Beta support for configurable dependency resolution & Biocontainers.

Consider the included tool ``seqtk_seq.cwl``. It includes the following SoftwareRequirement hint:

```
hints:
  SoftwareRequirement:
    packages:
    - package: seqtk
      version:
      - r93
```

I'm not happy that ``version`` is a list - but I can live with it for now I guess.

If cwltool is executed with the hidden ``--beta-conda-dependencies`` flag, this requirement will be processed by galaxy-lib, Conda will be installed, and seqtk will be installed, and a Conda environment including seqtk will be setup for the job.

```
virtualenv .venv
. .venv/bin/activate
python setup.py install
pip install galaxy-lib
cwltool --beta-conda-dependencies tests/seqtk_seq.cwl tests/seqtk_seq_job.json
```

Additional flags are available to configure dependency resolution in a more fine grained way - using Conda however has a number of advantages that make it particularily well suited to CWL. Conda packages are distributed as binaries that work across Mac and Linux and work on relatively old version of Linux (great for HPC). Conda also doesn't require root and supports installation of multiple different versions of a package - again these factors make it great for HPC and non-Docker targets.

The Biocontainers project (previously Biodocker) dovetails nicely with this. Every version of every Bioconda package has a corresponding best-practice (very lightweight, very small) Docker container on quay.io (assembled by @bgruening and colleagues). There are over 1800 such containers currently.

Continuing with the example above, the new ``--beta-use-biocontainers`` flag instructs cwltool to fetch the corresponding Biocontainers container from quay.io automatically or build one to use locally (required for instance for tools with multiple software requirements - fat tools).

```
cwltool --beta-use-biocontainers tests/seqtk_seq.cwl tests/seqtk_seq_job.json
```

These containers contain the same binaries that the package would use locally (outside of Docker). Therefore this technique allows cross platform reproducibility/remixability across CWL, Galaxy, and CLI - both inside and outside of Docker.

My sincerest hope is that we move away from CWL-specific Dockerfiles. For less effort, a community bioconda package can be made and the result can be used in many more contexts. The Docker image will then be maintained by the community Biocontainer project.

Rebased with correct spelling of DependenciesConfiguration thanks to @tetron.

cwltool/builder.py

@@ -36,6 +36,7 @@ def __init__(self):  # type: () -> None
         self.stagedir = None  # type: Text
         self.make_fs_access = None  # type: Type[StdFsAccess]
         self.build_job_script = None  # type: Callable[[List[str]], Text]
+        self.find_default_container = None  # type: Callable[[], Text]
 
     def bind_input(self, schema, datum, lead_pos=[], tail_pos=[]):
         # type: (Dict[Text, Any], Any, Union[int, List[int]], List[int]) -> List[Dict[Text, Any]]

cwltool/job.py

@@ -34,6 +34,7 @@
 
 PYTHON_RUN_SCRIPT = """
 import json
+import os
 import sys
 import subprocess
 
@@ -42,6 +43,7 @@
     commands = popen_description["commands"]
     cwd = popen_description["cwd"]
     env = popen_description["env"]
+    env["PATH"] = os.environ.get("PATH")
     stdin_path = popen_description["stdin_path"]
     stdout_path = popen_description["stdout_path"]
     stderr_path = popen_description["stderr_path"]
@@ -140,9 +142,12 @@ def run(self, dry_run=False, pull_image=True, rm_container=True,
         if docker_req and kwargs.get("use_container") is not False:
             env = os.environ
             img_id = docker.get_from_requirements(docker_req, docker_is_req, pull_image)
-        elif kwargs.get("default_container", None) is not None:
-            env = os.environ
-            img_id = kwargs.get("default_container")
+        if img_id is None:
+            find_default_container = self.builder.find_default_container
+            default_container = find_default_container and find_default_container()
+            if default_container:
+                img_id = default_container
+                env = os.environ
 
         if docker_is_req and img_id is None:
             raise WorkflowException("Docker is required for running this tool.")

cwltool/main.py

@@ -12,6 +12,7 @@
 import hashlib
 import pkg_resources  # part of setuptools
 import functools
+import string
 
 import rdflib
 from typing import (Union, Any, AnyStr, cast, Callable, Dict, Sequence, Text,
@@ -31,6 +32,13 @@
 from .builder import adjustFileObjs, adjustDirObjs
 from .stdfsaccess import StdFsAccess
 from .pack import pack
+from .utils import get_feature
+try:
+    from galaxy.tools.deps.requirements import ToolRequirement
+    from galaxy.tools import deps
+except ImportError:
+    ToolRequirement = None  # type: ignore
+    deps = None
 
