diff --git a/.gitignore b/.gitignore index 8229f12..e44a518 100644 --- a/.gitignore +++ b/.gitignore @@ -1,2 +1,94 @@ + +# Byte-compiled / optimized / DLL files +__pycache__/ +*.py[cod] +*$py.class + +# C extensions +*.so + +# Distribution / packaging +.Python +env/ +build/ +develop-eggs/ +dist/ +downloads/ +eggs/ +.eggs/ +lib/ +lib64/ +parts/ +sdist/ +var/ +*.egg-info/ +.installed.cfg +*.egg + +# PyInstaller +# Usually these files are written by a python script from a template +# before PyInstaller builds the exe, so as to inject date/other infos into it. +*.manifest +*.spec + +# Installer logs +pip-log.txt +pip-delete-this-directory.txt + +# Unit test / coverage reports +htmlcov/ +.tox/ +.coverage +.coverage.* +.cache +nosetests.xml +coverage.xml +*,cover +.hypothesis/ + +# Translations +*.mo +*.pot + +# Django stuff: +*.log +local_settings.py + +# Flask stuff: +instance/ +.webassets-cache + +# Scrapy stuff: +.scrapy + +# Sphinx documentation +docs/_build/ + +# PyBuilder +target/ + +# IPython Notebook +.ipynb_checkpoints + +# pyenv +.python-version + +# celery beat schedule file +celerybeat-schedule + +# dotenv +.env + +# virtualenv +.venv/ +venv/ +ENV/ + +# Spyder project settings +.spyderproject + +# Rope project settings +.ropeproject + # IDE files -.idea \ No newline at end of file +.idea diff --git a/.version b/.version index 60fe1f2..a85e614 100644 --- a/.version +++ b/.version @@ -1 +1 @@ -v0.2 +v0.3 diff --git a/1-finding-earthquake-epicenters.html b/1-finding-earthquake-epicenters.html deleted file mode 100755 index 7c0d791..0000000 --- a/1-finding-earthquake-epicenters.html +++ /dev/null @@ -1,125 +0,0 @@ - - - - - - - - - - - - Finding earthquake epicenters | Project Lovelace - - - - - - - - - - - - - - -
-
- -

Finding earthquake epicenters

- - - -

Problem

-
-

Required math: algebra, geometry.

-

An earthquake occurs at some unknown location $(x,y), -100 < x,y < 100$ where $x,y$ are in kilometers (km). Modeling the Earth's surface as a flat 2D plane, the earthquake emits seismic waves which travel through the Earth and are detected by three seismographs. Given the arrival times of the seismic waves, and the locations of the three seismographs, determine the earthquake's source or epicenter $(x,y)$. Assume the seismic waves travel at a constant 6 km/s. (We're also assuming that the earthquake happens very close to the surface and that the seismographs are close to each other so the Earth's curvature is negligible.)

-
- -

Input

-
-

One line for each earthquake event, containing the $x$ and $y$-coordinates of the seismograph and the arrival times of the seismic waves.

- -
-
Example input
-
- x1 y1 t1 x2 y2 t2 x3 y3 t3
- 8.38235322677 -58.0037208141 12.8607541935 -13.590571819 73.976069096 22.8474885484 77.2911723706 7.50876445638 5.76780978383 -
-
-
- -

Output

-
-

A single line for each earthquake event giving the $(x,y)$ coordinate of the earthquake in km.

- -
-
Example output
-
- 79.0674612756 -27.0524778103 -
-
-
- -

Submit Your Code

-
- -
- -
-

-
-
- - - - - - - - - diff --git a/2-The-M198-howitzer.html b/2-The-M198-howitzer.html deleted file mode 100644 index 254ab4d..0000000 --- a/2-The-M198-howitzer.html +++ /dev/null @@ -1,152 +0,0 @@ - - - - - - - - - - - - The M198 Howitzer | Project Lovelace - - - - - - - - - - - - - - -
-
-

The M198 Howitzer

- -

Problem

-
-

Required math: ordinary differential equations.

-

Required physics: Newton's laws of motion.

- -

An M198 howitzer situated on a flat surface fires an M107 shell of mass $m$ at an angle $\theta$ to the horizon. The projectile leaves the howitzer's barrel at the coordinates $(x_0, y_0)$ with initial velocity $v_0$. During it's flight it is subjected to a drag force acting in the opposite direction to its motion $$\mathbf{F}_d = -\frac{1}{2}C\rho Av^2\hat{\mathbf{v}} $$ where $\rho$ is the density of the air, $C$ is the projectile's drag coefficient, $A$ is the projectile's area subject to the drag force, and $v$ is the projectile's velocity. $\hat{\mathbf{v}}$ is a unit vector in the direction of the projectile's velocity. Values for the constants are given below in the input section.

- -

What is the $x$-coordinate of the projectile's landing spot?

-
- -

Input

-
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
ConstantValueComments
$g$$9.80665 \; \mathrm{m/s^2}$Standard gravity
$\rho$$1.225 \; \mathrm{kg/m^3}$Density of air at sea level and 15°C
$m$$43 \; \mathrm{kg}$M107 155mm shell mass
$A$$188.7 \; \mathrm{m^2}$Exposed area of M107 155mm shell. Calculated using $A=\pi r^2$ where $r$ is the radius of a shell ($155/2 \; \mathrm{mm}$).
$C$$0.0579$Drag coefficient of M107 155m shell for speeds below mach 0.9.
- -

The firing angle $\theta$ in degres, initial muzzle velocity $v_0$ in m/s, and coordinates of the howitzer's bore $(x_0, y_0)$ in meters. All to four significant figures.

- -
-
Example input
-
- # theta v_0 x_0 y_0
- 9.683 241.4 2.362 1.756 -
-
-
- -

Output

-
-

The $x$-coordinate of the projectile's landing spot in meters, accurate to at least the nearest meter.

- -
-
Example output
-
- 2678.15 -
-
-
- - -
-
- - - - - - - - diff --git a/3-DNA-splicing.html b/3-DNA-splicing.html deleted file mode 100644 index 0337af0..0000000 --- a/3-DNA-splicing.html +++ /dev/null @@ -1,112 +0,0 @@ - - - - - - - - - - - - DNA splicing | Project Lovelace - - - - - - - - - - - - - - -
-
-

DNA splicing

- -

Problem

-
-

A DNA sequence is a string of ATCG characters representing possible nucleotide base. The complement of a DNA sequence is obtained by substituting each base with its base pair (A and T are one pair. C and G is the other). Together the two strands containing the sequence form a DNA molecule. A restriction enzyme cuts off DNA strands at a specific binding site in a DNA sequence. EcoRII is a restriction enzyme that searches for the sequence ---CCWGG--- where W could be either A or T, and splices it open like ---NN___CCWGGNN--- where another DNA strand can be spliced into the underscored region.

- -

Given a DNA sequence to be spliced using EcoRII and a DNA strand to be spliced in afterward, what is the complement of the DNA sequence resulting from the splicing process?

-
- -

Input

-
-

The DNA sequence to be spliced using the EcoRII restriction enzyme on the first line. The sequence strand to be inserted on the second line.

- -
-
Example input
-
- CCAGGACCAGGCCCCAGGTGGGGCCAGGCCAGGCTC
- GTACTC -
-
-
- -

Output

-
-

A single line containing the complementary DNA sequence after splicing.

- -
-
Example output
-
- CATGAGGGTCCTCATGAGGGTCCGGCATGAGGGTCCACCCCCATGAGGGTCCCATGAGGGTCCGAG -
-
-
- - -
-
- - - - - - - - diff --git a/Makefile b/Makefile new file mode 100644 index 0000000..1bb7f1a --- /dev/null +++ b/Makefile @@ -0,0 +1,15 @@ +prepare-venv: clean + @echo "Creating new virtual environment..." + virtualenv -p python3.6 --no-site-packages env + env/bin/pip install -r requirements.txt + +update-requirements: + @echo "Updating environment requirements..." + env/bin/pip freeze > requirements.txt + +start: + @echo "Not implemented..." + +clean: + @echo "Deleting old virtual environment..." + rm -rf ./env diff --git a/T1-first-order-equations-the-euler-method.html b/T1-first-order-equations-the-euler-method.html deleted file mode 100644 index d00a848..0000000 --- a/T1-first-order-equations-the-euler-method.html +++ /dev/null @@ -1,149 +0,0 @@ - - - - - - - - - - - - First-order equation: The Euler method | Project Lovelace - - - - - - - - - - - - - - -
-
-

First-order equations: The Euler method

- -

Tutorial

-
-

Required math: Differential calculus.

- - -

The laws of nature are often written down in terms of differential equations. Everything from the motion of a baseball and cannon shells to the quantum state of a particle and the global ocean circulation are described in terms of differential equations. Without them, we wouldn't be able to understand most physical phenomena!

- -

A differential equation (DE) in a dependent variable $y(t)$ is any equation containing $y(t)$ and its derivatives. A first-order DE only contains $y(t)$ and its first derivative $\frac{dy}{dt}$. So one way to write a general first-order DE is - - $$ \frac{dy(t)}{dt} = f \left( t,y(t) \right) $$

- -

Many DE's can be solved by hand but many more cannot, making numerical/computational solutions very useful. In this tutorial you will solve a first-order ordinary differential equation (ODE) using Euler's method. The appendix discusses Euler's method more generally

- - -

The ODE given in the problem may be solved by hand however you will solve it using Euler's method. To implement the method, the first step is to approximate the derivative by a finite difference - - $$ \frac{\Delta P}{\Delta t} = \left( 1 - \frac{P}{K} \right) rP $$ - - where $\Delta P$ is the change in $P$ between two iterations of Euler's method and $\Delta t$ is the time step between iterations. Explicitly writing $\Delta P = P_{i+1} - P_i$ we can write - - $$ \frac{P_{i+1} - P_i}{\Delta t} = \left( 1 - \frac{P_i}{K} \right) rP_i $$ - - or solving for $P_{i+1}$ we get - - $$ P_{i+1} = P_i + \left( 1 - \frac{P_i}{K} \right) rP_i\Delta t $$

- -

We can then pick a small value for $\Delta t$ and approximate the solution starting from $t=0$. $P(0)=P_0$ is given as an input so we can calculate - - $$ P(\Delta t) = P_1 = P_0 + \left( 1 - \frac{P_0}{K} \right) rP_0\Delta t $$ - $$ P(2\Delta t) = P_2 = P_1 + \left( 1 - \frac{P_1}{K} \right) rP_1\Delta t $$ - - and so on until you have enough of the solution as desired. The smaller you pick $\Delta t$ to be, the more accurate your solution will be in generaly; however, it will take more steps to compute.

-
- -

Problem

-
-

Let $P = P(t)$ denote the population of geese on a university campus as a function of time (days). Then the population can be modelled by the differential equation - - $$ \frac{dP}{dt} = \left( 1 - \frac{P}{K} \right) rP \quad $$ - - with the initial condition $P(0) = P_0$, where $K$ is the "carrying capacity" or the maximum number of geese the campus may sustain according to the model, and $r$ is the growth rate of the geese. $P_0$ is the initial geese population at time $t=0$.

- -

The university would like to keep the population at a reasonable level and so it's your job to predict when the goose population will reach half the carrying capacity $(K/2)$.

-
- -

Input

-
-

Values for $K$, $r$, and $P_0$.

- -
-
Example input
-
- K r P_0
- 800 4.5 150 -
-
-
- -

Output

-
-

The number of days (rounded down to the nearest integer) on which the population reaches $K/2$.

- -
-
Example output
-
- 37 -
-
-
- - -
-
- - - - - - - - diff --git a/about.html b/about.html deleted file mode 100644 index 43d94fd..0000000 --- a/about.html +++ /dev/null @@ -1,77 +0,0 @@ - - - - - - - - - - - - About | Project Lovelace - - - - - - - - - -
-
-

About

- -

What is Project Lovelace?

-
-
-

Project Lovelace is an open online platform for learning about science and developing computational thinking through programming and problem solving. It is a collection of computational science problems and tutorials taken from all branches of the natural, social, and mathematical sciences. Each problem teaches a scientific application (e.g. locating earthquakes, DNA splicing) and requires the use of scientific insight and some programming skills to solve. Tutorials teach computational methods that students and researchers may find useful (e.g. solving differential equations, Bayesian inference) and may be required knowledge for some problems.

- -

While Project Lovelace is still in development, we are deploying the website and the problems one by one throughout the winter. In addition to the website's recreational aspect we ultimately hope that the problems and tutorials may be used in undergraduate courses, especially to complement courses that lack a computational portion as computational methods have become ubiquitous in almost every field of science.

- -

Lovelace draws inspiration from similar projects such as Project Euler and Rosalind.

-
- -
- - The name commemorates Ada Lovelace who proposed the first algorithm to be run on a computer in the 1840's. -
-
-
- - - - - - - - diff --git a/contact.html b/contact.html deleted file mode 100644 index e96b395..0000000 --- a/contact.html +++ /dev/null @@ -1,65 +0,0 @@ - - - - - - - - - - - - Project Lovelace - - - - - - - - - -
-
-

Contact

-

Check back soon!

-
-
- - - - - - - - diff --git a/error.html b/error.html deleted file mode 100644 index 515a2a0..0000000 --- a/error.html +++ /dev/null @@ -1,65 +0,0 @@ - - - - - - - - - - - - 404 - Project Lovelace - - - - - - - - - -
-
-

Uh-oh!

-

404 Error - Page Not Found

-
-

Home page »

-
-
- - - - - - - - diff --git a/index.html b/index.html deleted file mode 100755 index 1f82437..0000000 --- a/index.html +++ /dev/null @@ -1,84 +0,0 @@ - - - - - - - - - - - - Project Lovelace - - - - - - - - - -
-
-

Welcome to Project Lovelace!

