Merge pull request #66 from chrovis/feature/fix-protein-fs-change-pos…

…ition
chrovis · Oct 31, 2022 · e401a36 · e401a36
2 parents ed13cba + 48a7fde
commit e401a36
Show file tree

Hide file tree

Showing 2 changed files with 10 additions and 11 deletions.
diff --git a/src/varity/vcf_to_hgvs/protein.clj b/src/varity/vcf_to_hgvs/protein.clj
@@ -278,16 +278,14 @@
                                alt-repeat)))
 
 (defn- protein-frame-shift
-  [ppos pref palt seq-info]
-  (let [[ppos pref palt] (if (= pref palt)
-                           (->> (map vector (:ref-prot-seq seq-info) (:alt-prot-seq seq-info))
-                                (drop (dec ppos))
-                                (map-indexed vector)
-                                (drop-while (fn [[_ [r a]]] (= r a)))
-                                first
-                                ((fn [[i [r a]]]
-                                   [(+ ppos i) (str r) (str a)])))
-                           [ppos pref palt])
+  [ppos seq-info]
+  (let [[ppos pref palt] (->> (map vector (:ref-prot-seq seq-info) (:alt-prot-seq seq-info))
+                              (drop (dec ppos))
+                              (map-indexed vector)
+                              (drop-while (fn [[_ [r a]]] (= r a)))
+                              first
+                              ((fn [[i [r a]]]
+                                 [(+ ppos i) (str r) (str a)])))
         [_ _ offset _] (diff-bases pref palt)
         alt-prot-seq (format-alt-prot-seq seq-info)
         ref (nth (:ref-prot-seq seq-info) (dec (+ ppos offset)))
@@ -338,7 +336,7 @@
           :insertion (protein-insertion ppos pref palt seq-info)
           :indel (protein-indel ppos pref palt)
           :repeated-seqs (protein-repeated-seqs ppos pref palt seq-info)
-          :frame-shift (protein-frame-shift ppos pref palt seq-info)
+          :frame-shift (protein-frame-shift ppos seq-info)
           :extension (protein-extension ppos pref palt seq-info)
           :no-effect (mut/protein-no-effect)
           :unknown (mut/protein-unknown-mutation))))))

diff --git a/test/varity/vcf_to_hgvs_test.clj b/test/varity/vcf_to_hgvs_test.clj
@@ -214,6 +214,7 @@
         "chr2" 47478341 "T" "TGG" '("p.L762Gfs*2" "p.L696Gfs*2")
         "chr5" 112839837 "AGTGGCAT" "A" '("p.S1397Ifs*2"
                                           "p.S1415Ifs*2") ; https://github.com/chrovis/varity/issues/58
+        "chr17" 31261816 "CC" "C" '("p.N1542Tfs*11" "p.N1563Tfs*11") ; cf. rs1555619041 (+)
 
         ;; frame shift with initiation codon change (e.g. NM_007298:c.-19_80del from BRCA Share)
         "chr17" 43124016 "CCAGATGGGACACTCTAAGATTTTCTGCATAGCATTAATGACATTTTGTACTTCTTCAACGCGAAGAGCAGATAAATCCATTTCTTTCTGTTCCAATGAA" "C"