Merge pull request #771 from nf-core/dev

Release 2.11.0

CHANGELOG.md

@@ -3,6 +3,29 @@
 The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/)
 and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
 
+## nf-core/ampliseq version 2.11.0 - 2024-08-06
+
+### `Added`
+
+- [#765](https://github.com/nf-core/ampliseq/pull/765) - Added version R09-RS220 of curated GTDB 16S taxonomy: `sbdi-gtdb=R09-RS220-1` or `sbdi-gtdb` as parameter to `--dada_ref_taxonomy`
+- [#766](https://github.com/nf-core/ampliseq/pull/766) - Added version 10 of Unite as parameter for `--sintax_ref_taxonomy`: `unite-fungi=10.0` and `unite-alleuk=10.0`
+
+### `Changed`
+
+- [#762](https://github.com/nf-core/ampliseq/pull/762) - Improved output documentation section "Optional ASV filtering" and parameter documentation
+- [#766](https://github.com/nf-core/ampliseq/pull/766) - Modified warning filenames from `QIIME2_ANCOM` to avoid collisions
+- [#766](https://github.com/nf-core/ampliseq/pull/766),[#769](https://github.com/nf-core/ampliseq/pull/769) - Disabled Unite databases from the `--qiime_ref_taxonomy` because of divergent results compared to the other classifiers
+
+### `Fixed`
+
+- [#761](https://github.com/nf-core/ampliseq/pull/761) - Some sample sheet checks were not applied due to changes in the metadata ["meta"] structure in version 2.9.0
+- [#766](https://github.com/nf-core/ampliseq/pull/766) - Fixed broken urls for Unite databases (issue [#764](https://github.com/nf-core/ampliseq/issues/764))
+- [#769](https://github.com/nf-core/ampliseq/pull/769) - Reference taxonomy database values were not properly validated in versions 2.9.0 and 2.10.0
+
+### `Dependencies`
+
+### `Removed`
+
 ## nf-core/ampliseq version 2.10.0 - 2024-06-27
 
 ### `Added`

assets/multiqc_config.yml

@@ -1,7 +1,7 @@
 report_comment: >
-  This report has been generated by the <a href="https://github.com/nf-core/ampliseq/releases/tag/2.10.0" target="_blank">nf-core/ampliseq</a>
+  This report has been generated by the <a href="https://github.com/nf-core/ampliseq/releases/tag/2.11.0" target="_blank">nf-core/ampliseq</a>
   analysis pipeline. For information about how to interpret these results, please see the
-  <a href="https://nf-co.re/ampliseq/2.10.0/docs/output" target="_blank">documentation</a>.
+  <a href="https://nf-co.re/ampliseq/2.11.0/docs/output" target="_blank">documentation</a>.
 report_section_order:
   "nf-core-ampliseq-methods-description":
     order: -1000