-

Project Lovelace is an open online platform for learning about science and developing computational thinking through programming and problem solving. We are deploying the website and the problems one by one throughout the winter in preparation for a pilot run in April 2017.

-

Check Out the problems »

-
-
- -
-
-
-

Problems

-

Each problem teaches a scientific application (e.g. locating earthquakes, DNA splicing) and requires the use of scientific insight and some programming skills to solve.

-

Check out the problems »

-
-
-

Tutorials

-

Tutorials teach computational methods that students and researchers may find useful (e.g. solving differential equations, Bayesian inference) and tend to be more pedagogical than the problems.

-

Check out the tutorials »

-
-
-

About

-

We're hoping to not only become a recreational science and programming website, but also a resource for developing computational thinking in science students.

-

Find out more about us »

-
-
-
- - - - - - - - diff --git a/problems.html b/problems.html deleted file mode 100644 index d67842e..0000000 --- a/problems.html +++ /dev/null @@ -1,100 +0,0 @@ - - - - - - - - - - - - Problems | Project Lovelace - - - - - - - - - -
-
-

Problems

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

ID#

Problem title

1

Finding earthquake epicenters

2

The M198 howitzer

3

DNA splicing

4

Convex chocolate chip cookies

5

Simulating the Enigma machine

- -
-
- - - - - - - - diff --git a/requirements.txt b/requirements.txt new file mode 100644 index 0000000..1ed814e --- /dev/null +++ b/requirements.txt @@ -0,0 +1,7 @@ +appdirs==1.4.3 +Django==1.11.1 +packaging==16.8 +psycopg2==2.7.1 +pyparsing==2.2.0 +pytz==2017.2 +six==1.10.0 diff --git a/src/db.sqlite3 b/src/db.sqlite3 new file mode 100644 index 0000000..0bf588f Binary files /dev/null and b/src/db.sqlite3 differ diff --git a/src/lovelace/__init__.py b/src/lovelace/__init__.py new file mode 100644 index 0000000..e69de29 diff --git a/src/lovelace/settings.py b/src/lovelace/settings.py new file mode 100644 index 0000000..37899f9 --- /dev/null +++ b/src/lovelace/settings.py @@ -0,0 +1,125 @@ +""" +Django settings for lovelace project. + +Generated by 'django-admin startproject' using Django 1.11.1. + +For more information on this file, see +https://docs.djangoproject.com/en/1.11/topics/settings/ + +For the full list of settings and their values, see +https://docs.djangoproject.com/en/1.11/ref/settings/ +""" + +import os + +# Build paths inside the project like this: os.path.join(BASE_DIR, ...) +BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) + + +# Quick-start development settings - unsuitable for production +# See https://docs.djangoproject.com/en/1.11/howto/deployment/checklist/ + +# SECURITY WARNING: keep the secret key used in production secret! +SECRET_KEY = 'foobar' + +# SECURITY WARNING: don't run with debug turned on in production! +DEBUG = True + +ALLOWED_HOSTS = [] + + +# Application definition + +INSTALLED_APPS = [ + 'problems.apps.ProblemsConfig', + 'django.contrib.admin', + 'django.contrib.auth', + 'django.contrib.contenttypes', + 'django.contrib.sessions', + 'django.contrib.messages', + 'django.contrib.staticfiles', +] + +MIDDLEWARE = [ + 'django.middleware.security.SecurityMiddleware', + 'django.contrib.sessions.middleware.SessionMiddleware', + 'django.middleware.common.CommonMiddleware', + 'django.middleware.csrf.CsrfViewMiddleware', + 'django.contrib.auth.middleware.AuthenticationMiddleware', + 'django.contrib.messages.middleware.MessageMiddleware', + 'django.middleware.clickjacking.XFrameOptionsMiddleware', +] + +ROOT_URLCONF = 'lovelace.urls' + +TEMPLATES = [ + { + 'BACKEND': 'django.template.backends.django.DjangoTemplates', + 'DIRS': ['templates'], # look in the project-level templates directory for templates + 'APP_DIRS': True, + 'OPTIONS': { + 'context_processors': [ + 'django.template.context_processors.debug', + 'django.template.context_processors.request', + 'django.contrib.auth.context_processors.auth', + 'django.contrib.messages.context_processors.messages', + ], + }, + }, +] + +WSGI_APPLICATION = 'lovelace.wsgi.application' + + +# Database +# https://docs.djangoproject.com/en/1.11/ref/settings/#databases + +DATABASES = { + 'default': { + 'ENGINE': 'django.db.backends.sqlite3', + 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), + } +} + + +# Password validation +# https://docs.djangoproject.com/en/1.11/ref/settings/#auth-password-validators + +AUTH_PASSWORD_VALIDATORS = [ + { + 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', + }, + { + 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', + }, + { + 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', + }, + { + 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', + }, +] + + +# Internationalization +# https://docs.djangoproject.com/en/1.11/topics/i18n/ + +LANGUAGE_CODE = 'en-us' + +TIME_ZONE = 'Canada/Eastern' + +USE_I18N = True + +USE_L10N = True + +USE_TZ = True + + +# Static files (CSS, JavaScript, Images) +# https://docs.djangoproject.com/en/1.11/howto/static-files/ + +STATIC_URL = '/static/' + +STATICFILES_DIRS = [ + 'static' # look for static files in the project-level static directory +] diff --git a/src/lovelace/urls.py b/src/lovelace/urls.py new file mode 100644 index 0000000..a70a060 --- /dev/null +++ b/src/lovelace/urls.py @@ -0,0 +1,28 @@ +"""lovelace URL Configuration + +The `urlpatterns` list routes URLs to views. For more information please see: + https://docs.djangoproject.com/en/1.11/topics/http/urls/ +Examples: +Function views + 1. Add an import: from my_app import views + 2. Add a URL to urlpatterns: url(r'^$', views.home, name='home') +Class-based views + 1. Add an import: from other_app.views import Home + 2. Add a URL to urlpatterns: url(r'^$', Home.as_view(), name='home') +Including another URLconf + 1. Import the include() function: from django.conf.urls import url, include + 2. Add a URL to urlpatterns: url(r'^blog/', include('blog.urls')) +""" +from django.conf.urls import include, url +from django.contrib import admin +from django.views.generic import TemplateView + +urlpatterns = [ + url(r'^problems/', include('problems.urls')), + url(r'^admin/', admin.site.urls), + url(r'^$', TemplateView.as_view(template_name='index.html')), + url(r'^about$', TemplateView.as_view(template_name='about.html')), + url(r'^contact$', TemplateView.as_view(template_name='contact.html')), + url(r'^tutorials$', TemplateView.as_view(template_name='temporary/tutorials.html')), + url(r'^tutorials/1$', TemplateView.as_view(template_name='temporary/tutorial_1.html')), +] diff --git a/src/lovelace/wsgi.py b/src/lovelace/wsgi.py new file mode 100644 index 0000000..7e8e416 --- /dev/null +++ b/src/lovelace/wsgi.py @@ -0,0 +1,16 @@ +""" +WSGI config for lovelace project. + +It exposes the WSGI callable as a module-level variable named ``application``. + +For more information on this file, see +https://docs.djangoproject.com/en/1.11/howto/deployment/wsgi/ +""" + +import os + +from django.core.wsgi import get_wsgi_application + +os.environ.setdefault("DJANGO_SETTINGS_MODULE", "lovelace.settings") + +application = get_wsgi_application() diff --git a/src/manage.py b/src/manage.py new file mode 100755 index 0000000..fe70aa8 --- /dev/null +++ b/src/manage.py @@ -0,0 +1,22 @@ +#!/usr/bin/env python +import os +import sys + +if __name__ == "__main__": + os.environ.setdefault("DJANGO_SETTINGS_MODULE", "lovelace.settings") + try: + from django.core.management import execute_from_command_line + except ImportError: + # The above import may fail for some other reason. Ensure that the + # issue is really that Django is missing to avoid masking other + # exceptions on Python 2. + try: + import django + except ImportError: + raise ImportError( + "Couldn't import Django. Are you sure it's installed and " + "available on your PYTHONPATH environment variable? Did you " + "forget to activate a virtual environment?" + ) + raise + execute_from_command_line(sys.argv) diff --git a/src/problems/__init__.py b/src/problems/__init__.py new file mode 100644 index 0000000..e69de29 diff --git a/src/problems/admin.py b/src/problems/admin.py new file mode 100644 index 0000000..ae4103a --- /dev/null +++ b/src/problems/admin.py @@ -0,0 +1,6 @@ +from django.contrib import admin + +from .models import Problem + + +admin.site.register(Problem) diff --git a/src/problems/apps.py b/src/problems/apps.py new file mode 100644 index 0000000..d943a72 --- /dev/null +++ b/src/problems/apps.py @@ -0,0 +1,5 @@ +from django.apps import AppConfig + + +class ProblemsConfig(AppConfig): + name = 'problems' diff --git a/src/problems/migrations/0001_initial.py b/src/problems/migrations/0001_initial.py new file mode 100644 index 0000000..b3fa067 --- /dev/null +++ b/src/problems/migrations/0001_initial.py @@ -0,0 +1,37 @@ +# -*- coding: utf-8 -*- +# Generated by Django 1.11.1 on 2017-05-30 03:35 +from __future__ import unicode_literals + +import datetime +from django.db import migrations, models +import django.db.models.deletion + + +class Migration(migrations.Migration): + + initial = True + + dependencies = [ + ] + + operations = [ + migrations.CreateModel( + name='Problem', + fields=[ + ('id', models.AutoField(primary_key=True, serialize=False)), + ('name', models.CharField(max_length=128)), + ('date_added', models.DateField(blank=True, default=datetime.date.today)), + ('visible', models.BooleanField(default=False)), + ], + ), + migrations.CreateModel( + name='Submission', + fields=[ + ('id', models.AutoField(primary_key=True, serialize=False)), + ('date', models.DateTimeField(auto_now_add=True, verbose_name='date submitted')), + ('language', models.CharField(max_length=64, verbose_name='programming language')), + ('file', models.BinaryField(verbose_name='source code file')), + ('problem', models.ForeignKey(on_delete=django.db.models.deletion.PROTECT, to='problems.Problem')), + ], + ), + ] diff --git a/src/problems/migrations/__init__.py b/src/problems/migrations/__init__.py new file mode 100644 index 0000000..e69de29 diff --git a/src/problems/models.py b/src/problems/models.py new file mode 100644 index 0000000..820eab6 --- /dev/null +++ b/src/problems/models.py @@ -0,0 +1,26 @@ +from datetime import date + +# from django.conf import settings +from django.db import models + + +class Problem(models.Model): + id = models.AutoField(primary_key=True) + name = models.CharField(max_length=128, blank=False) # ex: "Finding Earthquake Epicenters" + date_added = models.DateField(default=date.today, blank=True, editable=True) + visible = models.BooleanField(default=False) + + def __str__(self): + return self.name + + +class Submission(models.Model): + id = models.AutoField(primary_key=True) + # user = models.ForeignKey(settings.AUTH_USER_MODEL) + problem = models.ForeignKey(Problem, on_delete=models.PROTECT) + date = models.DateTimeField(auto_now_add=True, verbose_name='date submitted') + language = models.CharField(max_length=64, verbose_name='programming language') + file = models.BinaryField(verbose_name='source code file') + + def __str__(self): + return self.id diff --git a/src/problems/templates/problems/index.html b/src/problems/templates/problems/index.html new file mode 100644 index 0000000..320543a --- /dev/null +++ b/src/problems/templates/problems/index.html @@ -0,0 +1,33 @@ +{% extends "base.html" %} +{% load static %} + +{% block body %} +
+
+

Problems

+ + {% if latest_problem_list %} + + + + + + + + + + {% for problem in latest_problem_list %} + + + + + {% endfor %} + +

ID#

Problem title

{{ problem.id }}

{{ problem.name }}

+ {% else %} +

No questions are available.

+ {% endif %} + +
+
+{% endblock %} diff --git a/src/problems/templates/problems/problem.html b/src/problems/templates/problems/problem.html new file mode 100644 index 0000000..e70e65a --- /dev/null +++ b/src/problems/templates/problems/problem.html @@ -0,0 +1,84 @@ +{% extends "base.html" %} +{% load static %} + +{% block preload_javascript %} + + + +{% endblock %} + +{% block body %} +
+
+ +

+ {% block problem_name %} + Problem Title Goes Here + {% endblock %} +

+ + {% block introduction %} + {% endblock %} + +

Problem

+
+ {% block required %} +

Required math: Required Math Goes Here.

+ {% endblock %} + +

+ {% block problem_body %} + Problem Body Goes Here + {% endblock %} +

+
+ +

Input

+
+ {% block input_description %} + Problem Input Goes Here + {% endblock %} + +
+
Example input
+
+ {% block input_example %} + Input Example Goes Here + {% endblock %} +
+
+
+ +

Output

+
+ {% block output_description %} + Output Description Goes Here + {% endblock %} + +
+
Example output
+
+ {% block output_example %} + Output Example Goes Here + {% endblock %} +
+
+
+ +

Submit Your Code

+
+ +
+ +
+

+
+
+{% endblock %} + +{% block postload_javascript %} + + +{% endblock %} \ No newline at end of file diff --git a/src/problems/templates/problems/problem_1.html b/src/problems/templates/problems/problem_1.html new file mode 100644 index 0000000..bf13c8b --- /dev/null +++ b/src/problems/templates/problems/problem_1.html @@ -0,0 +1,48 @@ +{% extends "problems/problem.html" %} + +{% block page_title %} + {{ problem.name }} | Project Lovelace +{% endblock %} + +{% block problem_name %} + {{ problem.name }} +{% endblock %} + +{% block required %} +

Required math: Required Math Goes Here.

