Skip to content

Latest commit

 

History

History
50 lines (37 loc) · 3.51 KB

Unix_02_problemset.md

File metadata and controls

50 lines (37 loc) · 3.51 KB
Raw

Unix 2 Problem Set

  1. If you have not already done so, follow Steps 1-3 in Unix: GIT for Beginners. Here is a summary of those steps, Please go to lecture for detailed steps:

    • Create a GitHub Account and Click "New" to create a new repository.
    • Add info about your repository
    • Please see the lecture notes for more detailed steps. In summary you will be doing the following: Create a local (your machine) directory with mkdir <dirname>, move into the new directory with cd <dirname> and set it up as a repository with git init. Now link it to your remote repository with git remote add.

  2. Move any files you created in Unix_01 Problem set to your local problemset git repository.

  3. Add all the new files in your local repository to your remote repository

    • git add * . You can use git add <filename> if you only want to add one file.
    • git commit -m 'adding previous problem set files'
    • git push
    • Visit the your GitHub repository website (on github.com) and see the files from your local repository that you just pushed up to your remote repository.

  4. If you are tired of typing your github username and password create and add an ssh key to your github account. Information can be found here on github.com. Follow the instructions for these two steps in the turorial.

  5. Create a directory call files in your ProblemSets directory.

  6. Move the file you renamed from sequences.nt.fa to cancer_genes.fasta to your files directory

  7. ADD/COMMIT/PUSH cancer_genes.fasta to your remote repository

  • git add files/cancer_genes.fasta
  • git commit -m 'adding cancer_genes.fasta'
  • git push
  • Visit the your GitHub repository website (on github.com) and see the file from your local repository that you just pushed up to your remote repository.
  1. Using your text editor (nano is a good one to start with) create a fasta file and name it mysequences.txt. Make sure it ends up in your problem sets files directory.

This is fasta file format:

>seqName description
ATGGCGTCTTGGCCTTAAAAGCTC

  1. ADD/COMMIT/PUSH mysequences.txt to your remote.

  2. Create a directory called fastas. (Hint: use mkdir)

  3. Copy the fasta file that you renamed to cancer_genes.fasta to the fasta directory.

  4. Verify that the file is within the fasta directory.

  5. Delete the the original file that you used for copying.

  6. Sync your remote repo with your local repo. Make sure to add each file you changed or use git add all *. Don't forget to commit and push.

  7. Read the man page for rm and cp to find out how to remove and copy a directory.

  8. Print out your history and redirect it to a file called unixBasics.history.txt

  9. Open this file with your text editor and delete any lines you do not want to keep. See this google search for info on delete entire lines in nano.

  10. Make sure all your files are synced with your remote repository.