It now lives in our OSS monorepo - https://github.com/TeselaGen/tg-oss
It can now be installed as
npm install @teselagen/bio-parsers
- THIS REPO HAS MOVED!
- Bio Parsers
- About this Repo
- [CHANGELOG](#changelogchangelogmd)
- Exported Functions
- Format Specification
- Usage
- Editing This Repo
- Debug
- Updating this repo
- Thanks/Collaborators
This repo contains a set of parsers to convert between datatypes through a generalized JSON format.
Use the following exports to convert to a generalized JSON format:
fastaToJson //handles fasta files (.fa, .fasta)
genbankToJson //handles genbank files (.gb, .gbk)
ab1ToJson //handles .ab1 sequencing read files
sbolXmlToJson //handles .sbol files
geneiousXmlToJson //handles .genious files
jbeiXmlToJson //handles jbei .seq or .xml files
snapgeneToJson //handles snapgene (.dna) files
anyToJson //this handles any of the above file types based on file extension
Use the following exports to convert from a generalized JSON format back to a specific format:
jsonToGenbank
jsonToFasta
jsonToBed
The generalized JSON format looks like:
const generalizedJsonFormat = {
"size": 25,
"sequence": "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa",
"circular": true,
"name": "pBbS8c-RFP",
"description": "",
"parts": [
{
"name": "part 1",
"type": "CDS", //optional for parts
"id": "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
"start": 10, //0-based inclusive index
"end": 30, //0-based inclusive index
"strand": 1,
"notes": {},
}
],
"primers": [
{
"name": "primer 1",
"id": "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
"start": 10, //0-based inclusive index
"end": 30, //0-based inclusive index
"strand": 1,
"notes": {},
}
],
"features": [
{
"name": "anonymous feature",
"type": "misc_feature",
"id": "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you
"start": 1,
"end": 3,
"strand": 1,
"notes": {},
},
{
"name": "coding region 1",
"type": "CDS",
"id": "5590c1d88979df000a4f02f5",
"start": 12,
"end": 9,
"strand": -1,
"notes": {},
}
],
//only if parsing in an ab1 file
"chromatogramData": {
"aTrace": [], //same as cTrace but for a
"tTrace": [], //same as cTrace but for t
"gTrace": [], //same as cTrace but for g
"cTrace": [0,0,0,1,3,5,11,24,56,68,54,30,21,3,1,4,1,0,0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
"basePos": [33, 46, 55, ...etc], //x position of the bases (can be unevenly spaced)
"baseCalls": ["A", "T", ...etc],
"qualNums": [], //or undefined if no qualNums are detected on the file
},
}npm install -S bio-parsers
or
yarn add bio-parsers
or
use it from a script tag:
<script src="https://unpkg.com/bio-parsers/umd/bio-parsers.js"></script>
<script>
async function main() {
var jsonOutput = await window.bioParsers.genbankToJson(
`LOCUS kc2 108 bp DNA linear 01-NOV-2016
COMMENT teselagen_unique_id: 581929a7bc6d3e00ac7394e8
FEATURES Location/Qualifiers
CDS 1..108
/label="GFPuv"
misc_feature 61..108
/label="gly_ser_linker"
bogus_dude 4..60
/label="ccmN_sig_pep"
misc_feature 4..60
/label="ccmN_nterm_sig_pep"
/pragma="Teselagen_Part"
/preferred5PrimeOverhangs=""
/preferred3PrimeOverhangs=""
ORIGIN
1 atgaaggtct acggcaagga acagtttttg cggatgcgcc agagcatgtt ccccgatcgc
61 ggtggcagtg gtagcgggag ctcgggtggc tcaggctctg ggg
//`
);
console.log('jsonOutput:', jsonOutput);
var genbankString = window.bioParsers.jsonToGenbank(jsonOutput[0].parsedSequence);
console.log(genbankString);
}
main();
</script>see the ./umd_demo.html file for a full working example
//To go from json to genbank:
import { jsonToGenbank } from "bio-parsers"
//You can pass an optional options object as the second argument. Here are the defaults
const options = {
isProtein: false, //by default the sequence will be parsed and validated as type DNA (unless U's instead of T's are found). If isProtein=true the sequence will be parsed and validated as a PROTEIN type (seqData.isProtein === true)
guessIfProtein: false, //if true the parser will attempt to guess if the sequence is of type DNA or type PROTEIN (this will override the isProtein flag)
guessIfProteinOptions: {
threshold = 0.90, //percent of characters that must be DNA letters to be considered of type DNA
dnaLetters = ['G', 'A', 'T', 'C'] //customizable set of letters to use as DNA
},
inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
// Example:
// 0123456
// ATGAGAG
// --fff-- (the feature covers GAG)
// 0-based inclusive start:
// feature.start = 2
// 1-based inclusive start:
// feature.start = 3
// 0-based inclusive end:
// feature.end = 4
// 1-based inclusive end:
// feature.end = 5
}
const genbankString = jsonToGenbank(generalizedJsonFormat, options)import { anyToJson } from "bio-parsers"
//note, anyToJson should be called using an await to allow for file parsing to occur (if a file is being passed)
const results = await anyToJson(
stringOrFile, //if ab1 files are being passed in you should pass files only, otherwise strings or files are fine as inputs
options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
)
//we always return an array of results because some files my contain multiple sequences
results[0].success //either true or false
results[0].messages //either an array of strings giving any warnings or errors generated during the parsing process
results[0].parsedSequence //this will be the generalized json format as specified above :)
//chromatogram data will be here (ab1 only):
results[0].parsedSequence.chromatogramData //You can pass an optional options object as the third argument. Here are the defaults
const options = {
fileName: "example.gb", //the filename is used if none is found in the genbank
isProtein: false, //if you know that it is a protein string being parsed you can pass true here
parseFastaAsCircular: false; //by default fasta files are parsed as linear sequences. You can change this by setting parseFastaAsCircular=true
//genbankToJson options only
inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
acceptParts: true //by default features with a feature.notes.pragma[0] === "Teselagen_Part" are added to the sequenceData.parts array. Setting this to false will keep them as features instead
// fastaToJson options only
parseName: true //by default attempt to parse the name and description of sequence from the comment line. Setting this to false will keep the name unchanged with no description
}import { ab1ToJson } from "bio-parsers"
const results = await ab1ToJson(
//this can be either a browser file <input type="file" id="input" multiple onchange="ab1ToJson(this.files[0])">
// or a node file ab1ToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
file,
options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
)
//we always return an array of results because some files my contain multiple sequences
results[0].success //either true or false
results[0].messages //either an array of strings giving any warnings or errors generated during the parsing process
results[0].parsedSequence //this will be the generalized json format as specified above :)
//chromatogram data will be here (ab1 only):
results[0].parsedSequence.chromatogramData import { snapgeneToJson } from "bio-parsers"
//file can be either a browser file <input type="file" id="input" multiple onchange="snapgeneToJson(this.files[0])">
// or a node file snapgeneToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
const results = await snapgeneToJson(file,options)import { genbankToJson } from "bio-parsers"
const result = genbankToJson(string, options)
console.info(result)
// [
// {
// "messages": [
// "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn",
// "Invalid feature end: 1384 detected for Homo sapiens and set to 1",
// ],
// "success": true,
// "parsedSequence": {
// "features": [
// {
// "notes": {
// "organism": [
// "Homo sapiens"
// ],
// "db_xref": [
// "taxon:9606"
// ],
// "chromosome": [
// "17"
// ],
// "map": [
// "17q21"
// ]
// },
// "type": "source",
// "strand": 1,
// "name": "Homo sapiens",
// "start": 0,
// "end": 1
// }
// ],
// "name": "NP_003623",
// "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag",
// "circular": true,
// "extraLines": [
// "DEFINITION contactin-associated protein 1 precursor [Homo sapiens].",
// "ACCESSION NP_003623",
// "VERSION NP_003623.1 GI:4505463",
// "DBSOURCE REFSEQ: accession NM_003632.2",
// "KEYWORDS RefSeq."
// ],
// "type": "DNA",
// "size": 925
// }
// }
// ]You can see more examples by looking at the tests.
Edit/create a new file and update/add any relevant tests.
Make sure they pass by running yarn test
yarn test-debug
Commit and push all changes Sign into npm using the teselagen npm account (npm whoami)
npm version patch|minor|major
npm publish
fork and pull request please :)
- IsaacLuo - https://github.com/IsaacLuo/SnapGeneFileReader (from which the snapgene parser was adapted)
- Joshua Nixon (original collaborator)
- Thomas Rich (original collaborator)