+{% endblock %} + +{% block problem_body %} +

+ An earthquake occurs at some unknown location $(x,y), -100 < x,y < 100$ where $x,y$ are in + kilometers (km). Modeling the Earth's surface as a flat 2D plane, the earthquake emits + seismic waves which travel through the Earth and are detected by three seismographs. Given + the arrival times of the seismic waves, and the locations of the three seismographs, + determine the earthquake's source or epicenter $(x,y)$. Assume the seismic waves travel at + a constant 6 km/s. (We're also assuming that the earthquake happens very close to the + surface and that the seismographs are close to each other so the Earth's curvature is + negligible.) +

+{% endblock %} + +{% block input_description %} +

+ One line for each earthquake event, containing the $x$ and $y$-coordinates of the + seismograph and the arrival times of the seismic waves. +

+{% endblock %} + +{% block input_example %} + x1 y1 t1 x2 y2 t2 x3 y3 t3
+ 8.38235322677 -58.0037208141 12.8607541935 -13.590571819 73.976069096 22.8474885484 77.2911723706 7.50876445638 5.76780978383 +{% endblock %} + +{% block output_description %} +

+ A single line for each earthquake event giving the $(x,y)$ coordinate of the earthquake in km. +

+{% endblock %} + +{% block output_example %} + 79.0674612756 -27.0524778103 +{% endblock %} diff --git a/src/problems/templates/problems/problem_2.html b/src/problems/templates/problems/problem_2.html new file mode 100644 index 0000000..6fe7389 --- /dev/null +++ b/src/problems/templates/problems/problem_2.html @@ -0,0 +1,87 @@ +{% extends "problems/problem.html" %} + +{% block problem_name %}{{ problem.name }}{% endblock %} + +{% block required %} +

Required math: ordinary differential equations.

+

Required physics: Newton's laws of motion.

+{% endblock %} + +{% block problem_body %} +

+ An M198 howitzer situated on a flat surface fires an M107 shell of mass $m$ at an angle + $\theta$ to the horizon. The projectile leaves the howitzer's barrel at the coordinates + $(x_0, y_0)$ with initial velocity $v_0$. During it's flight it is subjected to a drag + force acting in the opposite direction to its motion + + $$\mathbf{F}_d = -\frac{1}{2}C\rho Av^2\hat{\mathbf{v}} $$ + + where $\rho$ is the density of the air, $C$ is the projectile's drag coefficient, $A$ is + the projectile's area subject to the drag force, and $v$ is the projectile's velocity. + $\hat{\mathbf{v}}$ is a unit vector in the direction of the projectile's velocity. + Values for the constants are given below in the input section. +

+

+ What is the $x$-coordinate of the projectile's landing spot? +

+{% endblock %} + +{% block input_description %} + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
ConstantValueComments
$g$$9.80665 \; \mathrm{m/s^2}$Standard gravity
$\rho$$1.225 \; \mathrm{kg/m^3}$Density of air at sea level and 15°C
$m$$43 \; \mathrm{kg}$M107 155mm shell mass
$A$$188.7 \; \mathrm{m^2}$Exposed area of M107 155mm shell. Calculated using $A=\pi r^2$ where $r$ is the radius of a shell ($155/2 \; \mathrm{mm}$).
$C$$0.0579$Drag coefficient of M107 155m shell for speeds below mach 0.9.
+ +

+ The firing angle $\theta$ in degres, initial muzzle velocity $v_0$ in m/s, and coordinates + of the howitzer's bore $(x_0, y_0)$ in meters. All to four significant figures. +

+{% endblock %} + +{% block input_example %} + # theta v_0 x_0 y_0
+ 9.683 241.4 2.362 1.756 +{% endblock %} + +{% block output_description %} +

+ The $x$-coordinate of the projectile's landing spot in meters, accurate to at least the + nearest meter. +

+{% endblock %} + +{% block output_example %} + 2678.15 +{% endblock %} diff --git a/src/problems/templates/problems/problem_3.html b/src/problems/templates/problems/problem_3.html new file mode 100644 index 0000000..0a3a2d8 --- /dev/null +++ b/src/problems/templates/problems/problem_3.html @@ -0,0 +1,46 @@ +{% extends "problems/problem.html" %} + +{% block problem_name %}{{ problem.name }}{% endblock %} + +{% block required %} +

Required math: Required Math Goes Here.

+{% endblock %} + +{% block problem_body %} +

+ A DNA sequence is a string of ATCG characters representing possible nucleotide + base. The complement of a DNA sequence is obtained by substituting each base with its base + pair (A and T are one pair. C and G is the other). + Together the two strands containing the sequence form a DNA molecule. A restriction enzyme + cuts off DNA strands at a specific binding site in a DNA sequence. EcoRII is a restriction + enzyme that searches for the sequence ---CCWGG--- where W could be either + A or T, and splices it open like ---NN___CCWGGNN--- where + another DNA strand can be spliced into the underscored region. +

+

+ Given a DNA sequence to be spliced using EcoRII and a DNA strand to be spliced in + afterward, what is the complement of the DNA sequence resulting from the splicing process? +

+{% endblock %} + +{% block input_description %} +

+ The DNA sequence to be spliced using the EcoRII restriction enzyme on the first line. + The sequence strand to be inserted on the second line. +

+{% endblock %} + +{% block input_example %} + CCAGGACCAGGCCCCAGGTGGGGCCAGGCCAGGCTC
+ GTACTC +{% endblock %} + +{% block output_description %} +

