This is an embeddable component that you can include into your website to add a Betacoronavirus sequence search.
The component sends search requests to EBI-backed API, run on EBI cloud infrastructure. It uses NHMMER, CMSCAN and also adds text search functionality, backed by EBI Lucene text search plugin.
The sequences were extracted from the NCBI Blast database and the metadata was obtained from the associated INSDC entries.
This plugin is written in React/Redux. It is bundled as a Web Component, so it should not clash with your website's javascript or CSS.
Download this package directly from Github.
git clone https://github.com/covid19sequencesearch/covid19sequencesearch.github.io.git
Now you can add the component's javascript bundle (it contains all the styles and fonts) to your web page either directly or through an import with Webpack:
<script type="text/javascript" src="/covid19sequencesearch.github.io/dist/covid19-sequence-search.js"></script>
To use it just insert an html tag somewhere in your html:
<betacoronavirus-sequence-search databases='["betacoronavirus"]' />
To show some examples and/or enable the Rfam search, use:
<betacoronavirus-sequence-search
databases='["betacoronavirus"]'
examples='[
{"description": "2019-nCoV_N1-R primer", "urs": "", "sequence": "TCTGGTTACTGCCAGTTGAATCTG"}
]
rfam="true"
/>
You can also customise some elements of this embeddable component. See what you can change here. The example below changes the color of the buttons:
<betacoronavirus-sequence-search
databases='["betacoronavirus"]'
customStyle='{
"searchButtonColor": "#007c82",
"clearButtonColor": "#6c757d"
}'
/>
For a minimal example, see example.html.
Sequence search component accepts a number of attributes. You pass them as html attributes and their values are strings (this is a requirement of Web Components):
Parameters that you can use to customise some elements of this embeddable component
parameter | description |
---|---|
fixCss | fix the CSS. Use "fixCss": "true" if the button sizes are different |
linkColor | change the color of the links |
h3Color | change the color of the Similar sequences and Rfam classification text |
h3Size | change the size of the Similar sequences and Rfam classification text |
similarSeqText | change the Similar sequences text |
facetColor | change the color of the facet title |
facetSize | change the size of the facet title |
seqTitleSize | used in results, it changes the size of the title |
seqInfoColor | used in results, it changes the color of the text number of nucleotides |
seqInfoSize | used in results, it changes the size of the text number of nucleotides |
searchButtonColor | change the color of the Search button |
clearButtonColor | change the color of the Clear button |
uploadButtonColor | change the color of the Upload file button |
hideUploadButton | hide the Upload file button. Use "hideUploadButton": "true" to hide the button |
loadMoreButtonColor | change the color of the Load more button |
-
npm install
-
npm run serve
to start a server on http://localhost:8080/ -
npm run clean
to clean the dist folder of old assets -
npm run build
to generate a new distribution.