Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

fix(ci): change human reference from NC_000021.9 to BA000005.3 #488

Merged
merged 3 commits into from
Mar 1, 2022
Merged

fix(ci): change human reference from NC_000021.9 to BA000005.3 #488

merged 3 commits into from
Mar 1, 2022

Conversation

thomasbtf
Copy link
Contributor

Description

The download of NC_000021.9 fails, because of an internal sever error over at ncbi:

...
CCCTCTCCCTCACTCTTATAAGGACACTTAAGATTGCATTTAGAGCCCACCAAGATAATTCATGATAATC
TTCCATCACAAAATTCTTCACTTATTCACATCTGCAAGTCTCTTTGCCATAAAGGTTACATTTACAGGTA
CTAAGGATTAAGACCTGACATCTCTTGAGGCCATTATTCACCCTAACACA<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd">
<html>
<head>
<title>NCBI/ffsrv12 - WWW Error 500 Diagnostic</title>
<style type="text/css">
h1.error {color: red; font-size: 40pt}
div.diags {text-indent: 0.5in }
</style>
</head>
<body>
<h1>Server Error</h1>


<p>Your request could not be processed due to a problem on
our Web server.  This could be a transient problem, please
try the query again.  If it doesn't clear up within a
reasonable period of time, e-mail a short description of your
query and the diagnostic information shown below to:</p>

<p>
[email protected] - for problems with PubMed<br/>
[email protected] - for problems with other services<br/>
</p>

<p>Thank you for your assistance.  We will try to fix the
problem as soon as possible.
</p>
<hr/>
<p>
Diagnostic Information:</p>

<div class="diags">Error: 500</div>

<div class="diags">URL:  h t t p : / / w w w . n c b i . n l m . n i h . g o v / s v i e w e r / f l a t f i l e / f l a t f i l e . f c g i ? & a m p ; d b = n u c c o r e & a m p ; i d = N C _ 0 0 0 0 2 1 . 9 & a m p ; r e p o r t = 4 & a m p ; r e t m o d e = h t m l & a m p ; n c b i _ p h i d = 3 5 8 E 5 0 5 6 2 1 8 A A 2 8 1 0 0 0 0 0 0 F F F F F F 0 0 0 1 . 1 </div>

<div class="diags">Client: 130.14.26.24</div>

<div class="diags">Server: ffsrv12</div>

<div class="diags">Time: Fri Feb 25 05:08:35 EST 2022</div>


<p>
NOTE: The above is an internal URL which may differ from the one you used to address the page.</p>
<hr/>
<p>Rev. 01/04/08</p>

</body>
</html>

We only use NC_000021.9 in our CI, because it is only a small section of the human genome (chromosome 21). This PR changes to another chromosome 21 reference: https://www.ncbi.nlm.nih.gov/nuccore/BA000005.3

This will hopefully not produce the error above.

Related Issue

N/A

Checklist

@alethomas alethomas merged commit 14b4be0 into master Mar 1, 2022
@alethomas alethomas deleted the fix-ci-download-ref branch March 1, 2022 16:54
@github-actions github-actions bot mentioned this pull request Mar 1, 2022
Merged
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Reviewers

@alethomas alethomas alethomas approved these changes

Assignees
No one assigned
Labels
None yet
Projects
None yet
Milestone
No milestone
Development

Successfully merging this pull request may close these issues.
2 participants
@thomasbtf @alethomas