adding an annotateSingleSeq function

src/annotateSingleSeq.js

@@ -0,0 +1,29 @@
+const { autoAnnotate } = require("./autoAnnotate");
+
+function annotateSingleSeq({ fullSeq, searchSeq }) {
+  const fullSeqId = fullSeq.id || "fullSeqId";
+  const searchSeqId = searchSeq.id || "searchSeqId";
+  const results = autoAnnotate({
+    seqsToAnnotateById: {
+      [fullSeqId]: {
+        ...fullSeq,
+        id: fullSeqId
+      }
+    },
+    annotationsToCheckById: {
+      [searchSeqId]: {
+        ...searchSeq,
+        id: searchSeqId
+      }
+    },
+    compareName: false
+  });
+  if (results && results[fullSeqId]) {
+    return {
+      matches: results[fullSeqId]
+    };
+  } else {
+    return { matches: [] };
+  }
+}
+module.exports = { annotateSingleSeq };

src/annotateSingleSeq.test.js

@@ -0,0 +1,64 @@
+const { annotateSingleSeq } = require("./annotateSingleSeq");
+const { expect } = require("chai");
+
+describe("annotateSingleSeq", function() {
+  it(`regexes work - correctly annotates a single seq with a regex annotation`, done => {
+    const results = annotateSingleSeq({
+      fullSeq: { sequence: "AAAATTTTGGGGGCCCCCAAGT" },
+      searchSeq: { sequence: "TTTT.*CCC" }
+    });
+    // eslint-disable-next-line no-unused-expressions
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      matches: [
+        {
+          start: 4,
+          end: 17,
+          strand: 1,
+          id: "searchSeqId"
+        }
+      ]
+    });
+    done();
+  });
+  it(`correctly annotates a single seq with multiple matches`, done => {
+    const results = annotateSingleSeq({
+      fullSeq: { sequence: "AAAATTTTGGGGGCCCCCAAGTAAAATTTTGGGGGCCCCCAAGT" },
+      searchSeq: { sequence: "AAAATTTTGGGGGCCCCCAAGT", id: 2 }
+    });
+    // eslint-disable-next-line no-unused-expressions
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      matches: [
+        {
+          start: 0,
+          end: 21,
+          strand: 1,
+          id: 2
+        },
+        {
+          start: 22,
+          end: 43,
+          strand: 1,
+          id: 2
+        }
+      ]
+    });
+    done();
+  });
+  it(`correctly finds no matches when there are none`, done => {
+    const results = annotateSingleSeq({
+      fullSeq: { sequence: "AAAATTTTGGGGGCCCCCAAGTAAAATTTTGGGGGCCCCCAAGT" },
+      searchSeq: { sequence: "AAAATTTTGGGGGGGGGGCCCCCAAGT" }
+    });
+    // eslint-disable-next-line no-unused-expressions
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      matches: []
+    });
+    done();
+  });
+});

src/index.js

@@ -8,6 +8,7 @@ module.exports.getDiffFromSeqs = diffUtils.getDiffFromSeqs;
 module.exports.patchSeqWithDiff = diffUtils.patchSeqWithDiff;
 module.exports.reverseSeqDiff = diffUtils.reverseSeqDiff;
 module.exports.getAllInsertionsInSeqReads = require("./getAllInsertionsInSeqReads");
+module.exports.annotateSingleSeq = require("./annotateSingleSeq").annotateSingleSeq;
 module.exports.getDegenerateDnaStringFromAAString = require("./getDegenerateDnaStringFromAAString");
 module.exports.getDegenerateRnaStringFromAAString = require("./getDegenerateRnaStringFromAAString");
 module.exports.getVirtualDigest = require("./getVirtualDigest");