+ A single line containing the complementary DNA sequence after splicing. +

+{% endblock %} + +{% block output_example %} + CATGAGGGTCCTCATGAGGGTCCGGCATGAGGGTCCACCCCCATGAGGGTCCCATGAGGGTCCGAG +{% endblock %} diff --git a/src/problems/tests.py b/src/problems/tests.py new file mode 100644 index 0000000..7ce503c --- /dev/null +++ b/src/problems/tests.py @@ -0,0 +1,3 @@ +from django.test import TestCase + +# Create your tests here. diff --git a/src/problems/urls.py b/src/problems/urls.py new file mode 100644 index 0000000..a6ab15c --- /dev/null +++ b/src/problems/urls.py @@ -0,0 +1,11 @@ +from django.conf.urls import url + +from . import views + +app_name = 'problems' +urlpatterns = [ + # ex: /problems/ + url(r'^$', views.index, name='index'), + # ex: /problems/5/ + url(r'^(?P[0-9]+)/$', views.detail, name='detail'), +] diff --git a/src/problems/views.py b/src/problems/views.py new file mode 100644 index 0000000..0a0655d --- /dev/null +++ b/src/problems/views.py @@ -0,0 +1,18 @@ +from django.http import HttpResponseRedirect, Http404 +from django.shortcuts import get_object_or_404, render +from django.urls import reverse + +from .models import Problem, Submission + + +def index(request): + latest_problem_list = Problem.objects.order_by('id') + context = {'latest_problem_list': latest_problem_list} + return render(request, 'problems/index.html', context) + + +def detail(request, problem_id): + problem = get_object_or_404(Problem, pk=problem_id) + template = 'problems/problem_' + str(problem.id) + '.html' + context = {'problem': problem} + return render(request, template, context) diff --git a/src/static/css/bootstrap.css b/src/static/css/bootstrap.css new file mode 100644 index 0000000..6167622 --- /dev/null +++ b/src/static/css/bootstrap.css @@ -0,0 +1,6757 @@ +/*! + * Bootstrap v3.3.7 (http://getbootstrap.com) + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + */ +/*! normalize.css v3.0.3 | MIT License | github.com/necolas/normalize.css */ +html { + font-family: sans-serif; + -webkit-text-size-adjust: 100%; + -ms-text-size-adjust: 100%; +} +body { + margin: 0; +} +article, +aside, +details, +figcaption, +figure, +footer, +header, +hgroup, +main, +menu, +nav, +section, +summary { + display: block; +} +audio, +canvas, +progress, +video { + display: inline-block; + vertical-align: baseline; +} +audio:not([controls]) { + display: none; + height: 0; +} +[hidden], +template { + display: none; +} +a { + background-color: transparent; +} +a:active, +a:hover { + outline: 0; +} +abbr[title] { + border-bottom: 1px dotted; +} +b, +strong { + font-weight: bold; +} +dfn { + font-style: italic; +} +h1 { + margin: .67em 0; + font-size: 2em; +} +mark { + color: #000; + background: #ff0; +} +small { + font-size: 80%; +} +sub, +sup { + position: relative; + font-size: 75%; + line-height: 0; + vertical-align: baseline; +} +sup { + top: -.5em; +} +sub { + bottom: -.25em; +} +img { + border: 0; +} +svg:not(:root) { + overflow: hidden; +} +figure { + margin: 1em 40px; +} +hr { + height: 0; + -webkit-box-sizing: content-box; + -moz-box-sizing: content-box; + box-sizing: content-box; +} +pre { + overflow: auto; +} +code, +kbd, +pre, +samp { + font-family: monospace, monospace; + font-size: 1em; +} +button, +input, +optgroup, +select, +textarea { + margin: 0; + font: inherit; + color: inherit; +} +button { + overflow: visible; +} +button, +select { + text-transform: none; +} +button, +html input[type="button"], +input[type="reset"], +input[type="submit"] { + -webkit-appearance: button; + cursor: pointer; +} +button[disabled], +html input[disabled] { + cursor: default; +} +button::-moz-focus-inner, +input::-moz-focus-inner { + padding: 0; + border: 0; +} +input { + line-height: normal; +} +input[type="checkbox"], +input[type="radio"] { + -webkit-box-sizing: border-box; + -moz-box-sizing: border-box; + box-sizing: border-box; + padding: 0; +} +input[type="number"]::-webkit-inner-spin-button, +input[type="number"]::-webkit-outer-spin-button { + height: auto; +} +input[type="search"] { + -webkit-box-sizing: content-box; + -moz-box-sizing: content-box; + box-sizing: content-box; + -webkit-appearance: textfield; +} +input[type="search"]::-webkit-search-cancel-button, +input[type="search"]::-webkit-search-decoration { + -webkit-appearance: none; +} +fieldset { + padding: .35em .625em .75em; + margin: 0 2px; + border: 1px solid #c0c0c0; +} +legend { + padding: 0; + border: 0; +} +textarea { + overflow: auto; +} +optgroup { + font-weight: bold; +} +table { + border-spacing: 0; + border-collapse: collapse; +} +td, +th { + padding: 0; +} +/*! Source: https://github.com/h5bp/html5-boilerplate/blob/master/src/css/main.css */ +@media print { + *, + *:before, + *:after { + color: #000 !important; + text-shadow: none !important; + background: transparent !important; + -webkit-box-shadow: none !important; + box-shadow: none !important; + } + a, + a:visited { + text-decoration: underline; + } + a[href]:after { + content: " (" attr(href) ")"; + } + abbr[title]:after { + content: " (" attr(title) ")"; + } + a[href^="#"]:after, + a[href^="javascript:"]:after { + content: ""; + } + pre, + blockquote { + border: 1px solid #999; + + page-break-inside: avoid; + } + thead { + display: table-header-group; + } + tr, + img { + page-break-inside: avoid; + } + img { + max-width: 100% !important; + } + p, + h2, + h3 { + orphans: 3; + widows: 3; + } + h2, + h3 { + page-break-after: avoid; + } + .navbar { + display: none; + } + .btn > .caret, + .dropup > .btn > .caret { + border-top-color: #000 !important; + } + .label { + border: 1px solid #000; + } + .table { + border-collapse: collapse !important; + } + .table td, + .table th { + background-color: #fff !important; + } + .table-bordered th, + .table-bordered td { + border: 1px solid #ddd !important; + } +} +@font-face { + font-family: 'Glyphicons Halflings'; + + src: url('../fonts/glyphicons-halflings-regular.eot'); + src: url('../fonts/glyphicons-halflings-regular.eot?#iefix') format('embedded-opentype'), url('../fonts/glyphicons-halflings-regular.woff2') format('woff2'), url('../fonts/glyphicons-halflings-regular.woff') format('woff'), url('../fonts/glyphicons-halflings-regular.ttf') format('truetype'), url('../fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular') format('svg'); +} +.glyphicon { + position: relative; + top: 1px; + display: inline-block; + font-family: 'Glyphicons Halflings'; + font-style: normal; + font-weight: normal; + line-height: 1; + + -webkit-font-smoothing: antialiased; + -moz-osx-font-smoothing: grayscale; +} +.glyphicon-asterisk:before { + content: "\002a"; +} +.glyphicon-plus:before { + content: "\002b"; +} +.glyphicon-euro:before, +.glyphicon-eur:before { + content: "\20ac"; +} +.glyphicon-minus:before { + content: "\2212"; +} +.glyphicon-cloud:before { + content: "\2601"; +} +.glyphicon-envelope:before { + content: "\2709"; +} +.glyphicon-pencil:before { + content: "\270f"; +} +.glyphicon-glass:before { + content: "\e001"; +} +.glyphicon-music:before { + content: "\e002"; +} +.glyphicon-search:before { + content: "\e003"; +} +.glyphicon-heart:before { + content: "\e005"; +} +.glyphicon-star:before { + content: "\e006"; +} +.glyphicon-star-empty:before { + content: "\e007"; +} +.glyphicon-user:before { + content: "\e008"; +} +.glyphicon-film:before { + content: "\e009"; +} +.glyphicon-th-large:before { + content: "\e010"; +} +.glyphicon-th:before { + content: "\e011"; +} +.glyphicon-th-list:before { + content: "\e012"; +} +.glyphicon-ok:before { + content: "\e013"; +} +.glyphicon-remove:before { + content: "\e014"; +} +.glyphicon-zoom-in:before { + content: "\e015"; +} +.glyphicon-zoom-out:before { + content: "\e016"; +} +.glyphicon-off:before { + content: "\e017"; +} +.glyphicon-signal:before { + content: "\e018"; +} +.glyphicon-cog:before { + content: "\e019"; +} +.glyphicon-trash:before { + content: "\e020"; +} +.glyphicon-home:before { + content: "\e021"; +} +.glyphicon-file:before { + content: "\e022"; +} +.glyphicon-time:before { + content: "\e023"; +} +.glyphicon-road:before { + content: "\e024"; +} +.glyphicon-download-alt:before { + content: "\e025"; +} +.glyphicon-download:before { + content: "\e026"; +} +.glyphicon-upload:before { + content: "\e027"; +} +.glyphicon-inbox:before { + content: "\e028"; +} +.glyphicon-play-circle:before { + content: "\e029"; +} +.glyphicon-repeat:before { + content: "\e030"; +} +.glyphicon-refresh:before { + content: "\e031"; +} +.glyphicon-list-alt:before { + content: "\e032"; +} +.glyphicon-lock:before { + content: "\e033"; +} +.glyphicon-flag:before { + content: "\e034"; +} +.glyphicon-headphones:before { + content: "\e035"; +} +.glyphicon-volume-off:before { + content: "\e036"; +} +.glyphicon-volume-down:before { + content: "\e037"; +} +.glyphicon-volume-up:before { + content: "\e038"; +} +.glyphicon-qrcode:before { + content: "\e039"; +} +.glyphicon-barcode:before { + content: "\e040"; +} +.glyphicon-tag:before { + content: "\e041"; +} +.glyphicon-tags:before { + content: "\e042"; +} +.glyphicon-book:before { + content: "\e043"; +} +.glyphicon-bookmark:before { + content: "\e044"; +} +.glyphicon-print:before { + content: "\e045"; +} +.glyphicon-camera:before { + content: "\e046"; +} +.glyphicon-font:before { + content: "\e047"; +} +.glyphicon-bold:before { + content: "\e048"; +} +.glyphicon-italic:before { + content: "\e049"; +} +.glyphicon-text-height:before { + content: "\e050"; +} +.glyphicon-text-width:before { + content: "\e051"; +} +.glyphicon-align-left:before { + content: "\e052"; +} +.glyphicon-align-center:before { + content: "\e053"; +} +.glyphicon-align-right:before { + content: "\e054"; +} +.glyphicon-align-justify:before { + content: "\e055"; +} +.glyphicon-list:before { + content: "\e056"; +} +.glyphicon-indent-left:before { + content: "\e057"; +} +.glyphicon-indent-right:before { + content: "\e058"; +} +.glyphicon-facetime-video:before { + content: "\e059"; +} +.glyphicon-picture:before { + content: "\e060"; +} +.glyphicon-map-marker:before { + content: "\e062"; +} +.glyphicon-adjust:before { + content: "\e063"; +} +.glyphicon-tint:before { + content: "\e064"; +} +.glyphicon-edit:before { + content: "\e065"; +} +.glyphicon-share:before { + content: "\e066"; +} +.glyphicon-check:before { + content: "\e067"; +} +.glyphicon-move:before { + content: "\e068"; +} +.glyphicon-step-backward:before { + content: "\e069"; +} +.glyphicon-fast-backward:before { + content: "\e070"; +} +.glyphicon-backward:before { + content: "\e071"; +} +.glyphicon-play:before { + content: "\e072"; +} +.glyphicon-pause:before { + content: "\e073"; +} +.glyphicon-stop:before { + content: "\e074"; +} +.glyphicon-forward:before { + content: "\e075"; +} +.glyphicon-fast-forward:before { + content: "\e076"; +} +.glyphicon-step-forward:before { + content: "\e077"; +} +.glyphicon-eject:before { + content: "\e078"; +} +.glyphicon-chevron-left:before { + content: "\e079"; +} +.glyphicon-chevron-right:before { + content: "\e080"; +} +.glyphicon-plus-sign:before { + content: "\e081"; +} +.glyphicon-minus-sign:before { + content: "\e082"; +} +.glyphicon-remove-sign:before { + content: "\e083"; +} +.glyphicon-ok-sign:before { + content: "\e084"; +} +.glyphicon-question-sign:before { + content: "\e085"; +} +.glyphicon-info-sign:before { + content: "\e086"; +} +.glyphicon-screenshot:before { + content: "\e087"; +} +.glyphicon-remove-circle:before { + content: "\e088"; +} +.glyphicon-ok-circle:before { + content: "\e089"; +} +.glyphicon-ban-circle:before { + content: "\e090"; +} +.glyphicon-arrow-left:before { + content: "\e091"; +} +.glyphicon-arrow-right:before { + content: "\e092"; +} +.glyphicon-arrow-up:before { + content: "\e093"; +} +.glyphicon-arrow-down:before { + content: "\e094"; +} +.glyphicon-share-alt:before { + content: "\e095"; +} +.glyphicon-resize-full:before { + content: "\e096"; +} +.glyphicon-resize-small:before { + content: "\e097"; +} +.glyphicon-exclamation-sign:before { + content: "\e101"; +} +.glyphicon-gift:before { + content: "\e102"; +} +.glyphicon-leaf:before { + content: "\e103"; +} +.glyphicon-fire:before { + content: "\e104"; +} +.glyphicon-eye-open:before { + content: "\e105"; +} +.glyphicon-eye-close:before { + content: "\e106"; +} +.glyphicon-warning-sign:before { + content: "\e107"; +} +.glyphicon-plane:before { + content: "\e108"; +} +.glyphicon-calendar:before { + content: "\e109"; +} +.glyphicon-random:before { + content: "\e110"; +} +.glyphicon-comment:before { + content: "\e111"; +} +.glyphicon-magnet:before { + content: "\e112"; +} +.glyphicon-chevron-up:before { + content: "\e113"; +} +.glyphicon-chevron-down:before { + content: "\e114"; +} +.glyphicon-retweet:before { + content: "\e115"; +} +.glyphicon-shopping-cart:before { + content: "\e116"; +} +.glyphicon-folder-close:before { + content: "\e117"; +} +.glyphicon-folder-open:before { + content: "\e118"; +} +.glyphicon-resize-vertical:before { + content: "\e119"; +} +.glyphicon-resize-horizontal:before { + content: "\e120"; +} +.glyphicon-hdd:before { + content: "\e121"; +} +.glyphicon-bullhorn:before { + content: "\e122"; +} +.glyphicon-bell:before { + content: "\e123"; +} +.glyphicon-certificate:before { + content: "\e124"; +} +.glyphicon-thumbs-up:before { + content: "\e125"; +} +.glyphicon-thumbs-down:before { + content: "\e126"; +} +.glyphicon-hand-right:before { + content: "\e127"; +} +.glyphicon-hand-left:before { + content: "\e128"; +} +.glyphicon-hand-up:before { + content: "\e129"; +} +.glyphicon-hand-down:before { + content: "\e130"; +} +.glyphicon-circle-arrow-right:before { + content: "\e131"; +} +.glyphicon-circle-arrow-left:before { + content: "\e132"; +} +.glyphicon-circle-arrow-up:before { + content: "\e133"; +} +.glyphicon-circle-arrow-down:before { + content: "\e134"; +} +.glyphicon-globe:before { + content: "\e135"; +} +.glyphicon-wrench:before { + content: "\e136"; +} +.glyphicon-tasks:before { + content: "\e137"; +} +.glyphicon-filter:before { + content: "\e138"; +} +.glyphicon-briefcase:before { + content: "\e139"; +} +.glyphicon-fullscreen:before { + content: "\e140"; +} +.glyphicon-dashboard:before { + content: "\e141"; +} +.glyphicon-paperclip:before { + content: "\e142"; +} +.glyphicon-heart-empty:before { + content: "\e143"; +} +.glyphicon-link:before { + content: "\e144"; +} +.glyphicon-phone:before { + content: "\e145"; +} +.glyphicon-pushpin:before { + content: "\e146"; +} +.glyphicon-usd:before { + content: "\e148"; +} +.glyphicon-gbp:before { + content: "\e149"; +} +.glyphicon-sort:before { + content: "\e150"; +} +.glyphicon-sort-by-alphabet:before { + content: "\e151"; +} +.glyphicon-sort-by-alphabet-alt:before { + content: "\e152"; +} +.glyphicon-sort-by-order:before { + content: "\e153"; +} +.glyphicon-sort-by-order-alt:before { + content: "\e154"; +} +.glyphicon-sort-by-attributes:before { + content: "\e155"; +} +.glyphicon-sort-by-attributes-alt:before { + content: "\e156"; +} +.glyphicon-unchecked:before { + content: "\e157"; +} +.glyphicon-expand:before { + content: "\e158"; +} +.glyphicon-collapse-down:before { + content: "\e159"; +} +.glyphicon-collapse-up:before { + content: "\e160"; +} +.glyphicon-log-in:before { + content: "\e161"; +} +.glyphicon-flash:before { + content: "\e162"; +} +.glyphicon-log-out:before { + content: "\e163"; +} +.glyphicon-new-window:before { + content: "\e164"; +} +.glyphicon-record:before { + content: "\e165"; +} +.glyphicon-save:before { + content: "\e166"; +} +.glyphicon-open:before { + content: "\e167"; +} +.glyphicon-saved:before { + content: "\e168"; +} +.glyphicon-import:before { + content: "\e169"; +} +.glyphicon-export:before { + content: "\e170"; +} +.glyphicon-send:before { + content: "\e171"; +} +.glyphicon-floppy-disk:before { + content: "\e172"; +} +.glyphicon-floppy-saved:before { + content: "\e173"; +} +.glyphicon-floppy-remove:before { + content: "\e174"; +} +.glyphicon-floppy-save:before { + content: "\e175"; +} +.glyphicon-floppy-open:before { + content: "\e176"; +} +.glyphicon-credit-card:before { + content: "\e177"; +} +.glyphicon-transfer:before { + content: "\e178"; +} +.glyphicon-cutlery:before { + content: "\e179"; +} +.glyphicon-header:before { + content: "\e180"; +} +.glyphicon-compressed:before { + content: "\e181"; +} +.glyphicon-earphone:before { + content: "\e182"; +} +.glyphicon-phone-alt:before { + content: "\e183"; +} +.glyphicon-tower:before { + content: "\e184"; +} +.glyphicon-stats:before { + content: "\e185"; +} +.glyphicon-sd-video:before { + content: "\e186"; +} +.glyphicon-hd-video:before { + content: "\e187"; +} +.glyphicon-subtitles:before { + content: "\e188"; +} +.glyphicon-sound-stereo:before { + content: "\e189"; +} +.glyphicon-sound-dolby:before { + content: "\e190"; +} +.glyphicon-sound-5-1:before { + content: "\e191"; +} +.glyphicon-sound-6-1:before { + content: "\e192"; +} +.glyphicon-sound-7-1:before { + content: "\e193"; +} +.glyphicon-copyright-mark:before { + content: "\e194"; +} +.glyphicon-registration-mark:before { + content: "\e195"; +} +.glyphicon-cloud-download:before { + content: "\e197"; +} +.glyphicon-cloud-upload:before { + content: "\e198"; +} +.glyphicon-tree-conifer:before { + content: "\e199"; +} +.glyphicon-tree-deciduous:before { + content: "\e200"; +} +.glyphicon-cd:before { + content: "\e201"; +} +.glyphicon-save-file:before { + content: "\e202"; +} +.glyphicon-open-file:before { + content: "\e203"; +} +.glyphicon-level-up:before { + content: "\e204"; +} +.glyphicon-copy:before { + content: "\e205"; +} +.glyphicon-paste:before { + content: "\e206"; +} +.glyphicon-alert:before { + content: "\e209"; +} +.glyphicon-equalizer:before { + content: "\e210"; +} +.glyphicon-king:before { + content: "\e211"; +} +.glyphicon-queen:before { + content: "\e212"; +} +.glyphicon-pawn:before { + content: "\e213"; +} +.glyphicon-bishop:before { + content: "\e214"; +} +.glyphicon-knight:before { + content: "\e215"; +} +.glyphicon-baby-formula:before { + content: "\e216"; +} +.glyphicon-tent:before { + content: "\26fa"; +} +.glyphicon-blackboard:before { + content: "\e218"; +} +.glyphicon-bed:before { + content: "\e219"; +} +.glyphicon-apple:before { + content: "\f8ff"; +} +.glyphicon-erase:before { + content: "\e221"; +} +.glyphicon-hourglass:before { + content: "\231b"; +} +.glyphicon-lamp:before { + content: "\e223"; +} +.glyphicon-duplicate:before { + content: "\e224"; +} +.glyphicon-piggy-bank:before { + content: "\e225"; +} +.glyphicon-scissors:before { + content: "\e226"; +} +.glyphicon-bitcoin:before { + content: "\e227"; +} +.glyphicon-btc:before { + content: "\e227"; +} +.glyphicon-xbt:before { + content: "\e227"; +} +.glyphicon-yen:before { + content: "\00a5"; +} +.glyphicon-jpy:before { + content: "\00a5"; +} +.glyphicon-ruble:before { + content: "\20bd"; +} +.glyphicon-rub:before { + content: "\20bd"; +} +.glyphicon-scale:before { + content: "\e230"; +} +.glyphicon-ice-lolly:before { + content: "\e231"; +} +.glyphicon-ice-lolly-tasted:before { + content: "\e232"; +} +.glyphicon-education:before { + content: "\e233"; +} +.glyphicon-option-horizontal:before { + content: "\e234"; +} +.glyphicon-option-vertical:before { + content: "\e235"; +} +.glyphicon-menu-hamburger:before { + content: "\e236"; +} +.glyphicon-modal-window:before { + content: "\e237"; +} +.glyphicon-oil:before { + content: "\e238"; +} +.glyphicon-grain:before { + content: "\e239"; +} +.glyphicon-sunglasses:before { + content: "\e240"; +} +.glyphicon-text-size:before { + content: "\e241"; +} +.glyphicon-text-color:before { + content: "\e242"; +} +.glyphicon-text-background:before { + content: "\e243"; +} +.glyphicon-object-align-top:before { + content: "\e244"; +} +.glyphicon-object-align-bottom:before { + content: "\e245"; +} +.glyphicon-object-align-horizontal:before { + content: "\e246"; +} +.glyphicon-object-align-left:before { + content: "\e247"; +} +.glyphicon-object-align-vertical:before { + content: "\e248"; +} +.glyphicon-object-align-right:before { + content: "\e249"; +} +.glyphicon-triangle-right:before { + content: "\e250"; +} +.glyphicon-triangle-left:before { + content: "\e251"; +} +.glyphicon-triangle-bottom:before { + content: "\e252"; +} +.glyphicon-triangle-top:before { + content: "\e253"; +} +.glyphicon-console:before { + content: "\e254"; +} +.glyphicon-superscript:before { + content: "\e255"; +} +.glyphicon-subscript:before { + content: "\e256"; +} +.glyphicon-menu-left:before { + content: "\e257"; +} +.glyphicon-menu-right:before { + content: "\e258"; +} +.glyphicon-menu-down:before { + content: "\e259"; +} +.glyphicon-menu-up:before { + content: "\e260"; +} +* { + -webkit-box-sizing: border-box; + -moz-box-sizing: border-box; + box-sizing: border-box; +} +*:before, +*:after { + -webkit-box-sizing: border-box; + -moz-box-sizing: border-box; + box-sizing: border-box; +} +html { + font-size: 10px; + + -webkit-tap-highlight-color: rgba(0, 0, 0, 0); +} +body { + font-family: "Helvetica Neue", Helvetica, Arial, sans-serif; + font-size: 14px; + line-height: 1.42857143; + color: #333; + background-color: #fff; +} +input, +button, +select, +textarea { + font-family: inherit; + font-size: inherit; + line-height: inherit; +} +a { + color: #337ab7; + text-decoration: none; +} +a:hover, +a:focus { + color: #23527c; + text-decoration: underline; +} +a:focus { + outline: 5px auto -webkit-focus-ring-color; + outline-offset: -2px; +} +figure { + margin: 0; +} +img { + vertical-align: middle; +} +.img-responsive, +.thumbnail > img, +.thumbnail a > img, +.carousel-inner > .item > img, +.carousel-inner > .item > a > img { + display: block; + max-width: 100%; + height: auto; +} +.img-rounded { + border-radius: 6px; +} +.img-thumbnail { + display: inline-block; + max-width: 100%; + height: auto; + padding: 4px; + line-height: 1.42857143; + background-color: #fff; + border: 1px solid #ddd; + border-radius: 4px; + -webkit-transition: all .2s ease-in-out; + -o-transition: all .2s ease-in-out; + transition: all .2s ease-in-out; +} +.img-circle { + border-radius: 50%; +} +hr { + margin-top: 20px; + margin-bottom: 20px; + border: 0; + border-top: 1px solid #eee; +} +.sr-only { + position: absolute; + width: 1px; + height: 1px; + padding: 0; + margin: -1px; + overflow: hidden; + clip: rect(0, 0, 0, 0); + border: 0; +} +.sr-only-focusable:active, +.sr-only-focusable:focus { + position: static; + width: auto; + height: auto; + margin: 0; + overflow: visible; + clip: auto; +} +[role="button"] { + cursor: pointer; +} +h1, +h2, +h3, +h4, +h5, +h6, +.h1, +.h2, +.h3, +.h4, +.h5, +.h6 { + font-family: inherit; + font-weight: 500; + line-height: 1.1; + color: inherit; +} +h1 small, +h2 small, +h3 small, +h4 small, +h5 small, +h6 small, +.h1 small, +.h2 small, +.h3 small, +.h4 small, +.h5 small, +.h6 small, +h1 .small, +h2 .small, +h3 .small, +h4 .small, +h5 .small, +h6 .small, +.h1 .small, +.h2 .small, +.h3 .small, +.h4 .small, +.h5 .small, +.h6 .small { + font-weight: normal; + line-height: 1; + color: #777; +} +h1, +.h1, +h2, +.h2, +h3, +.h3 { + margin-top: 20px; + margin-bottom: 10px; +} +h1 small, +.h1 small, +h2 small, +.h2 small, +h3 small, +.h3 small, +h1 .small, +.h1 .small, +h2 .small, +.h2 .small, +h3 .small, +.h3 .small { + font-size: 65%; +} +h4, +.h4, +h5, +.h5, +h6, +.h6 { + margin-top: 10px; + margin-bottom: 10px; +} +h4 small, +.h4 small, +h5 small, +.h5 small, +h6 small, +.h6 small, +h4 .small, +.h4 .small, +h5 .small, +.h5 .small, +h6 .small, +.h6 .small { + font-size: 75%; +} +h1, +.h1 { + font-size: 36px; +} +h2, +.h2 { + font-size: 30px; +} +h3, +.h3 { + font-size: 24px; +} +h4, +.h4 { + font-size: 18px; +} +h5, +.h5 { + font-size: 14px; +} +h6, +.h6 { + font-size: 12px; +} +p { + margin: 0 0 10px; +} +.lead { + margin-bottom: 20px; + font-size: 16px; + font-weight: 300; + line-height: 1.4; +} +@media (min-width: 768px) { + .lead { + font-size: 21px; + } +} +small, +.small { + font-size: 85%; +} +mark, +.mark { + padding: .2em; + background-color: #fcf8e3; +} +.text-left { + text-align: left; +} +.text-right { + text-align: right; +} +.text-center { + text-align: center; +} +.text-justify { + text-align: justify; +} +.text-nowrap { + white-space: nowrap; +} +.text-lowercase { + text-transform: lowercase; +} +.text-uppercase { + text-transform: uppercase; +} +.text-capitalize { + text-transform: capitalize; +} +.text-muted { + color: #777; +} +.text-primary { + color: #337ab7; +} +a.text-primary:hover, +a.text-primary:focus { + color: #286090; +} +.text-success { + color: #3c763d; +} +a.text-success:hover, +a.text-success:focus { + color: #2b542c; +} +.text-info { + color: #31708f; +} +a.text-info:hover, +a.text-info:focus { + color: #245269; +} +.text-warning { + color: #8a6d3b; +} +a.text-warning:hover, +a.text-warning:focus { + color: #66512c; +} +.text-danger { + color: #a94442; +} +a.text-danger:hover, +a.text-danger:focus { + color: #843534; +} +.bg-primary { + color: #fff; + background-color: #337ab7; +} +a.bg-primary:hover, +a.bg-primary:focus { + background-color: #286090; +} +.bg-success { + background-color: #dff0d8; +} +a.bg-success:hover, +a.bg-success:focus { + background-color: #c1e2b3; +} +.bg-info { + background-color: #d9edf7; +} +a.bg-info:hover, +a.bg-info:focus { + background-color: #afd9ee; +} +.bg-warning { + background-color: #fcf8e3; +} +a.bg-warning:hover, +a.bg-warning:focus { + background-color: #f7ecb5; +} +.bg-danger { + background-color: #f2dede; +} +a.bg-danger:hover, +a.bg-danger:focus { + background-color: #e4b9b9; +} +.page-header { + padding-bottom: 9px; + margin: 40px 0 20px; + border-bottom: 1px solid #eee; +} +ul, +ol { + margin-top: 0; + margin-bottom: 10px; +} +ul ul, +ol ul, +ul ol, +ol ol { + margin-bottom: 0; +} +.list-unstyled { + padding-left: 0; + list-style: none; +} +.list-inline { + padding-left: 0; + margin-left: -5px; + list-style: none; +} +.list-inline > li { + display: inline-block; + padding-right: 5px; + padding-left: 5px; +} +dl { + margin-top: 0; + margin-bottom: 20px; +} +dt, +dd { + line-height: 1.42857143; +} +dt { + font-weight: bold; +} +dd { + margin-left: 0; +} +@media (min-width: 768px) { + .dl-horizontal dt { + float: left; + width: 160px; + overflow: hidden; + clear: left; + text-align: right; + text-overflow: ellipsis; + white-space: nowrap; + } + .dl-horizontal dd { + margin-left: 180px; + } +} +abbr[title], +abbr[data-original-title] { + cursor: help; + border-bottom: 1px dotted #777; +} +.initialism { + font-size: 90%; + text-transform: uppercase; +} +blockquote { + padding: 10px 20px; + margin: 0 0 20px; + font-size: 17.5px; + border-left: 5px solid #eee; +} +blockquote p:last-child, +blockquote ul:last-child, +blockquote ol:last-child { + margin-bottom: 0; +} +blockquote