vvv2_display

Description

Tools to create:

• a .png image file describing all variants (obtained from vardict-java variant caller) alongside a genome/assembly (to provide) with their proportion (ordinates), with CDS descriptions (obtained from vadr annotator). At the top of the figure can be displayed the coverage depth repartition (if -o cov_depth_f option is provided).

Python/R scripts and Galaxy wrapper to use them.

It uses the results of:

• vadr >= 1.4.1 for annotation (of reference/assembly, tested with vadr 1.6.4 too)
• vardict-java 1.8.3 for variant calling (of BAM alignement using reference/assembly and reads)

Programs

• vvv2_display.py: main script running each step of analyses This script can be run independently, once vvv2 conda environment is installed and activated. Type ./vvv2_display.py then enter to get help on how to use it.

• PYTHON_SCRIPTS/convert_tbl2json.py: Convert vadr annotation output .tbl file to json

• PYTHON_SCRIPTS/convert_vcffile_to_readablefile.py: Convert vardict-java variant calling vcf file to human readable txt file

• PYTHON_SCRIPTS/correct_multicontig_vardict_vcf.py: Correct vadr annotation output .tbl file for contigs positions when the assembly provided is composed of more than one contig.

• R_SCRIPTS/visualize_snp_v4.R: Create a .png file showing on the same png figure:
  • coverage depth repartition alongside the genome/assembly (if -o cov_depth_d option provided)
  • variant proportions alongside the genome/assembly and CDS positions.

Installation

Use conda environment:

conda create -n vvv2_display -y
conda activate vvv2_display
mamba/conda install -c bioconda vvv2_display

Prefer mamba installation if completely new conda environments (faster). Do not mix mamba and conda.

Description:

vvv2_display.py -h

Typical usage:

vvv2_display.py -p res_vadr_pass.tsv -f res_vadr_fail.tsv -s res_vadr_seqstat.txt -n res_vardict_all.vcf -r res_vvv2_display.png -o cov_depth_f.txt -y -w 10

where:

• res_vadr_pass.tsv is the 'pass' file of vadr annotation program run on the genome/assembly
• res_vadr_fail.tsv is the 'fail' file of vadr annotation program
• res_vadr_seqstat.txt is the 'seqstat' file of vadr annotation program
• res_vardict_all.vcf is the result of vardict-java variant caller
• res_vvv2_display.png is the name of the main output file (will be created)
• cov_depth_f.txt is the coverage depth by position, provided by samtools depth run on the bam alignement file
• -y tells to display coverage depth in linear scale (default log10 scale)
• -w 10 tells to set var significant threshold at 10% (default 7%): graphics display all variants, tsv summary will keep only significant ones (representation higher than this threshold)

All other options are for Galaxy wrapper compatibility (these are intermediate temporary files that must appear as parameter for Galaxy wrapper but are not used in a usual command line call)

Output example

Example is obtained on Turkey Coronavirus sequencing data, with as reference, the first draft assembly.

• png file:

Dotted vertical dash lines are contig boundaries.

• tsv summary file:

