-
Notifications
You must be signed in to change notification settings - Fork 128
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
[ancestral] Update test for root-seq arg behaviour
This test was modified to confirm my own understanding of the code which allowed the next set of commits (modifying `augur translate`). Rather than drop it, it's helpful to include it in the repo for future reference. This commit is related to <#1362>.
- Loading branch information
1 parent
aeb2c30
commit 9056148
Showing
2 changed files
with
59 additions
and
5 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
51 changes: 51 additions & 0 deletions
51
tests/functional/ancestral/data/simple-genome/nt_muts.no-ref-seq.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,51 @@ | ||
{ | ||
"annotations": { | ||
"nuc": { | ||
"end": 50, | ||
"start": 1, | ||
"strand": "+", | ||
"type": "source" | ||
} | ||
}, | ||
"generated_by": { | ||
"program": "augur", | ||
"version": "23.1.1" | ||
}, | ||
"mask": "00000000000000000000000000000000000000000000000000", | ||
"nodes": { | ||
"node_AB": { | ||
"muts": [ | ||
"A7G", | ||
"C14T", | ||
"T18C", | ||
"A33G", | ||
"A43T" | ||
], | ||
"sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAAGAACTACTTGTCCATAAA" | ||
}, | ||
"node_root": { | ||
"muts": [], | ||
"sequence": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA" | ||
}, | ||
"sample_A": { | ||
"muts": [ | ||
"G33C", | ||
"C39T" | ||
], | ||
"sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAACAACTATTTGTCCATAAA" | ||
}, | ||
"sample_B": { | ||
"muts": [ | ||
"G42A" | ||
], | ||
"sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAAGAACTACTTATCCATAAA" | ||
}, | ||
"sample_C": { | ||
"muts": [], | ||
"sequence": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA" | ||
} | ||
}, | ||
"reference": { | ||
"nuc": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA" | ||
} | ||
} |