footer, +blockquote small, +blockquote .small { + display: block; + font-size: 80%; + line-height: 1.42857143; + color: #777; +} +blockquote footer:before, +blockquote small:before, +blockquote .small:before { + content: '\2014 \00A0'; +} +.blockquote-reverse, +blockquote.pull-right { + padding-right: 15px; + padding-left: 0; + text-align: right; + border-right: 5px solid #eee; + border-left: 0; +} +.blockquote-reverse footer:before, +blockquote.pull-right footer:before, +.blockquote-reverse small:before, +blockquote.pull-right small:before, +.blockquote-reverse .small:before, +blockquote.pull-right .small:before { + content: ''; +} +.blockquote-reverse footer:after, +blockquote.pull-right footer:after, +.blockquote-reverse small:after, +blockquote.pull-right small:after, +.blockquote-reverse .small:after, +blockquote.pull-right .small:after { + content: '\00A0 \2014'; +} +address { + margin-bottom: 20px; + font-style: normal; + line-height: 1.42857143; +} +code, +kbd, +pre, +samp { + font-family: Menlo, Monaco, Consolas, "Courier New", monospace; +} +code { + padding: 2px 4px; + font-size: 90%; + color: #c7254e; + background-color: #f9f2f4; + border-radius: 4px; +} +kbd { + padding: 2px 4px; + font-size: 90%; + color: #fff; + background-color: #333; + border-radius: 3px; + -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .25); + box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .25); +} +kbd kbd { + padding: 0; + font-size: 100%; + font-weight: bold; + -webkit-box-shadow: none; + box-shadow: none; +} +pre { + display: block; + padding: 9.5px; + margin: 0 0 10px; + font-size: 13px; + line-height: 1.42857143; + color: #333; + word-break: break-all; + word-wrap: break-word; + background-color: #f5f5f5; + border: 1px solid #ccc; + border-radius: 4px; +} +pre code { + padding: 0; + font-size: inherit; + color: inherit; + white-space: pre-wrap; + background-color: transparent; + border-radius: 0; +} +.pre-scrollable { + max-height: 340px; + overflow-y: scroll; +} +.container { + padding-right: 15px; + padding-left: 15px; + margin-right: auto; + margin-left: auto; +} +@media (min-width: 768px) { + .container { + width: 750px; + } +} +@media (min-width: 992px) { + .container { + width: 970px; + } +} +@media (min-width: 1200px) { + .container { + width: 1170px; + } +} +.container-fluid { + padding-right: 15px; + padding-left: 15px; + margin-right: auto; + margin-left: auto; +} +.row { + margin-right: -15px; + margin-left: -15px; +} +.col-xs-1, .col-sm-1, .col-md-1, .col-lg-1, .col-xs-2, .col-sm-2, .col-md-2, .col-lg-2, .col-xs-3, .col-sm-3, .col-md-3, .col-lg-3, .col-xs-4, .col-sm-4, .col-md-4, .col-lg-4, .col-xs-5, .col-sm-5, .col-md-5, .col-lg-5, .col-xs-6, .col-sm-6, .col-md-6, .col-lg-6, .col-xs-7, .col-sm-7, .col-md-7, .col-lg-7, .col-xs-8, .col-sm-8, .col-md-8, .col-lg-8, .col-xs-9, .col-sm-9, .col-md-9, .col-lg-9, .col-xs-10, .col-sm-10, .col-md-10, .col-lg-10, .col-xs-11, .col-sm-11, .col-md-11, .col-lg-11, .col-xs-12, .col-sm-12, .col-md-12, .col-lg-12 { + position: relative; + min-height: 1px; + padding-right: 15px; + padding-left: 15px; +} +.col-xs-1, .col-xs-2, .col-xs-3, .col-xs-4, .col-xs-5, .col-xs-6, .col-xs-7, .col-xs-8, .col-xs-9, .col-xs-10, .col-xs-11, .col-xs-12 { + float: left; +} +.col-xs-12 { + width: 100%; +} +.col-xs-11 { + width: 91.66666667%; +} +.col-xs-10 { + width: 83.33333333%; +} +.col-xs-9 { + width: 75%; +} +.col-xs-8 { + width: 66.66666667%; +} +.col-xs-7 { + width: 58.33333333%; +} +.col-xs-6 { + width: 50%; +} +.col-xs-5 { + width: 41.66666667%; +} +.col-xs-4 { + width: 33.33333333%; +} +.col-xs-3 { + width: 25%; +} +.col-xs-2 { + width: 16.66666667%; +} +.col-xs-1 { + width: 8.33333333%; +} +.col-xs-pull-12 { + right: 100%; +} +.col-xs-pull-11 { + right: 91.66666667%; +} +.col-xs-pull-10 { + right: 83.33333333%; +} +.col-xs-pull-9 { + right: 75%; +} +.col-xs-pull-8 { + right: 66.66666667%; +} +.col-xs-pull-7 { + right: 58.33333333%; +} +.col-xs-pull-6 { + right: 50%; +} +.col-xs-pull-5 { + right: 41.66666667%; +} +.col-xs-pull-4 { + right: 33.33333333%; +} +.col-xs-pull-3 { + right: 25%; +} +.col-xs-pull-2 { + right: 16.66666667%; +} +.col-xs-pull-1 { + right: 8.33333333%; +} +.col-xs-pull-0 { + right: auto; +} +.col-xs-push-12 { + left: 100%; +} +.col-xs-push-11 { + left: 91.66666667%; +} +.col-xs-push-10 { + left: 83.33333333%; +} +.col-xs-push-9 { + left: 75%; +} +.col-xs-push-8 { + left: 66.66666667%; +} +.col-xs-push-7 { + left: 58.33333333%; +} +.col-xs-push-6 { + left: 50%; +} +.col-xs-push-5 { + left: 41.66666667%; +} +.col-xs-push-4 { + left: 33.33333333%; +} +.col-xs-push-3 { + left: 25%; +} +.col-xs-push-2 { + left: 16.66666667%; +} +.col-xs-push-1 { + left: 8.33333333%; +} +.col-xs-push-0 { + left: auto; +} +.col-xs-offset-12 { + margin-left: 100%; +} +.col-xs-offset-11 { + margin-left: 91.66666667%; +} +.col-xs-offset-10 { + margin-left: 83.33333333%; +} +.col-xs-offset-9 { + margin-left: 75%; +} +.col-xs-offset-8 { + margin-left: 66.66666667%; +} +.col-xs-offset-7 { + margin-left: 58.33333333%; +} +.col-xs-offset-6 { + margin-left: 50%; +} +.col-xs-offset-5 { + margin-left: 41.66666667%; +} +.col-xs-offset-4 { + margin-left: 33.33333333%; +} +.col-xs-offset-3 { + margin-left: 25%; +} +.col-xs-offset-2 { + margin-left: 16.66666667%; +} +.col-xs-offset-1 { + margin-left: 8.33333333%; +} +.col-xs-offset-0 { + margin-left: 0; +} +@media (min-width: 768px) { + .col-sm-1, .col-sm-2, .col-sm-3, .col-sm-4, .col-sm-5, .col-sm-6, .col-sm-7, .col-sm-8, .col-sm-9, .col-sm-10, .col-sm-11, .col-sm-12 { + float: left; + } + .col-sm-12 { + width: 100%; + } + .col-sm-11 { + width: 91.66666667%; + } + .col-sm-10 { + width: 83.33333333%; + } + .col-sm-9 { + width: 75%; + } + .col-sm-8 { + width: 66.66666667%; + } + .col-sm-7 { + width: 58.33333333%; + } + .col-sm-6 { + width: 50%; + } + .col-sm-5 { + width: 41.66666667%; + } + .col-sm-4 { + width: 33.33333333%; + } + .col-sm-3 { + width: 25%; + } + .col-sm-2 { + width: 16.66666667%; + } + .col-sm-1 { + width: 8.33333333%; + } + .col-sm-pull-12 { + right: 100%; + } + .col-sm-pull-11 { + right: 91.66666667%; + } + .col-sm-pull-10 { + right: 83.33333333%; + } + .col-sm-pull-9 { + right: 75%; + } + .col-sm-pull-8 { + right: 66.66666667%; + } + .col-sm-pull-7 { + right: 58.33333333%; + } + .col-sm-pull-6 { + right: 50%; + } + .col-sm-pull-5 { + right: 41.66666667%; + } + .col-sm-pull-4 { + right: 33.33333333%; + } + .col-sm-pull-3 { + right: 25%; + } + .col-sm-pull-2 { + right: 16.66666667%; + } + .col-sm-pull-1 { + right: 8.33333333%; + } + .col-sm-pull-0 { + right: auto; + } + .col-sm-push-12 { + left: 100%; + } + .col-sm-push-11 { + left: 91.66666667%; + } + .col-sm-push-10 { + left: 83.33333333%; + } + .col-sm-push-9 { + left: 75%; + } + .col-sm-push-8 { + left: 66.66666667%; + } + .col-sm-push-7 { + left: 58.33333333%; + } + .col-sm-push-6 { + left: 50%; + } + .col-sm-push-5 { + left: 41.66666667%; + } + .col-sm-push-4 { + left: 33.33333333%; + } + .col-sm-push-3 { + left: 25%; + } + .col-sm-push-2 { + left: 16.66666667%; + } + .col-sm-push-1 { + left: 8.33333333%; + } + .col-sm-push-0 { + left: auto; + } + .col-sm-offset-12 { + margin-left: 100%; + } + .col-sm-offset-11 { + margin-left: 91.66666667%; + } + .col-sm-offset-10 { + margin-left: 83.33333333%; + } + .col-sm-offset-9 { + margin-left: 75%; + } + .col-sm-offset-8 { + margin-left: 66.66666667%; + } + .col-sm-offset-7 { + margin-left: 58.33333333%; + } + .col-sm-offset-6 { + margin-left: 50%; + } + .col-sm-offset-5 { + margin-left: 41.66666667%; + } + .col-sm-offset-4 { + margin-left: 33.33333333%; + } + .col-sm-offset-3 { + margin-left: 25%; + } + .col-sm-offset-2 { + margin-left: 16.66666667%; + } + .col-sm-offset-1 { + margin-left: 8.33333333%; + } + .col-sm-offset-0 { + margin-left: 0; + } +} +@media (min-width: 992px) { + .col-md-1, .col-md-2, .col-md-3, .col-md-4, .col-md-5, .col-md-6, .col-md-7, .col-md-8, .col-md-9, .col-md-10, .col-md-11, .col-md-12 { + float: left; + } + .col-md-12 { + width: 100%; + } + .col-md-11 { + width: 91.66666667%; + } + .col-md-10 { + width: 83.33333333%; + } + .col-md-9 { + width: 75%; + } + .col-md-8 { + width: 66.66666667%; + } + .col-md-7 { + width: 58.33333333%; + } + .col-md-6 { + width: 50%; + } + .col-md-5 { + width: 41.66666667%; + } + .col-md-4 { + width: 33.33333333%; + } + .col-md-3 { + width: 25%; + } + .col-md-2 { + width: 16.66666667%; + } + .col-md-1 { + width: 8.33333333%; + } + .col-md-pull-12 { + right: 100%; + } + .col-md-pull-11 { + right: 91.66666667%; + } + .col-md-pull-10 { + right: 83.33333333%; + } + .col-md-pull-9 { + right: 75%; + } + .col-md-pull-8 { + right: 66.66666667%; + } + .col-md-pull-7 { + right: 58.33333333%; + } + .col-md-pull-6 { + right: 50%; + } + .col-md-pull-5 { + right: 41.66666667%; + } + .col-md-pull-4 { + right: 33.33333333%; + } + .col-md-pull-3 { + right: 25%; + } + .col-md-pull-2 { + right: 16.66666667%; + } + .col-md-pull-1 { + right: 8.33333333%; + } + .col-md-pull-0 { + right: auto; + } + .col-md-push-12 { + left: 100%; + } + .col-md-push-11 { + left: 91.66666667%; + } + .col-md-push-10 { + left: 83.33333333%; + } + .col-md-push-9 { + left: 75%; + } + .col-md-push-8 { + left: 66.66666667%; + } + .col-md-push-7 { + left: 58.33333333%; + } + .col-md-push-6 { + left: 50%; + } + .col-md-push-5 { + left: 41.66666667%; + } + .col-md-push-4 { + left: 33.33333333%; + } + .col-md-push-3 { + left: 25%; + } + .col-md-push-2 { + left: 16.66666667%; + } + .col-md-push-1 { + left: 8.33333333%; + } + .col-md-push-0 { + left: auto; + } + .col-md-offset-12 { + margin-left: 100%; + } + .col-md-offset-11 { + margin-left: 91.66666667%; + } + .col-md-offset-10 { + margin-left: 83.33333333%; + } + .col-md-offset-9 { + margin-left: 75%; + } + .col-md-offset-8 { + margin-left: 66.66666667%; + } + .col-md-offset-7 { + margin-left: 58.33333333%; + } + .col-md-offset-6 { + margin-left: 50%; + } + .col-md-offset-5 { + margin-left: 41.66666667%; + } + .col-md-offset-4 { + margin-left: 33.33333333%; + } + .col-md-offset-3 { + margin-left: 25%; + } + .col-md-offset-2 { + margin-left: 16.66666667%; + } + .col-md-offset-1 { + margin-left: 8.33333333%; + } + .col-md-offset-0 { + margin-left: 0; + } +} +@media (min-width: 1200px) { + .col-lg-1, .col-lg-2, .col-lg-3, .col-lg-4, .col-lg-5, .col-lg-6, .col-lg-7, .col-lg-8, .col-lg-9, .col-lg-10, .col-lg-11, .col-lg-12 { + float: left; + } + .col-lg-12 { + width: 100%; + } + .col-lg-11 { + width: 91.66666667%; + } + .col-lg-10 { + width: 83.33333333%; + } + .col-lg-9 { + width: 75%; + } + .col-lg-8 { + width: 66.66666667%; + } + .col-lg-7 { + width: 58.33333333%; + } + .col-lg-6 { + width: 50%; + } + .col-lg-5 { + width: 41.66666667%; + } + .col-lg-4 { + width: 33.33333333%; + } + .col-lg-3 { + width: 25%; + } + .col-lg-2 { + width: 16.66666667%; + } + .col-lg-1 { + width: 8.33333333%; + } + .col-lg-pull-12 { + right: 100%; + } + .col-lg-pull-11 { + right: 91.66666667%; + } + .col-lg-pull-10 { + right: 83.33333333%; + } + .col-lg-pull-9 { + right: 75%; + } + .col-lg-pull-8 { + right: 66.66666667%; + } + .col-lg-pull-7 { + right: 58.33333333%; + } + .col-lg-pull-6 { + right: 50%; + } + .col-lg-pull-5 { + right: 41.66666667%; + } + .col-lg-pull-4 { + right: 33.33333333%; + } + .col-lg-pull-3 { + right: 25%; + } + .col-lg-pull-2 { + right: 16.66666667%; + } + .col-lg-pull-1 { + right: 8.33333333%; + } + .col-lg-pull-0 { + right: auto; + } + .col-lg-push-12 { + left: 100%; + } + .col-lg-push-11 { + left: 91.66666667%; + } + .col-lg-push-10 { + left: 83.33333333%; + } + .col-lg-push-9 { + left: 75%; + } + .col-lg-push-8 { + left: 66.66666667%; + } + .col-lg-push-7 { + left: 58.33333333%; + } + .col-lg-push-6 { + left: 50%; + } + .col-lg-push-5 { + left: 41.66666667%; + } + .col-lg-push-4 { + left: 33.33333333%; + } + .col-lg-push-3 { + left: 25%; + } + .col-lg-push-2 { + left: 16.66666667%; + } + .col-lg-push-1 { + left: 8.33333333%; + } + .col-lg-push-0 { + left: auto; + } + .col-lg-offset-12 { + margin-left: 100%; + } + .col-lg-offset-11 { + margin-left: 91.66666667%; + } + .col-lg-offset-10 { + margin-left: 83.33333333%; + } + .col-lg-offset-9 { + margin-left: 75%; + } + .col-lg-offset-8 { + margin-left: 66.66666667%; + } + .col-lg-offset-7 { + margin-left: 58.33333333%; + } + .col-lg-offset-6 { + margin-left: 50%; + } + .col-lg-offset-5 { + margin-left: 41.66666667%; + } + .col-lg-offset-4 { + margin-left: 33.33333333%; + } + .col-lg-offset-3 { + margin-left: 25%; + } + .col-lg-offset-2 { + margin-left: 16.66666667%; + } + .col-lg-offset-1 { + margin-left: 8.33333333%; + } + .col-lg-offset-0 { + margin-left: 0; + } +} +table { + background-color: transparent; +} +caption { + padding-top: 8px; + padding-bottom: 8px; + color: #777; + text-align: left; +} +th { + text-align: left; +} +.table { + width: 100%; + max-width: 100%; + margin-bottom: 20px; +} +.table > thead > tr > th, +.table > tbody > tr > th, +.table > tfoot > tr > th, +.table > thead > tr > td, +.table > tbody > tr > td, +.table > tfoot > tr > td { + padding: 8px; + line-height: 1.42857143; + vertical-align: top; + border-top: 1px solid #ddd; +} +.table > thead > tr > th { + vertical-align: bottom; + border-bottom: 2px solid #ddd; +} +.table > caption + thead > tr:first-child > th, +.table > colgroup + thead > tr:first-child > th, +.table > thead:first-child > tr:first-child > th, +.table > caption + thead > tr:first-child > td, +.table > colgroup + thead > tr:first-child > td, +.table > thead:first-child > tr:first-child > td { + border-top: 0; +} +.table > tbody + tbody { + border-top: 2px solid #ddd; +} +.table .table { + background-color: #fff; +} +.table-condensed > thead > tr > th, +.table-condensed > tbody > tr > th, +.table-condensed > tfoot > tr > th, +.table-condensed > thead > tr > td, +.table-condensed > tbody > tr > td, +.table-condensed > tfoot > tr > td { + padding: 5px; +} +.table-bordered { + border: 1px solid #ddd; +} +.table-bordered > thead > tr > th, +.table-bordered > tbody > tr > th, +.table-bordered > tfoot > tr > th, +.table-bordered > thead > tr > td, +.table-bordered > tbody > tr > td, +.table-bordered > tfoot > tr > td { + border: 1px solid #ddd; +} +.table-bordered > thead > tr > th, +.table-bordered > thead > tr > td { + border-bottom-width: 2px; +} +.table-striped > tbody > tr:nth-of-type(odd) { + background-color: #f9f9f9; +} +.table-hover > tbody > tr:hover { + background-color: #f5f5f5; +} +table col[class*="col-"] { + position: static; + display: table-column; + float: none; +} +table td[class*="col-"], +table th[class*="col-"] { + position: static; + display: table-cell; + float: none; +} +.table > thead > tr > td.active, +.table > tbody > tr > td.active, +.table > tfoot > tr > td.active, +.table > thead > tr > th.active, +.table > tbody > tr > th.active, +.table > tfoot > tr > th.active, +.table > thead > tr.active > td, +.table > tbody > tr.active > td, +.table > tfoot > tr.active > td, +.table > thead > tr.active > th, +.table > tbody > tr.active > th, +.table > tfoot > tr.active > th { + background-color: #f5f5f5; +} +.table-hover > tbody > tr > td.active:hover, +.table-hover > tbody > tr > th.active:hover, +.table-hover > tbody > tr.active:hover > td, +.table-hover > tbody > tr:hover > .active, +.table-hover > tbody > tr.active:hover > th { + background-color: #e8e8e8; +} +.table > thead > tr > td.success, +.table > tbody > tr > td.success, +.table > tfoot > tr > td.success, +.table > thead > tr > th.success, +.table > tbody > tr > th.success, +.table > tfoot > tr > th.success, +.table > thead > tr.success > td, +.table > tbody > tr.success > td, +.table > tfoot > tr.success > td, +.table > thead > tr.success > th, +.table > tbody > tr.success > th, +.table > tfoot > tr.success > th { + background-color: #dff0d8; +} +.table-hover > tbody > tr > td.success:hover, +.table-hover > tbody > tr > th.success:hover, +.table-hover > tbody > tr.success:hover > td, +.table-hover > tbody > tr:hover > .success, +.table-hover > tbody > tr.success:hover > th { + background-color: #d0e9c6; +} +.table > thead > tr > td.info, +.table > tbody > tr > td.info, +.table > tfoot > tr > td.info, +.table > thead > tr > th.info, +.table > tbody > tr > th.info, +.table > tfoot > tr > th.info, +.table > thead > tr.info > td, +.table > tbody > tr.info > td, +.table > tfoot > tr.info > td, +.table > thead > tr.info > th, +.table > tbody > tr.info > th, +.table > tfoot > tr.info > th { + background-color: #d9edf7; +} +.table-hover > tbody > tr > td.info:hover, +.table-hover > tbody > tr > th.info:hover, +.table-hover > tbody > tr.info:hover > td, +.table-hover > tbody > tr:hover > .info, +.table-hover > tbody > tr.info:hover > th { + background-color: #c4e3f3; +} +.table > thead > tr > td.warning, +.table > tbody > tr > td.warning, +.table > tfoot > tr > td.warning, +.table > thead > tr > th.warning, +.table > tbody > tr > th.warning, +.table > tfoot > tr > th.warning, +.table > thead > tr.warning > td, +.table > tbody > tr.warning > td, +.table > tfoot > tr.warning > td, +.table > thead > tr.warning > th, +.table > tbody > tr.warning > th, +.table > tfoot > tr.warning > th { + background-color: #fcf8e3; +} +.table-hover > tbody > tr > td.warning:hover, +.table-hover > tbody > tr > th.warning:hover, +.table-hover > tbody > tr.warning:hover > td, +.table-hover > tbody > tr:hover > .warning, +.table-hover > tbody > tr.warning:hover > th { + background-color: #faf2cc; +} +.table > thead > tr > td.danger, +.table > tbody > tr > td.danger, +.table > tfoot > tr > td.danger, +.table > thead > tr > th.danger, +.table > tbody > tr > th.danger, +.table > tfoot > tr > th.danger, +.table > thead > tr.danger > td, +.table > tbody > tr.danger > td, +.table > tfoot > tr.danger > td, +.table > thead > tr.danger > th, +.table > tbody > tr.danger > th, +.table > tfoot > tr.danger > th { + background-color: #f2dede; +} +.table-hover > tbody > tr > td.danger:hover, +.table-hover > tbody > tr > th.danger:hover, +.table-hover > tbody > tr.danger:hover > td, +.table-hover > tbody > tr:hover > .danger, +.table-hover > tbody > tr.danger:hover > th { + background-color: #ebcccc; +} +.table-responsive { + min-height: .01%; + overflow-x: auto; +} +@media screen and (max-width: 767px) { + .table-responsive { + width: 100%; + margin-bottom: 15px; + overflow-y: hidden; + -ms-overflow-style: -ms-autohiding-scrollbar; + border: 1px solid #ddd; + } + .table-responsive > .table { + margin-bottom: 0; + } + .table-responsive > .table > thead > tr > th, + .table-responsive > .table > tbody > tr > th, + .table-responsive > .table > tfoot > tr > th, + .table-responsive > .table > thead > tr > td, + .table-responsive > .table > tbody > tr > td, + .table-responsive > .table > tfoot > tr > td { + white-space: nowrap; + } + .table-responsive > .table-bordered { + border: 0; + } + .table-responsive > .table-bordered > thead > tr > th:first-child, + .table-responsive > .table-bordered > tbody > tr > th:first-child, + .table-responsive > .table-bordered > tfoot > tr > th:first-child, + .table-responsive > .table-bordered > thead > tr > td:first-child, + .table-responsive > .table-bordered > tbody > tr > td:first-child, + .table-responsive > .table-bordered > tfoot > tr > td:first-child { + border-left: 0; + } + .table-responsive > .table-bordered > thead > tr > th:last-child, + .table-responsive > .table-bordered > tbody > tr > th:last-child, + .table-responsive > .table-bordered > tfoot > tr > th:last-child, + .table-responsive > .table-bordered > thead > tr > td:last-child, + .table-responsive > .table-bordered > tbody > tr > td:last-child, + .table-responsive > .table-bordered > tfoot > tr > td:last-child { + border-right: 0; + } + .table-responsive > .table-bordered > tbody > tr:last-child > th, + .table-responsive > .table-bordered > tfoot > tr:last-child > th, + .table-responsive > .table-bordered > tbody > tr:last-child > td, + .table-responsive > .table-bordered > tfoot > tr:last-child > td { + border-bottom: 0; + } +} +fieldset { + min-width: 0; + padding: 0; + margin: 0; + border: 0; +} +legend { + display: block; + width: 100%; + padding: 0; + margin-bottom: 20px; + font-size: 21px; + line-height: inherit; + color: #333; + border: 0; + border-bottom: 1px solid #e5e5e5; +} +label { + display: inline-block; + max-width: 100%; + margin-bottom: 5px; + font-weight: bold; +} +input[type="search"] { + -webkit-box-sizing: border-box; + -moz-box-sizing: border-box; + box-sizing: border-box; +} +input[type="radio"], +input[type="checkbox"] { + margin: 4px 0 0; + margin-top: 1px \9; + line-height: normal; +} +input[type="file"] { + display: block; +} +input[type="range"] { + display: block; + width: 100%; +} +select[multiple], +select[size] { + height: auto; +} +input[type="file"]:focus, +input[type="radio"]:focus, +input[type="checkbox"]:focus { + outline: 5px auto -webkit-focus-ring-color; + outline-offset: -2px; +} +output { + display: block; + padding-top: 7px; + font-size: 14px; + line-height: 1.42857143; + color: #555; +} +.form-control { + display: block; + width: 100%; + height: 34px; + padding: 6px 12px; + font-size: 14px; + line-height: 1.42857143; + color: #555; + background-color: #fff; + background-image: none; + border: 1px solid #ccc; + border-radius: 4px; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); + -webkit-transition: border-color ease-in-out .15s, -webkit-box-shadow ease-in-out .15s; + -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s; + transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s; +} +.form-control:focus { + border-color: #66afe9; + outline: 0; + -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, .6); + box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, .6); +} +.form-control::-moz-placeholder { + color: #999; + opacity: 1; +} +.form-control:-ms-input-placeholder { + color: #999; +} +.form-control::-webkit-input-placeholder { + color: #999; +} +.form-control::-ms-expand { + background-color: transparent; + border: 0; +} +.form-control[disabled], +.form-control[readonly], +fieldset[disabled] .form-control { + background-color: #eee; + opacity: 1; +} +.form-control[disabled], +fieldset[disabled] .form-control { + cursor: not-allowed; +} +textarea.form-control { + height: auto; +} +input[type="search"] { + -webkit-appearance: none; +} +@media screen and (-webkit-min-device-pixel-ratio: 0) { + input[type="date"].form-control, + input[type="time"].form-control, + input[type="datetime-local"].form-control, + input[type="month"].form-control { + line-height: 34px; + } + input[type="date"].input-sm, + input[type="time"].input-sm, + input[type="datetime-local"].input-sm, + input[type="month"].input-sm, + .input-group-sm input[type="date"], + .input-group-sm input[type="time"], + .input-group-sm input[type="datetime-local"], + .input-group-sm input[type="month"] { + line-height: 30px; + } + input[type="date"].input-lg, + input[type="time"].input-lg, + input[type="datetime-local"].input-lg, + input[type="month"].input-lg, + .input-group-lg input[type="date"], + .input-group-lg input[type="time"], + .input-group-lg input[type="datetime-local"], + .input-group-lg input[type="month"] { + line-height: 46px; + } +} +.form-group { + margin-bottom: 15px; +} +.radio, +.checkbox { + position: relative; + display: block; + margin-top: 10px; + margin-bottom: 10px; +} +.radio label, +.checkbox label { + min-height: 20px; + padding-left: 20px; + margin-bottom: 0; + font-weight: normal; + cursor: pointer; +} +.radio input[type="radio"], +.radio-inline input[type="radio"], +.checkbox input[type="checkbox"], +.checkbox-inline input[type="checkbox"] { + position: absolute; + margin-top: 4px \9; + margin-left: -20px; +} +.radio + .radio, +.checkbox + .checkbox { + margin-top: -5px; +} +.radio-inline, +.checkbox-inline { + position: relative; + display: inline-block; + padding-left: 20px; + margin-bottom: 0; + font-weight: normal; + vertical-align: middle; + cursor: pointer; +} +.radio-inline + .radio-inline, +.checkbox-inline + .checkbox-inline { + margin-top: 0; + margin-left: 10px; +} +input[type="radio"][disabled], +input[type="checkbox"][disabled], +input[type="radio"].disabled, +input[type="checkbox"].disabled, +fieldset[disabled] input[type="radio"], +fieldset[disabled] input[type="checkbox"] { + cursor: not-allowed; +} +.radio-inline.disabled, +.checkbox-inline.disabled, +fieldset[disabled] .radio-inline, +fieldset[disabled] .checkbox-inline { + cursor: not-allowed; +} +.radio.disabled label, +.checkbox.disabled label, +fieldset[disabled] .radio label, +fieldset[disabled] .checkbox label { + cursor: not-allowed; +} +.form-control-static { + min-height: 34px; + padding-top: 7px; + padding-bottom: 7px; + margin-bottom: 0; +} +.form-control-static.input-lg, +.form-control-static.input-sm { + padding-right: 0; + padding-left: 0; +} +.input-sm { + height: 30px; + padding: 5px 10px; + font-size: 12px; + line-height: 1.5; + border-radius: 3px; +} +select.input-sm { + height: 30px; + line-height: 30px; +} +textarea.input-sm, +select[multiple].input-sm { + height: auto; +} +.form-group-sm .form-control { + height: 30px; + padding: 5px 10px; + font-size: 12px; + line-height: 1.5; + border-radius: 3px; +} +.form-group-sm select.form-control { + height: 30px; + line-height: 30px; +} +.form-group-sm textarea.form-control, +.form-group-sm select[multiple].form-control { + height: auto; +} +.form-group-sm .form-control-static { + height: 30px; + min-height: 32px; + padding: 6px 10px; + font-size: 12px; + line-height: 1.5; +} +.input-lg { + height: 46px; + padding: 10px 16px; + font-size: 18px; + line-height: 1.3333333; + border-radius: 6px; +} +select.input-lg { + height: 46px; + line-height: 46px; +} +textarea.input-lg, +select[multiple].input-lg { + height: auto; +} +.form-group-lg .form-control { + height: 46px; + padding: 10px 16px; + font-size: 18px; + line-height: 1.3333333; + border-radius: 6px; +} +.form-group-lg select.form-control { + height: 46px; + line-height: 46px; +} +.form-group-lg textarea.form-control, +.form-group-lg select[multiple].form-control { + height: auto; +} +.form-group-lg .form-control-static { + height: 46px; + min-height: 38px; + padding: 11px 16px; + font-size: 18px; + line-height: 1.3333333; +} +.has-feedback { + position: relative; +} +.has-feedback .form-control { + padding-right: 42.5px; +} +.form-control-feedback { + position: absolute; + top: 0; + right: 0; + z-index: 2; + display: block; + width: 34px; + height: 34px; + line-height: 34px; + text-align: center; + pointer-events: none; +} +.input-lg + .form-control-feedback, +.input-group-lg + .form-control-feedback, +.form-group-lg .form-control + .form-control-feedback { + width: 46px; + height: 