 _logger = logging.getLogger("cwltool")
 
@@ -144,6 +152,15 @@ def arg_parser():  # type: () -> argparse.ArgumentParser
     exgroup.add_argument("--quiet", action="store_true", help="Only print warnings and errors.")
     exgroup.add_argument("--debug", action="store_true", help="Print even more logging")
 
+    # help="Dependency resolver configuration file describing how to adapt 'SoftwareRequirement' packages to current system."
+    parser.add_argument("--beta-dependency-resolvers-configuration", default=None, help=argparse.SUPPRESS)
+    # help="Defaut root directory used by dependency resolvers configuration."
+    parser.add_argument("--beta-dependencies-directory", default=None, help=argparse.SUPPRESS)
+    # help="Use biocontainers for tools without an explicitly annotated Docker container."
+    parser.add_argument("--beta-use-biocontainers", default=None, help=argparse.SUPPRESS, action="store_true")
+    # help="Short cut to use Conda to resolve 'SoftwareRequirement' packages."
+    parser.add_argument("--beta-conda-dependencies", default=None, help=argparse.SUPPRESS, action="store_true")
+
     parser.add_argument("--tool-help", action="store_true", help="Print command line help for tool")
 
     parser.add_argument("--relative-deps", choices=['primary', 'cwd'],
@@ -634,8 +651,20 @@ def main(argsl=None,
                 stdout.write(json.dumps(processobj, indent=4))
                 return 0
 
+            conf_file = getattr(args, "beta_dependency_resolvers_configuration", None)  # Text
+            use_conda_dependencies = getattr(args, "beta_conda_dependencies", None)  # Text
+
+            make_tool_kwds = vars(args)
+
+            build_job_script = None  # type: Callable[[Any, List[str]], Text]
+            if conf_file or use_conda_dependencies:
+                dependencies_configuration = DependenciesConfiguration(args)  # type: DependenciesConfiguration
+                make_tool_kwds["build_job_script"] = dependencies_configuration.build_job_script
+
+            make_tool_kwds["find_default_container"] = functools.partial(find_default_container, args)
+
             tool = make_tool(document_loader, avsc_names, metadata, uri,
-                    makeTool, vars(args))
+                    makeTool, make_tool_kwds)
 
             if args.print_rdf:
                 printrdf(tool, document_loader.ctx, args.rdf_serializer, stdout)
@@ -748,5 +777,100 @@ def locToPath(p):
         _logger.removeHandler(stderr_handler)
         _logger.addHandler(defaultStreamHandler)
 
