Skip to content

covid19sequencesearch/covid19sequencesearch.github.io

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Betacoronavirus sequence search embed

This is an embeddable component that you can include into your website to add a Betacoronavirus sequence search.

The component sends search requests to EBI-backed API, run on EBI cloud infrastructure. It uses NHMMER, CMSCAN and also adds text search functionality, backed by EBI Lucene text search plugin.

The sequences were extracted from the NCBI Blast database and the metadata was obtained from the associated INSDC entries.

This plugin is written in React/Redux. It is bundled as a Web Component, so it should not clash with your website's javascript or CSS.

Installation

Download this package directly from Github.

git clone https://github.com/covid19sequencesearch/covid19sequencesearch.github.io.git

Now you can add the component's javascript bundle (it contains all the styles and fonts) to your web page either directly or through an import with Webpack:

<script type="text/javascript" src="/covid19sequencesearch.github.io/dist/covid19-sequence-search.js"></script>

To use it just insert an html tag somewhere in your html:

<betacoronavirus-sequence-search databases='["betacoronavirus"]' />

To show some examples and/or enable the Rfam search, use:

<betacoronavirus-sequence-search 
    databases='["betacoronavirus"]'
    examples='[
        {"description": "2019-nCoV_N1-R primer", "urs": "", "sequence": "TCTGGTTACTGCCAGTTGAATCTG"}
    ]
    rfam="true"
/>

You can also customise some elements of this embeddable component. See what you can change here. The example below changes the color of the buttons:

<betacoronavirus-sequence-search
    databases='["betacoronavirus"]'
    customStyle='{
      "searchButtonColor": "#007c82",
      "clearButtonColor": "#6c757d"
    }'
/>

For a minimal example, see example.html.

Attributes/parameters

Sequence search component accepts a number of attributes. You pass them as html attributes and their values are strings (this is a requirement of Web Components):

layout

Parameters that you can use to customise some elements of this embeddable component

parameter description
fixCss fix the CSS. Use "fixCss": "true" if the button sizes are different
linkColor change the color of the links
h3Color change the color of the Similar sequences and Rfam classification text
h3Size change the size of the Similar sequences and Rfam classification text
similarSeqText change the Similar sequences text
facetColor change the color of the facet title
facetSize change the size of the facet title
seqTitleSize used in results, it changes the size of the title
seqInfoColor used in results, it changes the color of the text number of nucleotides
seqInfoSize used in results, it changes the size of the text number of nucleotides
searchButtonColor change the color of the Search button
clearButtonColor change the color of the Clear button
uploadButtonColor change the color of the Upload file button
hideUploadButton hide the Upload file button. Use "hideUploadButton": "true" to hide the button
loadMoreButtonColor change the color of the Load more button

Developer details

Local development

  1. npm install

  2. npm run serve to start a server on http://localhost:8080/

  3. npm run clean to clean the dist folder of old assets

  4. npm run build to generate a new distribution.

About

No description, website, or topics provided.

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published