py_idt

A python interface for creating IDT bulk oligo order forms in Excel.

You might find this module useful if you design DNA oligos in python and then order them from IDT.

Installation and Usage

1. Install the py_idt module:

• Option 1) Using conda:

  A minimal conda environment.yml is provided:

  name: py_idt_env
  channels:
    - defaults
  dependencies:
    - pip=19.0.3
    - python=3.7.3
    - pip:
      - git+ssh://[email protected]/conorcamplisson/py_idt.git
  

  To create and activate a conda environment using this file:

  $ git clone [email protected]:conorcamplisson/py_idt.git
  $ cd py_idt/
  $ conda env create -f environment.yml
  $ source activate py_idt_env
  

• Option 2) Using pip:

  $ pip install git+ssh://[email protected]/conorcamplisson/py_idt.git
  

2. Example usage (test_module.py):

from py_idt import IDTOrder

# configure output directory
IDTOrder.settings['output_dir'] = 'example_order'

def main():

    # create a new IDT oligonucleotide order
    order = IDTOrder()

    # add some oligos to this order
    order.add_oligo('Test_oligo_1', 'ACGTACGTACGTACGTACGT')
    order.add_oligo('Test_oligo_2', 'TGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA', scale='250nm', purification='PAGE')
    order.add_oligo('Test_oligo_3', '/5Phos/AAAAACCCCCGGGGGTTTTT', scale='100nm', purification='HPLC')

    # create Excel IDT bulk order form
    order.save()


if __name__ == '__main__':
    main()

An Excel file suitable for upload to IDT's custom DNA oligo bulk input form is generated:

/example_order/<timestamp>_idt_order.xlsx

3. To order oligos using IDT's Bulk Input feature, upload the Excel file here: https://www.idtdna.com/site/order/oligoentry

4. Once you upload the Excel file, click "Update" to generate the oligos.

5. At this point, you can add the oligos to your cart and check out.