indice	position	ref	alt	freq	gene	prot	lseq	rseq	isHomo*
1	6388	A	G	0.1429	1a	ORF1a,ORF1ab polyprotein [exception ribosomal slippage],NSP3  putative papain-like protease	GTATTGTAGAAATTGTGATG	GTATGGTCATCAAAATACAT	no
2	6622	A	G	0.0833	1a	ORF1a,ORF1ab polyprotein [exception ribosomal slippage],NSP3  putative papain-like protease	GAAGAAAGCTGTTTTTCTTA	GGAAGCATTGAAATGTGAAC	no
3	6838	A	G	0.1429	1a	ORF1a,ORF1ab polyprotein [exception ribosomal slippage],NSP3  putative papain-like protease	AGTTTGTGACATTTTGTCTA	TATAATTTCTGTAGATACTG	no
4	7014	R	A	0.8824	1a	ORF1a,ORF1ab polyprotein [exception ribosomal slippage],NSP3  putative papain-like protease	TACCGTCATATGGTATAGAC	CTGATAAATTAACACCTCGT	no
5	7833	G	A	0.0909	1a	ORF1a,ORF1ab polyprotein [exception ribosomal slippage],NSP4	ATTGTTTTAATGGTGATAAT	ATGCACCTGGAGCTTTACCA	no
6	8110	T	A	0.0833	1a	ORF1a,ORF1ab polyprotein [exception ribosomal slippage],NSP4	AGAACTTATGTTTAATATGG	TAGTACATTCTTTACTGGTG	no
7	9328	A	G	0.1034	1a	ORF1a,ORF1ab polyprotein [exception ribosomal slippage],NSP5  putative 3C-like proteinase	TGCATTACACACTGGAACGG	CCTACATGGTGAGTTCTATG	no
8	13404	A	C	0.1429	intergene	intergene	GTTAGTGGGAACATCCAATA	TTTAGTTGATCTTAGAACGT	no
9	15255	A	T	0.0882	1ab	similar to ORF1ab polyprotein,similar to NSP13:GBSEP:putative helicase	CTGTGGTAATCATAAACCAA	GTTGTCAATACCGTTAGTAT	no
10	15319	C	T	0.0769	1ab	similar to ORF1ab polyprotein,similar to NSP13:GBSEP:putative helicase	TACAGGGCTAATTGTGCTGG	AGCGAAAATGTTGATGATTT	no
11	15326	A	G	0.08	1ab	similar to ORF1ab polyprotein,similar to NSP13:GBSEP:putative helicase	CTAATTGTGCTGGCAGCGAA	ATGTTGATGATTTTAATCAA	yes
12	19937	G	A	0.0714	1ab	similar to ORF1ab polyprotein,similar to NSP16:GBSEP:putative 2-O-ribose methyltransferase	TAACAGAGACAAGTTGGCAC	AAAATTTATATGACATTGCA	no
13	21092	T	C	0.0811	S	similar to spike protein	TTACGTGGTGATAACACTGG	GTTTCTTATGATTATCAGTG	no
14	25794	TT	AA	0.0838	5b	5b protein	AGGATTAGATTGTGTTTACT	CTTAACAAAGCAGGACAAGC	no

*NB: an homopolymer region is set to 'yes' if there is a succession of at least 3 identical nucleotides.
     it looks like a restrictive measure, but Ion Torrent and Nanopore sequencing are very bad on such region, so make sure you verify these variants.

Galaxy wrapper

• vvv2_display.xml: Allow Galaxy integration of vvv2_display.py. vvv2_display can be used in Galaxy pipelines.

Citation

Please, if you use vvv2_display and publish results, cite:

• Lai, Zhongwu, Aleksandra Markovets, Miika Ahdesmaki, Brad Chapman, Oliver Hofmann, Robert McEwen, Justin Johnson, Brian Dougherty, J. Carl Barrett, and Jonathan R. Dry. “VarDict: A Novel and Versatile Variant Caller for next-Generation Sequencing in Cancer Research.” Nucleic Acids Research 44, no. 11 (June 20, 2016): e108–e108. https://doi.org/10.1093/nar/gkw227.
• Schäffer, Alejandro A., Eneida L. Hatcher, Linda Yankie, Lara Shonkwiler, J. Rodney Brister, Ilene Karsch-Mizrachi, and Eric P. Nawrocki. “VADR: Validation and Annotation of Virus Sequence Submissions to GenBank.” BMC Bioinformatics 21, no. 1 (December 2020): 211. https://doi.org/10.1186/s12859-020-3537-3.
• Flageul, Alexandre, Pierrick Lucas, Edouard Hirchaud, Fabrice Touzain, Yannick Blanchard, Nicolas Eterradossi, Paul Brown, and Béatrice Grasland. “Viral Variant Visualizer (VVV): A Novel Bioinformatic Tool for Rapid and Simple Visualization of Viral Genetic Diversity.” Virus Research 291 (January 2021): 198201. https://doi.org/10.1016/j.virusres.2020.198201.