Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

reev does not load any boxes for a specific variant #447

Closed
sczakihl opened this issue Feb 6, 2024 · 2 comments · Fixed by #450 or bihealth/reev-frontend-lib#98
Closed

reev does not load any boxes for a specific variant #447

sczakihl opened this issue Feb 6, 2024 · 2 comments · Fixed by #450 or bihealth/reev-frontend-lib#98
Labels
bug Something isn't working
Milestone

Comments

@sczakihl
Copy link
Collaborator

sczakihl commented Feb 6, 2024

Describe the bug
For this indel nothing is loading: chrX:102884958:T:TTCGGAGGAGCAGTCC also nothing when entering as NM_004780.3(TCEAL1):c.124_138dup

Other indels (e.g. chr4:113568635:ATCAAAAGTAAAGAAAATTAT:A) work however.

To Reproduce
Steps to reproduce the behavior:

  1. Go to 'reev'
  2. enter TCEAL1 variant above
  3. Scroll down to 'anywhere'
  4. See error

Expected behavior
results page should load.

Screenshots
grafik

@sczakihl sczakihl added the bug Something isn't working label Feb 6, 2024
@holtgrewe holtgrewe added this to the 0.6.0 milestone Feb 6, 2024
@holtgrewe
Copy link
Member

Root Cause Analysis
The seqvarInfo store made the wrong assumption that there must be HPO terms for each gene.

@holtgrewe
Copy link
Member

@sczakihl please confirm that this works now

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
bug Something isn't working
Projects
None yet
2 participants