assets/report_template.Rmd

@@ -1544,7 +1544,7 @@ for (folder in ancom) {
 any_ancombc <- !isFALSE(params$ancombc) || !isFALSE(params$ancombc_formula)
 ```
 
-```{r, eval = !isFALSE(params$any_ancombc), results='asis'}
+```{r, eval = !isFALSE(any_ancombc), results='asis'}
 cat(paste0("
 ## ANCOM-BC
 

bin/taxref_reformat_sintax.sh → bin/taxref_reformat_sintax_fasta.sh

@@ -5,4 +5,3 @@
 # Just rename the preformatted file
 # Assumes only one (gzipped) file
 mv * sintaxdb.fa.gz
-

bin/taxref_reformat_sintax_tar.sh

@@ -0,0 +1,13 @@
+#!/bin/sh
+
+# Handles preformatted database tar files suitable for sintax
+#
+# This turned out to be a MISTAKE and is NOT USED, but I'm keeping the file for a while anyway.
+
+# Extract the fasta file without _dev in its name
+f=$(tar tfz *.tgz | grep fasta | grep -v '_dev')
+tar xzf *.tgz $f
+
+# Change the name and gzip
+mv $f sintaxdb.fa
+gzip sintaxdb.fa

conf/test_its_dada_taxonomy.config

@@ -0,0 +1,50 @@
+/*
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+    Nextflow config file for running minimal tests
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+    Defines input files and everything required to run a fast and simple pipeline test.
+
+    Use as follows:
+        nextflow run nf-core/ampliseq -profile test_sintax,<docker/singularity> --outdir <OUTDIR>
+
+----------------------------------------------------------------------------------------
+*/
+
+params {
+    config_profile_name = 'Test sintax profile'
+    config_profile_description = 'Minimal test dataset to check pipeline function for ITS data with the DADA2 taxonomy classifier'
+
+    // Limit resources so that this can run on GitHub Actions
+    max_cpus   = 2
+    max_memory = '12.GB'
+    max_time   = '6.h'
+
+    // Input data
+    FW_primer = "CTTGGTCATTTAGAGGAAGTAA"
+    RV_primer = "TCCTGAGGGAAACTTCG"
+    input = params.pipelines_testdata_base_path + "ampliseq/samplesheets/Samplesheet_pacbio_ITS.tsv"
+    metadata = params.pipelines_testdata_base_path + "ampliseq/samplesheets/Metadata_pacbio_ITS.tsv"
+    pacbio = true
+    max_ee = 12
+    cut_its = "its2"
+
+    skip_dada_taxonomy = false
+    dada_ref_taxonomy = "unite-fungi"
+
+    //this is to remove low abundance ASVs to reduce runtime of downstream processes
+    min_samples = 2
+    min_frequency = 10
+
+    //produce average barplots
+    metadata_category_barplot = "var2,var3"
+
+    //restrict ANCOM analysis to higher taxonomic levels
+    tax_agglom_max = 4
+    ancom = true
+
+    sbdiexport = true
+
+    qiime_adonis_formula = "var2"
+
+    diversity_rarefaction_depth = 500
+}

docs/output.md

@@ -23,7 +23,7 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d
   - [Cutadapt](#cutadapt) - Primer trimming
   - [MultiQC](#multiqc) - Aggregate report describing results
 - [ASV inferrence with DADA2](#asv-inferrence-with-dada2) - Infer Amplicon Sequence Variants (ASVs)
-- [Optional ASV filtering](#optional-asv-filtering) - Filter ASVs to optimize downstream analysis
+- [Optional ASV post processing](#optional-asv-post-processing) - Filter ASVs to optimize downstream analysis
   - [VSEARCH cluster](#vsearch-cluster) - Centroid fasta file, filtered asv table, and stats
   - [Barrnap](#barrnap) - Predict ribosomal RNA sequences and optional filtering
   - [Length filter](#length-filter) - Optionally, ASV can be filtered by length thresholds
@@ -163,7 +163,9 @@ For binned quality scores in NovaSeq data, monotonicity in the fitted error mode
 
 </details>
 
-### Optional ASV filtering
+### Optional ASV post processing
+
+ASV post-processing takes place after DADA2's ASV computation (i.e. after chimera removal, for example table `ASV_tax.tsv`) but _before_ taxonomic classification. Post-processing will affect all downstream files. Clustering and filters are applied sequentially, in the same sequence as shown here. All filters are off by default and can be enabled by setting thresholds as detailed in the parameter documentation.
 
 #### VSEARCH cluster
 
@@ -184,7 +186,7 @@ This directory will hold the centroid fasta file, the filtered asv count table (
 
 Barrnap predicts the location of ribosomal RNA genes in genomes, here it can be used to discriminate rRNA sequences from potential contamination. It supports bacteria (5S,23S,16S), archaea (5S,5.8S,23S,16S), metazoan mitochondria (12S,16S) and eukaryotes (5S,5.8S,28S,18S).
 
