[ancestral] Update test for root-seq arg behaviour

This test was modified to confirm my own understanding of the code which
allowed the next set of commits (modifying `augur translate`). Rather
than drop it, it's helpful to include it in the repo for future
reference. This commit is related to
<#1362>.

tests/functional/ancestral/cram/general.t

@@ -22,8 +22,12 @@ node-data JSON we diff against.
   >   "nt_muts.ref-seq.json"
   {}
 
-Same as above but without a root-sequence so no mutations inferred on the root node
-(and thus the inferred reference will be different)
+Same as above but without providing a `--root-sequence`. The effect of this on behaviour is:
+- The JSON['reference']['nuc'] is not actually the "reference", because we
+don't know what this is! Instead it's the inferred root-node sequence.
+See <https://github.com/nextstrain/augur/issues/1362> for more.
+- An array of 'muts' is still present on the root node, but it will never contain any
+mutations (as there's nothing to compare the root node to)
 
   $ ${AUGUR} ancestral \
   >  --tree "$TESTDIR/../data/simple-genome/tree.nwk" \
@@ -33,7 +37,6 @@ Same as above but without a root-sequence so no mutations inferred on the root n
 
 
   $ python3 "$TESTDIR/../../../../scripts/diff_jsons.py" \
-  >   "$TESTDIR/../data/simple-genome/nt_muts.ref-seq.json" \
-  >   "nt_muts.no-ref-seq.json" \
-  >   --exclude-paths "root['reference']['nuc']" "root['nodes']['node_root']['muts']"
+  >   "$TESTDIR/../data/simple-genome/nt_muts.no-ref-seq.json" \
+  >   "nt_muts.no-ref-seq.json"
   {}

tests/functional/ancestral/data/simple-genome/nt_muts.no-ref-seq.json

@@ -0,0 +1,51 @@
+{
+  "annotations": {
+    "nuc": {
+      "end": 50,
+      "start": 1,
+      "strand": "+",
+      "type": "source"
+    }
+  },
+  "generated_by": {
+    "program": "augur",
+    "version": "23.1.1"
+  },
+  "mask": "00000000000000000000000000000000000000000000000000",
+  "nodes": {
+    "node_AB": {
+      "muts": [
+        "A7G",
+        "C14T",
+        "T18C",
+        "A33G",
+        "A43T"
+      ],
+      "sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAAGAACTACTTGTCCATAAA"
+    },
+    "node_root": {
+      "muts": [],
+      "sequence": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA"
+    },
+    "sample_A": {
+      "muts": [
+        "G33C",
+        "C39T"
+      ],
+      "sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAACAACTATTTGTCCATAAA"
+    },
+    "sample_B": {
+      "muts": [
+        "G42A"
+      ],
+      "sequence": "AAAACAGAAATGCTCTGCGGGTAAAAAAAAAAGAACTACTTATCCATAAA"
+    },
+    "sample_C": {
+      "muts": [],
+      "sequence": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA"
+    }
+  },
+  "reference": {
+    "nuc": "AAAACAAAAATGCCCTGTGGGTAAAAAAAAAAAAACTACTTGACCATAAA"
+  }
+}