+
+COMMAND_WITH_DEPENDENCIES_TEMPLATE = string.Template("""#!/bin/bash
+$handle_dependencies
+python "run_job.py" "job.json"
+""")
+
+
+def find_default_container(args, builder):
+    if args.default_container:
+        return args.default_container
+    elif args.beta_use_biocontainers:
+        try:
+            from galaxy.tools.deps.containers import ContainerRegistry, AppInfo, ToolInfo, DOCKER_CONTAINER_TYPE
+        except ImportError:
+            raise Exception("galaxy-lib not found")
+
+        app_info = AppInfo(
+            involucro_auto_init=True,
+            enable_beta_mulled_containers=True,
+        )  # type: AppInfo
+        container_registry = ContainerRegistry(app_info)  # type: ContainerRegistry
+        requirements = _get_dependencies(builder)
+        tool_info = ToolInfo(requirements=requirements)  # type: ToolInfo
+        container_description = container_registry.find_best_container_description([DOCKER_CONTAINER_TYPE], tool_info)
+        print container_description
+        if container_description:
+            return container_description.identifier
+
+    return None
+
+
+class DependenciesConfiguration(object):
+
+    def __init__(self, args):
+        # type: (argparse.Namespace) -> None
+        conf_file = getattr(args, "beta_dependency_resolvers_configuration", None)
+        tool_dependency_dir = getattr(args, "beta_dependencies_directory", None)
+        conda_dependencies = getattr(args, "beta_conda_dependencies", None)
+        if conf_file is not None and os.path.exists(conf_file):
+            self.use_tool_dependencies = True
+            if not tool_dependency_dir:
+                tool_dependency_dir = os.path.abspath(os.path.dirname(conf_file))
+            self.tool_dependency_dir = tool_dependency_dir
+            self.dependency_resolvers_config_file = conf_file
+        elif conda_dependencies:
+            if not tool_dependency_dir:
+                tool_dependency_dir = os.path.abspath("./cwltool_deps")
+            self.tool_dependency_dir = tool_dependency_dir
+            self.use_tool_dependencies = True
+            self.dependency_resolvers_config_file = None
+        else:
+            self.use_tool_dependencies = False
+
+    @property
+    def config_dict(self):
+        return {
+            'conda_auto_install': True,
+            'conda_auto_init': True,
+        }
+
+    def build_job_script(self, builder, command):
+        # type: (Any, List[str]) -> Text
+        if deps is None:
+            raise Exception("galaxy-lib not found")
+        tool_dependency_manager = deps.build_dependency_manager(self)  # type: deps.DependencyManager
+        dependencies = _get_dependencies(builder)
+        handle_dependencies = ""  # str
+        if dependencies:
+            handle_dependencies = "\n".join(tool_dependency_manager.dependency_shell_commands(dependencies, job_directory=builder.tmpdir))
+
+        template_kwds = dict(handle_dependencies=handle_dependencies)  # type: Dict[str, str]
+        job_script = COMMAND_WITH_DEPENDENCIES_TEMPLATE.substitute(template_kwds)
+        return job_script
+
+
+def _get_dependencies(builder):
+    # type: (Any) -> List[ToolRequirement]
+    (software_requirement, _) = get_feature(builder, "SoftwareRequirement")
+    dependencies = []  # type: List[ToolRequirement]
+    if software_requirement and software_requirement.get("packages"):
+        packages = software_requirement.get("packages")
+        for package in packages:
+            version = package.get("version", None)
+            if isinstance(version, list):
+                if version:
+                    version = version[0]
+                else:
+                    version = None
+            dependencies.append(ToolRequirement.from_dict(dict(
+                name=package["package"].split("#")[-1],
+                version=version,
+                type="package",
+            )))
+    return dependencies
+
 if __name__ == "__main__":
     sys.exit(main(sys.argv[1:]))

cwltool/process.py

@@ -502,6 +502,18 @@ def _init_job(self, joborder, **kwargs):
 
         builder.resources = self.evalResources(builder, kwargs)
 
+        build_job_script = kwargs.get("build_job_script", None)  # type: Callable[[Builder, List[str]], Text]
+        curried_build_job_script = None  # type: Callable[[List[str]], Text]
+        if build_job_script:
+            curried_build_job_script = lambda commands: build_job_script(builder, commands)
+        builder.build_job_script = curried_build_job_script
+
+        find_default_container = kwargs.get("find_default_container", None)  # type: Callable[[Builder], Text]
+        curried_find_default_container = None  # type: Callable[[], Text]
+        if find_default_container:
+            curried_find_default_container = lambda: find_default_container(builder)
+        builder.find_default_container = curried_find_default_container
+
         return builder
 
     def evalResources(self, builder, kwargs):

tests/2.fasta

@@ -0,0 +1,11 @@
+>Sequence 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
+gttcgatgcc taaaatacct tcttttgtcc ctacacagac cacagttttc ctaatggctt
+tacaccgact agaaattctt gtgcaagcac taattgaaag cggttggcct agagtgttac
+cggtttgtat agctgagcgc gtctcttgcc ctgatcaaag gttcattttc tctactttgg
+aagacgttgt ggaagaatac aacaagtacg agtctctccc ccctggtttg ctgattactg
+gatacagttg taataccctt cgcaacaccg cgtaactatc tatatgaatt attttccctt
+tattatatgt agtaggttcg tctttaatct tcctttagca agtcttttac tgttttcgac
+ctcaatgttc atgttcttag gttgttttgg ataatatgcg gtcagtttaa tcttcgttgt
+ttcttcttaa aatatttatt catggtttaa tttttggttt gtacttgttc aggggccagt
+tcattattta ctctgtttgt atacagcagt tcttttattt ttagtatgat tttaatttaa
+aacaattcta atggtcaaaa a