-Optionally, ASV sequences can be filtered for rRNA sequences identified by Barrnap with `--filter_ssu` that can take a list of abbreviations of the above supported categories (kingdoms), e.g. `bac,arc,mito,euk`. This filtering takes place after DADA2's ASV computation (i.e. after chimera removal) but _before_ taxonomic classification (also applies to above mentioned taxonomic classification with DADA2, i.e. files `ASV_tax.tsv` & `ASV_tax_species.tsv`).
+Optionally, ASV sequences can be filtered for rRNA sequences identified by Barrnap with `--filter_ssu` that can take a list of abbreviations of the above supported categories (kingdoms), e.g. `bac,arc,mito,euk`.
 
 <details markdown="1">
 <summary>Output files</summary>
@@ -200,7 +202,7 @@ Optionally, ASV sequences can be filtered for rRNA sequences identified by Barrn
 
 #### Length filter
 
-Optionally, a length filter can be used to reduce potential contamination after ASV computation. For example with 515f and 806r primers the majority of 16S rRNA amplicon sequences should have a length of 253 bp and amplicons vary significantely are likely spurious.
+Optionally, a length filter can be used to reduce potential contamination after ASV computation. For example with 515f and 806r primers the majority of 16S rRNA amplicon sequences should have a length of 253 bp and amplicons that differ significantly from this are likely spurious.
 
 The minimum ASV length threshold can be set by `--min_len_asv` and the maximum length threshold with `--max_len_asv`. If no threshold is set, the filter (and output) is omitted.
 

docs/usage.md

@@ -229,8 +229,8 @@ Pre-configured reference taxonomy databases are:
 | greengenes   | -     | -      | +       | (+)²   | 16S rRNA                                      |
 | greengenes2  | -     | -      | -       | +      | 16S rRNA                                      |
 | pr2          | +     | -      | -       | -      | 18S rRNA                                      |
-| unite-fungi  | +     | +      | -       | +      | eukaryotic nuclear ribosomal ITS region       |
-| unite-alleuk | +     | +      | -       | +      | eukaryotic nuclear ribosomal ITS region       |
+| unite-fungi  | +     | +      | -       | -      | eukaryotic nuclear ribosomal ITS region       |
+| unite-alleuk | +     | +      | -       | -      | eukaryotic nuclear ribosomal ITS region       |
 | coidb        | +     | +      | -       | -      | eukaryotic Cytochrome Oxidase I (COI)         |
 | midori2-co1  | +     | -      | -       | -      | eukaryotic Cytochrome Oxidase I (COI)         |
 | phytoref     | +     | -      | -       | -      | eukaryotic plastid 16S rRNA                   |

modules/local/qiime2_ancom_tax.nf

@@ -43,7 +43,7 @@ process QIIME2_ANCOM_TAX {
         --to-tsv
 
     if [ \$(grep -v '^#' -c ${table.baseName}-level-${taxlevel}.feature-table.tsv) -lt 2 ]; then
-        echo ${taxlevel} > ancom/\"WARNING Summing your data at taxonomic level ${taxlevel} produced less than two rows (taxa), ANCOM can't proceed -- did you specify a bad reference taxonomy?\".txt
+        echo ${taxlevel} > ancom/\"WARNING ${table.baseName} Summing your data at taxonomic level ${taxlevel} produced less than two rows (taxa), ANCOM can't proceed -- did you specify a bad reference taxonomy?\".txt
     else
         qiime composition add-pseudocount \\
                 --i-table lvl${taxlevel}-${table} \\

nextflow.config

@@ -284,21 +284,22 @@ profiles {
         executor.cpus           = 4
         executor.memory         = 8.GB
     }
-    test               { includeConfig 'conf/test.config'               }
-    test_single        { includeConfig 'conf/test_single.config'        }
-    test_multi         { includeConfig 'conf/test_multi.config'         }
-    test_doubleprimers { includeConfig 'conf/test_doubleprimers.config' }
-    test_pacbio_its    { includeConfig 'conf/test_pacbio_its.config'    }
-    test_iontorrent    { includeConfig 'conf/test_iontorrent.config'    }
-    test_fasta         { includeConfig 'conf/test_fasta.config'         }
-    test_failed        { includeConfig 'conf/test_failed.config'        }
-    test_full          { includeConfig 'conf/test_full.config'          }
-    test_reftaxcustom  { includeConfig 'conf/test_reftaxcustom.config'  }
