modified crispr

JeffXiePL · Sep 13, 2024 · 2f0752c · 2f0752c
1 parent 7b02e56
commit 2f0752c
Showing 1 changed file with 15 additions and 18 deletions.
diff --git a/docs/notebooks/CRISPR.ipynb b/docs/notebooks/CRISPR.ipynb
@@ -27,7 +27,7 @@
    "cell_type": "markdown",
    "metadata": {},
    "source": [
-    "The target sequence and guideRNA (gRNA) sequence needs to be generated. Note the the gRNA sequence can be passed as a string."
+    "The target sequence and guideRNA (gRNA) sequence needs to be generated. Note the the sequence can be passed as a `Dseqrecord` object."
    ]
   },
   {
@@ -39,17 +39,17 @@
      "name": "stdout",
      "output_type": "stream",
      "text": [
-      "0\n"
+      "[]\n"
      ]
     }
    ],
    "source": [
     "# Defining the target sequence\n",
-    "sequence = Dseqrecord(\"GGTCTCACCTTACCGTTGACGGACGATCGATTTGAC\")\n",
+    "sequence = Dseqrecord(\"GTTACTTTACCCGACGTCCCCGG\")\n",
     "\n",
     "# Defining the guide RNA sequence\n",
-    "gRNA_sequence = protospacer(sequence)\n",
-    "print(len(gRNA_sequence))"
+    "gRNA_sequence = protospacer(guide_construct = sequence, cas=cas9)\n",
+    "print(gRNA_sequence)"
    ]
   },
   {
@@ -58,26 +58,23 @@
    "metadata": {},
    "outputs": [
     {
-     "ename": "IndexError",
-     "evalue": "list index out of range",
-     "output_type": "error",
-     "traceback": [
-      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
-      "\u001b[0;31mIndexError\u001b[0m                                Traceback (most recent call last)",
-      "Cell \u001b[0;32mIn[21], line 2\u001b[0m\n\u001b[1;32m      1\u001b[0m \u001b[38;5;66;03m# Initializing the Cas9 protein\u001b[39;00m\n\u001b[0;32m----> 2\u001b[0m enzyme \u001b[38;5;241m=\u001b[39m cas9(\u001b[43mgRNA_sequence\u001b[49m\u001b[43m[\u001b[49m\u001b[38;5;241;43m0\u001b[39;49m\u001b[43m]\u001b[49m)\n\u001b[1;32m      4\u001b[0m \u001b[38;5;66;03m# Simulating the CRISPR-Cas9 cut\u001b[39;00m\n\u001b[1;32m      5\u001b[0m cut_products \u001b[38;5;241m=\u001b[39m gRNA_sequence(enzyme)\n",
-      "\u001b[0;31mIndexError\u001b[0m: list index out of range"
+     "name": "stdout",
+     "output_type": "stream",
+     "text": [
+      "0\n"
      ]
     }
    ],
    "source": [
     "# Initializing the Cas9 protein\n",
-    "enzyme = cas9(gRNA_sequence[0])\n",
+    "enzyme = cas9(protospacer=gRNA_sequence[0])\n",
     "\n",
-    "# Simulating the CRISPR-Cas9 cut\n",
-    "cut_products = gRNA_sequence(enzyme)\n",
+    "# Simulating the CRISPR-Cas9 cut by searching for the cut sites\n",
+    "cas9_sites = enzyme.search(sequence)\n",
+    "print(len(cas9_sites))\n",
     "\n",
-    "# The cut_products will contain the fragments resulting from the cut\n",
-    "for fragment in cut_products:\n",
+    "# The cas9_sites will contain the fragments resulting from the cut\n",
+    "for fragment in cas9_sites:\n",
     "    print(fragment.format(\"fasta\"))"
    ]
   }