Merge back 'dev' on 'master' for 1.4.0 release

.gitignore

@@ -3,6 +3,11 @@
 .project
 .settings/*
 
+# Ignore Netbeans config files
+nbproject
+tests
+
+
 # Ignore the compiled object files
 *.o
 *.gcno

CHANGELOG

@@ -4,6 +4,19 @@ brevity.  Much more detail can be found in the git revision history:
 
     https://github.com/qmarcou/IGoR
 
+* 1.4.0 (April 2, 2020)
+
+  A brief description of the release content's
+
+  New features:
+  - Add new file with CDR3 segments 
+  - Add new option -getdatadir to output the path of default models directory
+  - New IGL and IGK models for humans
+
+  Miscellaneous :
+  - New script igor-compute_pgen to calculate pgen for a single sequence
+
+
 * 1.3.0 (August 4, 2018)
 
   A brief description of the release content's

Makefile.am

@@ -16,6 +16,7 @@ man_MANS = igor.1
 bin_SCRIPTS = \
   scripts/igor-compute_pgen
 
+
 install-data-local:
 	mkdir -p $(DESTDIR)$(pkgdatadir)/models
 	cp -r models/* $(DESTDIR)$(pkgdatadir)/models

docs/asciidoc/alignments/alignment_commands.adoc

@@ -7,12 +7,20 @@ switch in the command line. For each gene, alignment parameters can be
 set using `--V`,`--D` or `--J`. *Specifying any of those three argument
 will cause to align only the specified genes*. In order to specify a set
 of parameters for all genes or force to align all genes the argument
-`--all` should be passed. The arguments for setting the different
+`--all` should be passed.
+
+The complementarity-determining region (CDR3) of the aligned sequences is
+by default written on a file <batchname>_indexed_CDR3.csv in the aligns
+directory when `--all` is used. In case of separated alignments the CDR3 file
+can be generated by using the `--feature ---ntCDR3` option.
+
+The arguments for setting the different
 parameters are given in the table below.
 If the considered sequences are nucleotide CDR3 sequences (delimited by 
 its anchors on 3' and 5' sides) using the command `--ntCDR3` alignments will
 be performed using gene anchors information as offset bounds.
 
+
 [width="99%",cols="<32%,<68%",options="header",]
 |=======================================================================
 |Command line argument |Description

docs/asciidoc/alignments/alignments_output.adoc

@@ -37,3 +37,25 @@ the genomic template)
 |3_p_align_offset |Offset of the last nucleotide of the SW alignemnt
 (relative to the read)
 |=======================================================================
+
+
+
+The CDR3 files are semicolon separated files. For each IGoR indexed 
+sequence the following fields are given:
+[width="99%",cols="<32%,<68%",options="header",]
+|=======================================================================
+|Field |Description
+|seq_index |The sequence index the alignment corresponds to in the
+_indexed_sequences.csv_ file.
+
+|v_anchor | Position of the V anchor (first nucleotide of 2nd-CYS codon) relative to the read sequence. 
+
+|j_anchor | Position of the J anchor (last nucleotide of J-PHE or J-TRP codon) relative to the read sequence. 
+
+|CDR3nt | Nucleotide CDR3 sequence of the indexed sequence.
+
+|CDR3aa | Amino acids CDR3 sequence of the indexed sequence.
+
+|=======================================================================
+
+TIP: Anchors positions are 0 based indices relative to the read sequence.