tests/2.fastq

@@ -0,0 +1,12 @@
+@EAS54_6_R1_2_1_413_324
+CCCTTCTTGTCTTCAGCGTTTCTCC
++
+;;3;;;;;;;;;;;;7;;;;;;;88
+@EAS54_6_R1_2_1_540_792
+TTGGCAGGCCAAGGCCGATGGATCA
++
+;;;;;;;;;;;7;;;;;-;;;3;83
+@EAS54_6_R1_2_1_443_348
+GTTGCTTCTGGCGTGGGTGGGGGGG
++EAS54_6_R1_2_1_443_348
+;;;;;;;;;;;9;7;;.7;393333

tests/seqtk_seq.cwl

@@ -0,0 +1,24 @@
+cwlVersion: v1.0
+class: CommandLineTool
+id: "seqtk_seq"
+doc: "Convert to FASTA (seqtk)"
+inputs:
+  - id: input1
+    type: File
+    inputBinding:
+      position: 1
+      prefix: "-a"
+outputs:
+  - id: output1
+    type: File
+    outputBinding:
+      glob: out
+baseCommand: ["seqtk", "seq"]
+arguments: []
+stdout: out
+hints:
+  SoftwareRequirement:
+    packages:
+    - package: seqtk
+      version:
+      - r93

tests/seqtk_seq_job.json

@@ -0,0 +1,6 @@
+{
+  "input1": {
+    "class": "File",
+    "location": "2.fastq"
+  }
+}

typeshed/2.7/galaxy/__init__.pyi

@@ -0,0 +1,13 @@
+# Stubs for galaxy (Python 3.5)
+#
+# NOTE: This dynamically typed stub was automatically generated by stubgen.
+
+from typing import Any
+
+PROJECT_NAME = ...  # type: str
+PROJECT_OWNER = ...  # type: str
+PROJECT_USERAME = ...  # type: str
+PROJECT_URL = ...  # type: str
+PROJECT_AUTHOR = ...  # type: str
+PROJECT_EMAIL = ...  # type: str
+RAW_CONTENT_URL = ...  # type: Any

typeshed/2.7/galaxy/tools/__init__.pyi

@@ -0,0 +1,4 @@
+# Stubs for galaxy.tools (Python 3.5)
+#
+# NOTE: This dynamically typed stub was automatically generated by stubgen.
+

typeshed/2.7/galaxy/tools/deps/__init__.pyi

@@ -0,0 +1,32 @@
+# Stubs for galaxy.tools.deps (Python 3.5)
+#
+# NOTE: This dynamically typed stub was automatically generated by stubgen.
+
+from typing import Any, Optional
+from .resolvers import NullDependency as NullDependency
+from .resolvers.conda import CondaDependencyResolver as CondaDependencyResolver
+from .resolvers.galaxy_packages import GalaxyPackageDependencyResolver as GalaxyPackageDependencyResolver
+from .resolvers.tool_shed_packages import ToolShedPackageDependencyResolver as ToolShedPackageDependencyResolver
+
+log = ...  # type: Any
+EXTRA_CONFIG_KWDS = ...  # type: Any
+CONFIG_VAL_NOT_FOUND = ...  # type: Any
+
+def build_dependency_manager(config: Any): ...  # type: DependencyManager
+
+class NullDependencyManager:
+    dependency_resolvers = ...  # type: Any
+    def uses_tool_shed_dependencies(self): ...
+    def dependency_shell_commands(self, requirements: Any, **kwds) -> List[str]: ...
+    def find_dep(self, name, version: Optional[Any] = ..., type: str = ..., **kwds): ...
+
+class DependencyManager:
+    extra_config = ...  # type: Any
+    default_base_path = ...  # type: Any
+    resolver_classes = ...  # type: Any
+    dependency_resolvers = ...  # type: Any
+    def __init__(self, default_base_path, conf_file: Optional[Any] = ..., **extra_config) -> None: ...
+    def dependency_shell_commands(self, requirements: Any, **kwds) -> List[str]: ...
+    def requirements_to_dependencies(self, requirements, **kwds): ...
+    def uses_tool_shed_dependencies(self): ...
+    def find_dep(self, name, version: Optional[Any] = ..., type: str = ..., **kwds): ...