Output

Output

Split Reads

RNAnue reports the detected splits in .SAM format (RNAnue detect). In this file, pairs of rows represent the split reads, consisting of the individual segments, e.g

A00551:29:H73LYDSXX:1:1101:7274:10645	16	gi|170079663|ref|NC_010473.1|	3520484	22	1X51=	*	0	0	AGGGGTCTTTCCGTCTTGCCGCGGGTACACTGCATCTTCACAGCGAGTTCAA	*	XA:Z:TTTCTGG	XC:f:0.714286	XE:f:-15.6	XL:i:7	XM:i:5	XN:i:0	XR:f:0.0735294	XS:i:5	XX:i:1	XY:i:52
A00551:29:H73LYDSXX:1:1101:7274:10645	16	gi|170079663|ref|NC_010473.1|	3520662	22	11=5S	*	0	0	TTCGATCAAGAAGAAC	*	XA:Z:GAAGAAC	XC:f:0.714286	XE:f:-15.6	XL:i:7	XM:i:5	XN:i:0	XR:f:0.0735294	XS:i:5	XX:i:53	XY:i:68

In the following the tags are listed that are reported in the detected split reads. Please note that in the upper segment the alignment is in reverse as done in the calculation of the complemtarity to represent the 3'-5' and 5'-3' duplex.

tag	description
XC:f	complementarity
XL:f	length of alignment
XR:f	site length ratio
XM:i	matches in alignment
XA:Z	alignment of sequence
XE:f	hybridization energy

Clustering

Interactions