check for newlines when concat fastas

[hoelzer]

Command error:
  [E::fai_build_core] Different line length in sequence 'NC_008066.1'
  [faidx] Could not build fai index db.fa.gz.fai

This happend to me while using phix and providing two mtDNA FASTAs from NCBI. For DCS it was working though.

So I assume that the problem is that the integrated phiX FASTA has different line lengths as the two mtDNA FASTAs from NCBI

[hoelzer]

Hm, but actually the phix.fasta seems fine w/ the same line lengths... not sure

[hoelzer]

figured it:

>NC_053523.1 Gallus gallus isolate bGalGal1 mitochondrion, complete sequence, whole genome shotgun sequence
>NC_008066.1 Chlorocebus sabaeus mitochondrion, complete genome
CACGTTCCTCTTAAATAAGACATCTCGATG>gi|9626372|ref|NC_001422.1| Enterobacteria phage phiX174 sensu lato, complete genome

maybe it's good to add a newline to the FASTAs before cat!

[hoelzer]

DCS likely worked because it's not cated as the last file ;)

[MarieLataretu]

AAAha, now I get it. There was no newline at the end of the custom FASTA, right?

[hoelzer]

AAAha, now I get it. There was no newline at the end of the custom FASTA, right?

yes! And that caused samtools to fail obviously.

(srry if this was unclear, did this yesterday while netflixing ;) )

So basically we could implement that for each own FASTA a user provides an additional newline is added, just in case.

[MarieLataretu]

yeah, we check for bgzip compression anyway, that can happen also there!