-    test_qiimecustom   { includeConfig 'conf/test_qiimecustom.config'   }
-    test_novaseq       { includeConfig 'conf/test_novaseq.config'       }
-    test_pplace        { includeConfig 'conf/test_pplace.config'        }
-    test_sintax        { includeConfig 'conf/test_sintax.config'        }
-    test_multiregion   { includeConfig 'conf/test_multiregion.config'   }
+    test                   { includeConfig 'conf/test.config'                   }
+    test_single            { includeConfig 'conf/test_single.config'            }
+    test_multi             { includeConfig 'conf/test_multi.config'             }
+    test_doubleprimers     { includeConfig 'conf/test_doubleprimers.config'     }
+    test_pacbio_its        { includeConfig 'conf/test_pacbio_its.config'        }
+    test_iontorrent        { includeConfig 'conf/test_iontorrent.config'        }
+    test_fasta             { includeConfig 'conf/test_fasta.config'             }
+    test_failed            { includeConfig 'conf/test_failed.config'            }
+    test_full              { includeConfig 'conf/test_full.config'              }
+    test_reftaxcustom      { includeConfig 'conf/test_reftaxcustom.config'      }
+    test_qiimecustom       { includeConfig 'conf/test_qiimecustom.config'       }
+    test_novaseq           { includeConfig 'conf/test_novaseq.config'           }
+    test_pplace            { includeConfig 'conf/test_pplace.config'            }
+    test_sintax            { includeConfig 'conf/test_sintax.config'            }
+    test_its_dada_taxonomy { includeConfig 'conf/test_its_dada_taxonomy.config' }
+    test_multiregion       { includeConfig 'conf/test_multiregion.config'       }
 }
 
 // Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile
@@ -356,7 +357,7 @@ manifest {
     description     = """Amplicon sequencing analysis workflow using DADA2 and QIIME2"""
     mainScript      = 'main.nf'
     nextflowVersion = '!>=23.04.0'
-    version         = '2.10.0'
+    version         = '2.11.0'
     doi             = '10.5281/zenodo.1493841,10.3389/fmicb.2020.550420'
 }
 

nextflow_schema.json

@@ -150,6 +150,7 @@
         "primer_removal": {
             "title": "Primer removal",
             "type": "object",
+            "description": "Spurious sequences sometimes lack primer sequences and primers introduce errors that can be removed in that step",
             "default": "",
             "properties": {
                 "retain_untrimmed": {
@@ -188,7 +189,7 @@
         "read_trimming_and_quality_filtering": {
             "title": "Read trimming and quality filtering",
             "type": "object",
-            "description": "",
+            "description": "Read trimming and quality filtering is supposed to reduce spurious results and aid error correction",
             "default": "",
             "properties": {
                 "trunclenf": {
@@ -271,6 +272,7 @@
         "asv_post_processing": {
             "title": "ASV post processing",
             "type": "object",
+            "description": "ASV post-processing takes place after ASV computation but before taxonomic assignment, it will affect all downstream processes",
             "default": "",
             "properties": {
                 "vsearch_cluster": {
@@ -370,21 +372,22 @@
                         "rdp",
                         "rdp=18",
                         "sbdi-gtdb",
-                        "sbdi-gtdb=R06-RS202-1",
-                        "sbdi-gtdb=R06-RS202-3",
-                        "sbdi-gtdb=R07-RS207-1",
+                        "sbdi-gtdb=R09-RS220-1",
                         "sbdi-gtdb=R08-RS214-1",
+                        "sbdi-gtdb=R07-RS207-1",
+                        "sbdi-gtdb=R06-RS202-3",
+                        "sbdi-gtdb=R06-RS202-1",
                         "silva",
                         "silva=132",
                         "silva=138",
                         "unite-alleuk",
-                        "unite-alleuk=8.2",
-                        "unite-alleuk=8.3",
                         "unite-alleuk=9.0",
+                        "unite-alleuk=8.3",
+                        "unite-alleuk=8.2",
                         "unite-fungi",
-                        "unite-fungi=8.2",
-                        "unite-fungi=8.3",
                         "unite-fungi=9.0",
