--soloType CB_UMI_Complex ,didn't match barcodes or UMIs

[StardDii]

Hi,Alex
Thanks for reading my question:
here are my parameters:
STAR --runThreadN 8
--genomeDir /home/dii/data/ref_gene/mouse/STAR_anno
--readFilesIn /home/dii/data/GEGA/raw_RNAseq/MBc/raw_data/first_100_SRR25388161_2.fastq /home/dii/data/GEGA/raw_RNAseq/MBc/raw_data/first_100_SRR25388161_1.fastq
--soloType CB_UMI_Complex
--soloStrand Forward
--soloUMIposition 0_0_0_8
--soloCBposition 0_9_0_16 0_48_0_55
--soloCBmatchWLtype 1MM
--soloFeatures Gene
--soloCBwhitelist /home/dii/data/GEGA/raw_RNAseq/scRNA_barcode/bc1_whitelist1.txt /home/dii/data/GEGA/raw_RNAseq/scRNA_barcode/bc2_whitelist2.txt
--outFileNamePrefix /home/dii/result/GAGEseq/test/

here is the library : UMIs(9)+barcode1(8)+adopter(31)+barcode(8), in read1
[TGATGATCA]+[AGGAGAAC]+[ACTCCACGTGCTTGAGCAACGAGGTACGACA]+[GTTCTCGT]

I am not sure about my setting of --soloUMIposition 0_0_0_8 and --soloCBposition 0_9_0_16 0_48_0_55 \ since output had no UMIs or barcode :(

                                   noNoAdapter              0
                                       noNoUMI              0
                                        noNoCB              0
                                       noNinCB              0
                                      noNinUMI             13
                              noUMIhomopolymer              0
                                   noNoWLmatch             12
                                   noTooManyMM              0
                            noTooManyWLmatches              0
                               yesWLmatchExact              0
                           yesOneWLmatchWithMM              0
                          yesMultWLmatchWithMM              0

[StardDii]

                                    noUnmapped              0
                                   noNoFeature              0
                                  MultiFeature              0
                   subMultiFeatureMultiGenomic              0
                            noTooManyWLmatches              0
                          noMMtoWLwithoutExact              0
                                    yesWLmatch              0
                            yessubWLmatchExact              0
                   yessubWLmatch_UniqueFeature              0
                               yesCellBarcodes              0
                                       yesUMIs              0