Support frame shift with initiation codon change

[totakke]

Supports frame shift caused by initiation codon change. That case is sometimes found in BRCA Share database.

(require '[varity.vcf-to-hgvs :as v2h]
         '[clj-hgvs.core :as hgvs])

(->> (v2h/vcf-variant->protein-hgvs {:chr "chr17"
                                     :pos 43124016
                                     :ref "CCAGATGGGACACTCTAAGATTTTCTGCATAGCATTAATGACATTTTGTACTTCTTCAACGCGAAGAGCAGATAAATCCATTTCTTTCTGTTCCAATGAA"
                                     :alt "C"}
                                    "path/to/hg38.fa"
                                    "path/to/refGene.txt.gz")
     (map hgvs/format))
;;=> ("p.Met1SerfsTer13")

This PR also includes performance improvement of variant normalization. Process for finding repeated units from bases is heavy when the too long bases are supplied. I limited maximum size of a repeated unit to avoid process freeze.

I confirmed lein test :all passed.

[codecov]

Codecov Report

Merging #18 into master will increase coverage by 0.2%.
The diff coverage is 23.65%.

@@            Coverage Diff            @@
##           master      #18     +/-   ##
=========================================
+ Coverage   36.15%   36.36%   +0.2%     
=========================================
  Files          12       12             
  Lines        1239     1254     +15     
  Branches       24       24             
=========================================
+ Hits          448      456      +8     
- Misses        767      774      +7     
  Partials       24       24

Impacted Files	Coverage Δ
src/varity/vcf_to_hgvs/protein.clj	23.48% <17.24%> (+0.38%)	⬆️
src/varity/vcf_to_hgvs.clj	20.51% <4.54%> (+0.15%)	⬆️
src/varity/vcf_to_hgvs/common.clj	62.59% <84.61%> (+0.49%)	⬆️

---

Continue to review full report at Codecov.

Legend - Click here to learn more
Δ = absolute <relative> (impact), ø = not affected, ? = missing data
Powered by Codecov. Last update 61a72ac...814c9ea. Read the comment docs.

[federkasten]

LGTM 👍 This changes make ~10% faster in the use of reporting 😺