+                        "unite-fungi=8.3",
+                        "unite-fungi=8.2",
                         "zehr-nifh",
                         "zehr-nifh=2.5.0"
                     ]
@@ -451,20 +454,7 @@
                     "type": "string",
                     "help_text": "Choose any of the supported databases, and optionally also specify the version. Database and version are separated by an equal sign (`=`, e.g. `silva=138`) . This will download the desired database and initiate taxonomic classification with QIIME2 and the chosen database.\n\nIf both, `--dada_ref_taxonomy` and `--qiime_ref_taxonomy` are used, DADA2 classification will be used for downstream analysis.\n\nThe following databases are supported:\n- SILVA ribosomal RNA gene database project - 16S rRNA\n- UNITE - eukaryotic nuclear ribosomal ITS region - ITS\n- Greengenes (only testing!)\n\nGenerally, using `silva`, `unite-fungi`, or `unite-alleuk` will select the most recent supported version. For testing purposes, the tiny database `greengenes85` (dereplicated at 85% sequence similarity) is available. For details on what values are valid, please either use an invalid value such as `x` (causing the pipeline to send an error message with all valid values) or see `conf/ref_databases.config`.",
                     "description": "Name of supported database, and optionally also version number",
-                    "enum": [
-                        "silva=138",
-                        "silva",
-                        "unite-fungi=8.3",
-                        "unite-fungi=8.2",
-                        "unite-fungi",
-                        "unite-alleuk=9.0",
-                        "unite-alleuk=8.3",
-                        "unite-alleuk=8.2",
-                        "unite-alleuk",
-                        "greengenes85",
-                        "greengenes2",
-                        "greengenes2=2022.10"
-                    ]
+                    "enum": ["silva=138", "silva", "greengenes85", "greengenes2", "greengenes2=2022.10"]
                 },
                 "qiime_ref_tax_custom": {
                     "type": "string",
@@ -517,14 +507,16 @@
                     "enum": [
                         "coidb",
                         "coidb=221216",
+                        "unite-fungi",
+                        "unite-fungi=10.0",
                         "unite-fungi=9.0",
                         "unite-fungi=8.3",
                         "unite-fungi=8.2",
-                        "unite-fungi",
+                        "unite-alleuk",
+                        "unite-alleuk=10.0",
                         "unite-alleuk=9.0",
                         "unite-alleuk=8.3",
-                        "unite-alleuk=8.2",
-                        "unite-alleuk"
+                        "unite-alleuk=8.2"
                     ]
                 },
                 "addsh": {
@@ -575,6 +567,7 @@
             "title": "ASV filtering",
             "type": "object",
             "default": "",
+            "description": "Filtering by taxonomy or abundance will affect all downstream analysis",
             "fa_icon": "fas fa-filter",
             "properties": {
                 "exclude_taxa": {
@@ -600,7 +593,7 @@
         "downstream_analysis": {
             "title": "Downstream analysis",
             "type": "object",
-            "description": "",
+            "description": "Metadata is used here to visualize data either for quality control or publication ready figures",
             "default": "",
             "fa_icon": "fas fa-bacteria",
             "properties": {
@@ -652,7 +645,7 @@
         "differential_abundance_analysis": {
             "title": "Differential abundance analysis",
             "type": "object",
-            "description": "",
+            "description": "Differential abundance analysis relies on provided metadata",
             "default": "",
             "fa_icon": "fas fa-bacteria",
             "properties": {
@@ -705,7 +698,7 @@
         "pipeline_report": {
             "title": "Pipeline summary report",
             "type": "object",
-            "description": "",
+            "description": "Customization of the pipeline report",
             "default": "",
             "properties": {
                 "report_template": {