[R package] Allow maps to start mid-sequence

[jweile]

The x-axis always starts at 1 at the moment. Allow that to be dynamic based on potential partial input.

Smart detection: If the the wt sequence provided is longer than the range of positions covered, then assume it starts at 1 (and print a warning), otherwise, restrict to range.

[jweile]

Implemented in R-package, but causing error in webapp:

When running WW-domain:

Error in if (length(wt.aa) > coverLength) { : 
  missing value where TRUE/FALSE needed
Calls: dashboard -> genophenogram
In addition: Warning message:
In max(values, na.rm = TRUE) :
  no non-missing arguments to max; returning -Inf

{
 "scoresetID": "urn:mavedb:00000002-a-2",
"uniprot": "P46937",
"pdb": "1JMQ",
"mainChain": "A",
"WT": "GACGTTCCACTGCCGGCTGGTTGGGAAATGGCTAAAACTAGTTCTGGTCAGCGTTACTTCCTGAACCACATCGACCAGACCACCACGTGGCAGGACCCGCGT",
"seqOffset": "169",
"synMed": "1",
"stopMed": "NULL",
"pngRes": "80",
"job": "ea64ee53-35b5-434f-8828-18c9804b0370" 
}

[jweile]

Identified missing na.rm=TRUE as cause.

Fixed in commit 818f6b8