Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Zero Division Error in the variant filtration when there is no Allele depth #42

Closed
ramsainanduri opened this issue Jul 25, 2024 · 0 comments · Fixed by #43
Closed

Zero Division Error in the variant filtration when there is no Allele depth #42

ramsainanduri opened this issue Jul 25, 2024 · 0 comments · Fixed by #43
Labels
bug Something isn't working

Comments

@ramsainanduri
Copy link
Member

18 70465200 . A ATGTGGTGTGTGTGTGTGTGTGTTTGTGGTGTGTG 2461.73 . AC=2;AF=1;AN=2;DP=205;ExcessHet=3.0103;FS=0;MLEAC=2;MLEAF=1;MQ=55.52;SOR=0.693 GT:AD:DP:GQ:PL 1/1:0,0:0:99:2499,167,0
@ramsainanduri ramsainanduri added the bug Something isn't working label Jul 25, 2024
@ramsainanduri ramsainanduri linked a pull request Jul 25, 2024 that will close this issue
Fixed Zero division error when there is no allele depth for a variant #43
Merged
ramsainanduri added a commit that referenced this issue Jul 25, 2024
@ramsainanduri
Updated Changelog #42 #43
e58f9b9
ramsainanduri added a commit that referenced this issue Jul 25, 2024
@ramsainanduri
Fixed Zero division error when there is no allele depth for a variant (…
a4e25d7 
…#43)

* Fixed Zero division error when there is no allele depth for a variant

* Updated Changelog #42 #43
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
bug Something isn't working
Projects
None yet
Milestone
No milestone
1 participant
@ramsainanduri