variable_assignment_in_r.qmd

# Variable Assignment in `R` {.unnumbered}

In `R` we operate with variables. A variable can be seen as a container for a value. To get a better conceptual understanding of this, you can go through the following and code-along in your own `R`-session.

## Assigning a Value to a Variable

- In `R`, we state values directly in the chunk or the console, e.g.:

```{r}
#| echo: true
#| eval: true
3
```

- Here, we just state `3`, so `R` simply "throws" that right back at you!

- Now, if want to "catch" that `3` we have to assign it to a variable, e.g.:

```{r}
#| echo: true
#| eval: true
x <- 3
```

- Notice how now we "catch" the `3` and nothing is "thrown" back to you, because we now have the `3` stored in `x`:

```{r}
#| echo: true
#| eval: true
x
```

## Updating the Value of a Variable

- Now, we can of course use `x` moving forward, e.g. by adding `2`:

```{r}
#| echo: true
#| eval: true
x + 2
```

- Notice how this does **not** change `x` and the result is simply "thrown" right-back-at-ya

```{r}
#| echo: true
#| eval: true
x
```

- If we wanted to update `x` by adding `2`, we would have to "catch" the result as before:

```{r}
#| echo: true
#| eval: true
x <- x + 2
```

- Now, we have updated `x`:

```{r}
#| echo: true
#| eval: true
x
```

## Use one Variable in the Creation of Another

- Analogue, we can create a new variable using x:

```{r}
#| echo: true
#| eval: true
y <- x + 3
```

- Again, this does **not** change `x`

```{r}
#| echo: true
#| eval: true
x
```

- But rather the result is now stored in `y`

```{r}
#| echo: true
#| eval: true
y
```


## Summary

- In `R`, we use the assignment operator `<-` to perform assignment
- Variables are not change in place, but needs to be stored
- Note, this also applies to running e.g. a `dplyr`-pipeline, where we do not change the dataset by running the pipeline, but we must store the result of the pipeline

*Before continuing, make sure that you are on track with the above concepts!*

- Create a new variable `my_age` containing... You guessed it!
- Add `0.5` to the variable (I.e. your age, when you're done with this course)
- Check the value of `my_age`, did you remember to assign, thereby updating?


## Pipeline Example

```{r}
#| echo: false
#| eval: true
#| message: false
library("tidyverse")
set.seed(779868)
my_dna_data <- tibble(
  sequence = replicate(
    n = 10,
    expr = paste0(
      x = sample(x = c("a", "c", "g", "t"),
                 size = sample(x = seq(3, 21, by = 3), size = 1, replace = TRUE),
                 replace = TRUE),
      collapse = "")))
```

- Let us create some example sequence data:

```{r}
#| echo: true
#| eval: true


tibble(sequence = c("aggtgtgag", "tggaatgaaccgcctacc",
                    "aagaatgga", "tct", "tgtatt", "tgg",
                    "accttcaacgagtcccactgt", "cgt",
                    "gaggctgagctggttgta", "ggggaacag"))
```

- Notice, that our data creation is just "thrown" back at us, we forgot something!

```{r}
#| echo: true
#| eval: true


my_dna_data <- tibble(sequence = c("aggtgtgag", "tggaatgaaccgcctacc",
                                   "aagaatgga", "tct", "tgtatt", "tgg",
                                   "accttcaacgagtcccactgt", "cgt",
                                   "gaggctgagctggttgta", "ggggaacag"))
```

- Now, we have stored the data in the variable `my_dna_data`

```{r}
#| echo: true
#| eval: true


my_dna_data
```

- Note here, that a variable can as we saw before with `x` and `y` store a single value, e.g. `2`, but here, we are storing a `tibble`-object in the variable `my_dna_data` and in that `tibble`-object, we have a variable `sequence`, which contains some randomly generated dna.

- But what if we wanted to add a new variable to the `tibble`-object, which is the lenght of each of the dna-sequences?

```{r}
#| echo: true
#| eval: true


my_dna_data |>
  mutate(dna_length = str_length(sequence))
```

Nice! Let's see that data again then:

```{r}
#| echo: true
#| eval: true


my_dna_data
```

- Wait! What? Where is the variable we literally just created?

- We forgot something... We did not update the `my_dna_data`, let's fix that:

```{r}
#| echo: true
#| eval: true


my_dna_data <- my_dna_data |>
  mutate(dna_length = str_length(sequence))
```

- Note, nothing is "trown" back at us! Let's verify, that we did indeed update the `my_dna_data`:

```{r}
#| echo: true
#| eval: true


my_dna_data
```

Did it make sense? Check yourself, add a new variable to `my_dna_data` called `sequence_capital` by using the function `str_to_upper()`

That's it - Hope it helped and remember... Bio data science in R is really fun!