Issue in Prime Editing command

[bnouyou]

Hello,

I am using CRISPResso2 for prime editing.
This is the command:

    CRISPResso \
                    --fastq_r1 $FASTQ_R1 \
                    --fastq_r2 $FASTQ_R2 \
                    --amplicon_seq ATGTGGGCTGCCTAGAAAGGcatggatgagagaagcctggagacagggatcccagggaaacgcccatgcaattagtctatttctgctgcaagtaagcatgcatttgtaggcttgatgctttttttctgcttctccagccctggcctgggtcaatccttggggcccagactgagcacgtgatggcagaggaaaggaagccctgcttcctccagagggcgtcgcaggacagcttttcctagacaggggctagtatgtgcagctcctgcaccgggatactGGTTGACAAGTTTGGCTGGG \
                    --prime_editing_pegRNA_spacer_seq GGCCCAGACTGAGCACGTGA \
                    --prime_editing_pegRNA_extension_seq TCTGCCATCAAAGCGTGCTCAGTCTG \
                    --prime_editing_pegRNA_scaffold_seq GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTCC \
                    --output_folder output_folder \
                    --name output_name \

I have this error message:

CRITICAL @ Wed, 22 Dec 2021 16:02:28:
         Parameter error, please check your input.

ERROR: The prime editing pegRNA spacer sequence appears to be given in the 3'->5' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order.

Do you know what is the problem ?

Thank you in advance for your help.

[Colelyman]

Hi @bnouyou,

Thanks for using CRISPResso2! This error appears when the prime_editing_pegRNA_spacer_seq aligns better to the reverse complement of the amplicon than to provided amplicon sequence. I would suggest using the reverse complement of the prime_editing_pegRNA_spacer_seq to make sure that you are giving it in the correct order (5'->3').

Thanks,
Cole

[bnouyou]

Hello,

Actually, without changing the spacer sequence, if I remove the arguments for --prime_editing_pegRNA_extension_seq and --prime_editing_pegRNA_scaffold_seq then I have no error.
Do you know how can I make this working ?

Thank you for your help.

[bnouyou]

Hello,

I have tried with the reverse complement of the prime_editing_pegRNA_spacer_seq, and I still have the same error when I provide the extension sequence.

This is the error I have with --debug:

Traceback (most recent call last):
  File "/seqr/mambaforge/envs/crispresso2_env/lib/python3.9/site-packages/CRISPResso2/CRISPRessoCORE.py", line 1097, in main
    raise CRISPRessoShared.BadParameterException('The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.')
CRISPResso2.CRISPRessoShared.BadParameterException: The prime editing pegRNA spacer sequence appears to be given in the 3'->5' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order.

By the way, I am using CRISPResso version 2.2.6, installed with Conda.

Thank you in advance for your help.

[bnouyou]

I think I have found the problem. It seems that this issue is raised when the amplicon sequence provided is not completely written in uppercase. After changing this, everything works fine.

[kclem]

Thanks @bnouyou . I've fixed this in the last commit, so this shouldn't be a problem in the future.