Debug barcode start site

README.md

@@ -90,7 +90,7 @@ See full detail in [Parameters](#parameters).
 File should contain following columns. 
 * `name`: gRNA ID column
 * `sequence`: gRNA sequence
-* `barcode`: R2 barcode to help match reporter to gRNA
+* `barcode`: R2 barcode to help match reporter to gRNA, written in the sense direction (as in R1)
 * In order to use accessibility in the [variant effect quantification](#bean-run-quantify-variant-effects), provide accessibility information in one of two options. (For non-targeting guides, provide NA values (empty cell).)   
   * Option 1: `chrom` & `genomic_pos`: Chromosome (ex. `chr19`) and genomic position of guide sequence. You will have to provide the path to the bigwig file with matching reference version in `bean-run`. 
   * Option 2: `accessibility_signal`: ATAC-seq signal value of the target loci of each guide.  
@@ -153,6 +153,7 @@ Read structure
 * `--barcode-start-seq` (default: ''): Barcode + reporter starts after this sequence in R2, denoted as the sense direction (the same sequence direction as R1).
 * `--guide-start-seqs-file` (default: `None`): CSV file path with per-sample `guide_start_seq` to be used, if provided. Formatted as `sample_id, guide_start_seq` 
 * `--guide-end-seqs-file` (default: `None`): CSV file path with per-sample `guide_end_seq` to be used, if provided. Formatted as `sample_id,guide_end_seq` 
+* `--guide-start-seqs-file` (default: `None`): CSV file path with per-sample `barcode_start_seq` to be used, if provided. Formatted as `sample_id, guide_start_seq` 
 * `-l`, `--reporter-length` (default: `32`): Length of the reporter sequence.
 * `--gstart-reporter` (default: `6`): Start position of the guide sequence in the reporter
 * `--guide-bc` (default: `True`): Construct has guide barcode 

bean/mapping/GuideEditCounter.py

@@ -47,7 +47,7 @@ class NoReadsAfterQualityFiltering(Exception):
 
 
 strand_str_to_int = {"neg": -1, "pos": 1, "-": -1, "+": 1}
-
+base_revcomp = {"A":"T", "T":"A", "G":"C", "C":"G"}
 
 def _get_stranded_guide_offset(strand: int, start_pos: int, guide_len: int) -> int:
     if strand == -1:
@@ -652,16 +652,15 @@ def get_reporter_seq_qual(self, R2_record: SeqIO.SeqRecord, R2_start = 0):
 
     def get_barcode(self, R1_seq, R2_seq):
         if self.barcode_start_seq != "":
-            barcode_start_idx = revcomp(R2_seq).replace(
-                self.base_edited_from, self.base_edited_to
-            ).find(
-                self.barcode_start_seq.replace(self.base_edited_from, self.base_edited_to)
-            )
+            barcode_start_idx = R2_seq.replace(
+                base_revcomp[self.base_edited_from], base_revcomp[self.base_edited_to]
+            ).find(revcomp(self.barcode_start_seq).replace(base_revcomp[self.base_edited_from], base_revcomp[self.base_edited_to]))
             if barcode_start_idx == -1:
                 return -1, ""
+            barcode_start_idx += len(self.barcode_start_seq)
         else: 
             barcode_start_idx = 0
-        return barcode_start_idx, revcomp(R2_seq[barcode_start_idx: self.guide_bc_len])
+        return barcode_start_idx, revcomp(R2_seq[barcode_start_idx: (barcode_start_idx + self.guide_bc_len)])
 
     def _match_read_to_sgRNA_bcmatch_semimatch(self, R1_seq: str, R2_seq: str):
         # This should be adjusted for each experimental recipes.

tests/test_count.py

@@ -1,5 +1,8 @@
 import pytest
 import subprocess
+from bean.mapping import GuideEditCounter
+from bean.mapping.utils import _get_input_parser
+from bean.mapping._supporting_fn import revcomp
 
 
 @pytest.mark.order(2)
@@ -52,6 +55,15 @@ def test_count_samples_bcstart():
     except subprocess.CalledProcessError as exc:
         raise exc
 
+def test_barcode_start_idx():
+    args = vars(_get_input_parser().parse_args(["-b", "A", "-f", "tests/data/test_guide_info.csv",]))
+    args["barcode_start_seq"] = "gtttgaattcgctagctaggtcttg"
+    args["R1"] = "tests/data/test_R1.fastq"
+    args["R2"] = "tests/data/test_R2.fastq"
+    gc = GuideEditCounter(**args)
+    sidx, bc = gc.get_barcode("", revcomp("agtggcaccgagtcggtgcttttttTAACAGTGTAATCTGGCGAGCCACTGTTCTTTGTACCAGAAgtttgaattcgctagctaggtcttgctgg".upper()))
+    assert sidx == 29
+    assert bc == "AGAA"
 
 @pytest.mark.order(6)
 def test_count_samples_tiling():