reversetranslate

The goal of reversetranslate is to provide a set of R functions to assist users in reverse translating an amino acid sequence to DNA nucleotides.

Installation

You can install the development version from GitHub with:

# install.packages("devtools")
devtools::install_github("greg-botwin/reversetranslate")

General Details

Users can supply their own Codon Frequency Table relevant to the organism they are most interested in simulating the reverse translation in or use one of the commonly desired options supplied. Users can also select between the following three different models of reverse translation depending on what assumptions you want to make regarding how redundant codons are chosen and your intended application.

1. proportional
2. equal
3. GC biased

The user may also choose to limit the inclusion of low frequency codons into the reverse translated nucleotide sequence.

The package currently maintains Codon Frequency Tables for:

• Homo sapiens
• Escherichia coli

Additional details on package functionality can be found by viewing the package vignette.

Example

Load Package

library(reversetranslate)

Example Amino Acid Sequence

minimal_aa_seq
#> [1] "XXXYXXXYYZ"

Example Codon Frequency Table

minimal_freq_tbl
#>   codon aa prop
#> 1   AAA  X  0.4
#> 2   GGG  X  0.4
#> 3   CCC  X  0.2
#> 4   TTT  Y  1.0
#> 5   GCT  Z  0.2
#> 6   ATG  Z  0.4
#> 7   AAC  Z  0.2
#> 8   CCC  Z  0.2

Example Reverse Translation

reverse_translate(amino_acid_seq = minimal_aa_seq, codon_tbl = minimal_freq_tbl,
                  limit = 0, model = "proportional")
#> Properly formated Codon Frequency Table
#> [1] "AAAAAAAAATTTAAACCCCCCTTTTTTCCC"

Support

This work was supported by Cedars-Sinai Precision Health.