],
+  [
+    "$.meta.definition.val",
+    "acids",
+  ],
+  [
+    "$.meta.definition.val",
+    "may",
+  ],
+  [
+    "$.meta.definition.val",
+    "also",
+  ],
+  [
+    "$.meta.definition.val",
+    "termed",
+  ],
+  [
+    "$.meta.definition.val",
+    "region",
+  ],
+  [
+    "$.meta.definition.val",
+    "number",
+  ],
+  [
+    "$.meta.definition.val",
+    "nucleotides",
+  ],
+  [
+    "$.meta.synonyms[*].val",
+    "sequence",
+  ],
+]
+`;