docs/asciidoc/general/general_commands.adoc

@@ -15,3 +15,6 @@ General
 ~~~~~~~
 
 include::general_command_lines.adoc[]
+
+include::scripts.adoc[]
+

docs/asciidoc/general/scripts.adoc

@@ -0,0 +1,19 @@
+[[scripts]]
+Bash scripts
+^^^^^^^^^^^^
+
+A set of bash scripts for common tasks using igor.
+We can use igor-compute_pgen to calculate the Pgen of
+a specific sequence.
+
+[source,shell]
+----
+igor-compute_pgen <specie> <chain> <ntsequence>
+----
+Example
+
+[source,shell]
+----
+igor-compute_pgen human beta actcagctttgtatttctgtgccagcagcgtagattgggacagggggcctcctacgagcagtacgtcgggccg
+----
+

docs/asciidoc/general/workflow/supplied_models_table.adoc

@@ -1,6 +1,6 @@
 [cols="<,<",options="header",]
 |=======================
 |Species |Chains
-|human |alpha, beta, heavy
-|mouse |beta
+|human |TRA (or alpha), TRB (or beta), IGH (or heavy chain), IGL (or lambda light chain), IGK (or kappa light chain)
+|mouse |TRB (or beta)
 |=======================

igor_src/CDR3SeqData.cpp

@@ -0,0 +1,62 @@
+/*
+ * File:   CDR3SeqData.cpp
+ *
+ *      Author: Carlos Olivares
+ * 
+ *  This source code is distributed as part of the IGoR software.
+ *  IGoR (Inference and Generation of Repertoires) is a versatile software to analyze and model immune receptors
+ *  generation, selection, mutation and all other processes.
+ *   Copyright (C) 2017- Quentin Marcou, 2019 - Carlos Olivares
+ *
+ *   This program is free software: you can redistribute it and/or modify
+ *   it under the terms of the GNU General Public License as published by
+ *   the Free Software Foundation, either version 3 of the License, or
+ *   (at your option) any later version.
+ *
+ *   This program is distributed in the hope that it will be useful,
+ *   but WITHOUT ANY WARRANTY; without even the implied warranty of
+ *   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ *   GNU General Public License for more details.
+
+ *   You should have received a copy of the GNU General Public License
+ *   along with this program.  If not, see <https://www.gnu.org/licenses/>.
+ *
+ */
+
+#include <string>
+
+#include "CDR3SeqData.h"
+
+CDR3SeqData::CDR3SeqData() {
+	seq_index = -1;
+	v_anchor  = -1;
+	j_anchor  = -1;
+	CDR3nt    = "";
+	CDR3aa    = "";
+}
+
+//CDR3SeqData::CDR3SeqData(int seq_index, int v_anchor, int j_anchor ) {
+//	seq_index = seq_index;
+//	v_anchor  = v_anchor;
+//	j_anchor  = j_anchor;
+//	CDR3nt    = "";
+//	CDR3aa    = "";
+//}
+
+CDR3SeqData::CDR3SeqData(const CDR3SeqData& orig) {
+}
+
+CDR3SeqData::~CDR3SeqData() {
+}
+
+
+std::string CDR3SeqData::strData(){
+	std::string delimiter = ";";
+	return  std::to_string(seq_index) + delimiter +
+					std::to_string(v_anchor ) + delimiter +
+					std::to_string(j_anchor ) + delimiter +
+					CDR3nt + delimiter +
+					CDR3aa;	
+}
+
+

igor_src/CDR3SeqData.h

@@ -0,0 +1,29 @@
+
+/** 
+ * \class CDR3SeqData CDR3SeqData.h
+ * \brief Class to store CDR3 information of a sequence.
+ * \author C. Olivares
+ * 
+ */
+
+#ifndef CDR3SEQDATA_H
+#define CDR3SEQDATA_H
+
+class CDR3SeqData {
+public:
+    CDR3SeqData();
+    CDR3SeqData(const CDR3SeqData& orig);
+    virtual ~CDR3SeqData();
+    int seq_index;
+    int v_anchor;
+    int j_anchor;
+    std::string CDR3nt;
+    std::string CDR3aa;
+    std::string strData();
+
+private:
+
+};
+
+#endif /* CDR3SEQDATA_H */
+

igor_src/Counter.cpp

@@ -27,22 +27,15 @@
 
 using namespace std;
 
-Counter::Counter(string path): Counter(path,false){
-
-}
-
-Counter::Counter(string path , bool last_iter):path_to_file(path),last_iter_only(last_iter),fstreams_created(false){
-	//Make sure the given path is a folder
-	if (path_to_file[path_to_file.size()-1] != '/'){
-		path_to_file+="/";
-	}
-}
-
 /*
  * By default the counter will be output in /tmp
  * I hope you're using a UNIX based system
  */
-Counter::Counter(): Counter("/tmp/") {
+Counter::Counter(const string& path /* = "/tmp/"*/, bool last_iter /* = false*/):path_to_file(path),last_iter_only(last_iter),fstreams_created(false){
+	//Make sure the given path is a folder
+	if (path_to_file.back() != '/'){
+		path_to_file.push_back('/');
+	}
 }
 
 Counter::~Counter() {

igor_src/Counter.h

@@ -46,9 +46,7 @@
  */
 class Counter {
 public:
-	Counter();
-	Counter(std::string);
-	Counter(std::string , bool);
+	Counter(const std::string& path = "/tmp/", bool last_iter = false);
 	virtual ~Counter();
 
 	virtual std::string type() const =0;