46px; + line-height: 46px; +} +.input-sm + .form-control-feedback, +.input-group-sm + .form-control-feedback, +.form-group-sm .form-control + .form-control-feedback { + width: 30px; + height: 30px; + line-height: 30px; +} +.has-success .help-block, +.has-success .control-label, +.has-success .radio, +.has-success .checkbox, +.has-success .radio-inline, +.has-success .checkbox-inline, +.has-success.radio label, +.has-success.checkbox label, +.has-success.radio-inline label, +.has-success.checkbox-inline label { + color: #3c763d; +} +.has-success .form-control { + border-color: #3c763d; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); +} +.has-success .form-control:focus { + border-color: #2b542c; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #67b168; + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #67b168; +} +.has-success .input-group-addon { + color: #3c763d; + background-color: #dff0d8; + border-color: #3c763d; +} +.has-success .form-control-feedback { + color: #3c763d; +} +.has-warning .help-block, +.has-warning .control-label, +.has-warning .radio, +.has-warning .checkbox, +.has-warning .radio-inline, +.has-warning .checkbox-inline, +.has-warning.radio label, +.has-warning.checkbox label, +.has-warning.radio-inline label, +.has-warning.checkbox-inline label { + color: #8a6d3b; +} +.has-warning .form-control { + border-color: #8a6d3b; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); +} +.has-warning .form-control:focus { + border-color: #66512c; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #c0a16b; + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #c0a16b; +} +.has-warning .input-group-addon { + color: #8a6d3b; + background-color: #fcf8e3; + border-color: #8a6d3b; +} +.has-warning .form-control-feedback { + color: #8a6d3b; +} +.has-error .help-block, +.has-error .control-label, +.has-error .radio, +.has-error .checkbox, +.has-error .radio-inline, +.has-error .checkbox-inline, +.has-error.radio label, +.has-error.checkbox label, +.has-error.radio-inline label, +.has-error.checkbox-inline label { + color: #a94442; +} +.has-error .form-control { + border-color: #a94442; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075); +} +.has-error .form-control:focus { + border-color: #843534; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #ce8483; + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .075), 0 0 6px #ce8483; +} +.has-error .input-group-addon { + color: #a94442; + background-color: #f2dede; + border-color: #a94442; +} +.has-error .form-control-feedback { + color: #a94442; +} +.has-feedback label ~ .form-control-feedback { + top: 25px; +} +.has-feedback label.sr-only ~ .form-control-feedback { + top: 0; +} +.help-block { + display: block; + margin-top: 5px; + margin-bottom: 10px; + color: #737373; +} +@media (min-width: 768px) { + .form-inline .form-group { + display: inline-block; + margin-bottom: 0; + vertical-align: middle; + } + .form-inline .form-control { + display: inline-block; + width: auto; + vertical-align: middle; + } + .form-inline .form-control-static { + display: inline-block; + } + .form-inline .input-group { + display: inline-table; + vertical-align: middle; + } + .form-inline .input-group .input-group-addon, + .form-inline .input-group .input-group-btn, + .form-inline .input-group .form-control { + width: auto; + } + .form-inline .input-group > .form-control { + width: 100%; + } + .form-inline .control-label { + margin-bottom: 0; + vertical-align: middle; + } + .form-inline .radio, + .form-inline .checkbox { + display: inline-block; + margin-top: 0; + margin-bottom: 0; + vertical-align: middle; + } + .form-inline .radio label, + .form-inline .checkbox label { + padding-left: 0; + } + .form-inline .radio input[type="radio"], + .form-inline .checkbox input[type="checkbox"] { + position: relative; + margin-left: 0; + } + .form-inline .has-feedback .form-control-feedback { + top: 0; + } +} +.form-horizontal .radio, +.form-horizontal .checkbox, +.form-horizontal .radio-inline, +.form-horizontal .checkbox-inline { + padding-top: 7px; + margin-top: 0; + margin-bottom: 0; +} +.form-horizontal .radio, +.form-horizontal .checkbox { + min-height: 27px; +} +.form-horizontal .form-group { + margin-right: -15px; + margin-left: -15px; +} +@media (min-width: 768px) { + .form-horizontal .control-label { + padding-top: 7px; + margin-bottom: 0; + text-align: right; + } +} +.form-horizontal .has-feedback .form-control-feedback { + right: 15px; +} +@media (min-width: 768px) { + .form-horizontal .form-group-lg .control-label { + padding-top: 11px; + font-size: 18px; + } +} +@media (min-width: 768px) { + .form-horizontal .form-group-sm .control-label { + padding-top: 6px; + font-size: 12px; + } +} +.btn { + display: inline-block; + padding: 6px 12px; + margin-bottom: 0; + font-size: 14px; + font-weight: normal; + line-height: 1.42857143; + text-align: center; + white-space: nowrap; + vertical-align: middle; + -ms-touch-action: manipulation; + touch-action: manipulation; + cursor: pointer; + -webkit-user-select: none; + -moz-user-select: none; + -ms-user-select: none; + user-select: none; + background-image: none; + border: 1px solid transparent; + border-radius: 4px; +} +.btn:focus, +.btn:active:focus, +.btn.active:focus, +.btn.focus, +.btn:active.focus, +.btn.active.focus { + outline: 5px auto -webkit-focus-ring-color; + outline-offset: -2px; +} +.btn:hover, +.btn:focus, +.btn.focus { + color: #333; + text-decoration: none; +} +.btn:active, +.btn.active { + background-image: none; + outline: 0; + -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125); + box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125); +} +.btn.disabled, +.btn[disabled], +fieldset[disabled] .btn { + cursor: not-allowed; + filter: alpha(opacity=65); + -webkit-box-shadow: none; + box-shadow: none; + opacity: .65; +} +a.btn.disabled, +fieldset[disabled] a.btn { + pointer-events: none; +} +.btn-default { + color: #333; + background-color: #fff; + border-color: #ccc; +} +.btn-default:focus, +.btn-default.focus { + color: #333; + background-color: #e6e6e6; + border-color: #8c8c8c; +} +.btn-default:hover { + color: #333; + background-color: #e6e6e6; + border-color: #adadad; +} +.btn-default:active, +.btn-default.active, +.open > .dropdown-toggle.btn-default { + color: #333; + background-color: #e6e6e6; + border-color: #adadad; +} +.btn-default:active:hover, +.btn-default.active:hover, +.open > .dropdown-toggle.btn-default:hover, +.btn-default:active:focus, +.btn-default.active:focus, +.open > .dropdown-toggle.btn-default:focus, +.btn-default:active.focus, +.btn-default.active.focus, +.open > .dropdown-toggle.btn-default.focus { + color: #333; + background-color: #d4d4d4; + border-color: #8c8c8c; +} +.btn-default:active, +.btn-default.active, +.open > .dropdown-toggle.btn-default { + background-image: none; +} +.btn-default.disabled:hover, +.btn-default[disabled]:hover, +fieldset[disabled] .btn-default:hover, +.btn-default.disabled:focus, +.btn-default[disabled]:focus, +fieldset[disabled] .btn-default:focus, +.btn-default.disabled.focus, +.btn-default[disabled].focus, +fieldset[disabled] .btn-default.focus { + background-color: #fff; + border-color: #ccc; +} +.btn-default .badge { + color: #fff; + background-color: #333; +} +.btn-primary { + color: #fff; + background-color: #337ab7; + border-color: #2e6da4; +} +.btn-primary:focus, +.btn-primary.focus { + color: #fff; + background-color: #286090; + border-color: #122b40; +} +.btn-primary:hover { + color: #fff; + background-color: #286090; + border-color: #204d74; +} +.btn-primary:active, +.btn-primary.active, +.open > .dropdown-toggle.btn-primary { + color: #fff; + background-color: #286090; + border-color: #204d74; +} +.btn-primary:active:hover, +.btn-primary.active:hover, +.open > .dropdown-toggle.btn-primary:hover, +.btn-primary:active:focus, +.btn-primary.active:focus, +.open > .dropdown-toggle.btn-primary:focus, +.btn-primary:active.focus, +.btn-primary.active.focus, +.open > .dropdown-toggle.btn-primary.focus { + color: #fff; + background-color: #204d74; + border-color: #122b40; +} +.btn-primary:active, +.btn-primary.active, +.open > .dropdown-toggle.btn-primary { + background-image: none; +} +.btn-primary.disabled:hover, +.btn-primary[disabled]:hover, +fieldset[disabled] .btn-primary:hover, +.btn-primary.disabled:focus, +.btn-primary[disabled]:focus, +fieldset[disabled] .btn-primary:focus, +.btn-primary.disabled.focus, +.btn-primary[disabled].focus, +fieldset[disabled] .btn-primary.focus { + background-color: #337ab7; + border-color: #2e6da4; +} +.btn-primary .badge { + color: #337ab7; + background-color: #fff; +} +.btn-success { + color: #fff; + background-color: #5cb85c; + border-color: #4cae4c; +} +.btn-success:focus, +.btn-success.focus { + color: #fff; + background-color: #449d44; + border-color: #255625; +} +.btn-success:hover { + color: #fff; + background-color: #449d44; + border-color: #398439; +} +.btn-success:active, +.btn-success.active, +.open > .dropdown-toggle.btn-success { + color: #fff; + background-color: #449d44; + border-color: #398439; +} +.btn-success:active:hover, +.btn-success.active:hover, +.open > .dropdown-toggle.btn-success:hover, +.btn-success:active:focus, +.btn-success.active:focus, +.open > .dropdown-toggle.btn-success:focus, +.btn-success:active.focus, +.btn-success.active.focus, +.open > .dropdown-toggle.btn-success.focus { + color: #fff; + background-color: #398439; + border-color: #255625; +} +.btn-success:active, +.btn-success.active, +.open > .dropdown-toggle.btn-success { + background-image: none; +} +.btn-success.disabled:hover, +.btn-success[disabled]:hover, +fieldset[disabled] .btn-success:hover, +.btn-success.disabled:focus, +.btn-success[disabled]:focus, +fieldset[disabled] .btn-success:focus, +.btn-success.disabled.focus, +.btn-success[disabled].focus, +fieldset[disabled] .btn-success.focus { + background-color: #5cb85c; + border-color: #4cae4c; +} +.btn-success .badge { + color: #5cb85c; + background-color: #fff; +} +.btn-info { + color: #fff; + background-color: #5bc0de; + border-color: #46b8da; +} +.btn-info:focus, +.btn-info.focus { + color: #fff; + background-color: #31b0d5; + border-color: #1b6d85; +} +.btn-info:hover { + color: #fff; + background-color: #31b0d5; + border-color: #269abc; +} +.btn-info:active, +.btn-info.active, +.open > .dropdown-toggle.btn-info { + color: #fff; + background-color: #31b0d5; + border-color: #269abc; +} +.btn-info:active:hover, +.btn-info.active:hover, +.open > .dropdown-toggle.btn-info:hover, +.btn-info:active:focus, +.btn-info.active:focus, +.open > .dropdown-toggle.btn-info:focus, +.btn-info:active.focus, +.btn-info.active.focus, +.open > .dropdown-toggle.btn-info.focus { + color: #fff; + background-color: #269abc; + border-color: #1b6d85; +} +.btn-info:active, +.btn-info.active, +.open > .dropdown-toggle.btn-info { + background-image: none; +} +.btn-info.disabled:hover, +.btn-info[disabled]:hover, +fieldset[disabled] .btn-info:hover, +.btn-info.disabled:focus, +.btn-info[disabled]:focus, +fieldset[disabled] .btn-info:focus, +.btn-info.disabled.focus, +.btn-info[disabled].focus, +fieldset[disabled] .btn-info.focus { + background-color: #5bc0de; + border-color: #46b8da; +} +.btn-info .badge { + color: #5bc0de; + background-color: #fff; +} +.btn-warning { + color: #fff; + background-color: #f0ad4e; + border-color: #eea236; +} +.btn-warning:focus, +.btn-warning.focus { + color: #fff; + background-color: #ec971f; + border-color: #985f0d; +} +.btn-warning:hover { + color: #fff; + background-color: #ec971f; + border-color: #d58512; +} +.btn-warning:active, +.btn-warning.active, +.open > .dropdown-toggle.btn-warning { + color: #fff; + background-color: #ec971f; + border-color: #d58512; +} +.btn-warning:active:hover, +.btn-warning.active:hover, +.open > .dropdown-toggle.btn-warning:hover, +.btn-warning:active:focus, +.btn-warning.active:focus, +.open > .dropdown-toggle.btn-warning:focus, +.btn-warning:active.focus, +.btn-warning.active.focus, +.open > .dropdown-toggle.btn-warning.focus { + color: #fff; + background-color: #d58512; + border-color: #985f0d; +} +.btn-warning:active, +.btn-warning.active, +.open > .dropdown-toggle.btn-warning { + background-image: none; +} +.btn-warning.disabled:hover, +.btn-warning[disabled]:hover, +fieldset[disabled] .btn-warning:hover, +.btn-warning.disabled:focus, +.btn-warning[disabled]:focus, +fieldset[disabled] .btn-warning:focus, +.btn-warning.disabled.focus, +.btn-warning[disabled].focus, +fieldset[disabled] .btn-warning.focus { + background-color: #f0ad4e; + border-color: #eea236; +} +.btn-warning .badge { + color: #f0ad4e; + background-color: #fff; +} +.btn-danger { + color: #fff; + background-color: #d9534f; + border-color: #d43f3a; +} +.btn-danger:focus, +.btn-danger.focus { + color: #fff; + background-color: #c9302c; + border-color: #761c19; +} +.btn-danger:hover { + color: #fff; + background-color: #c9302c; + border-color: #ac2925; +} +.btn-danger:active, +.btn-danger.active, +.open > .dropdown-toggle.btn-danger { + color: #fff; + background-color: #c9302c; + border-color: #ac2925; +} +.btn-danger:active:hover, +.btn-danger.active:hover, +.open > .dropdown-toggle.btn-danger:hover, +.btn-danger:active:focus, +.btn-danger.active:focus, +.open > .dropdown-toggle.btn-danger:focus, +.btn-danger:active.focus, +.btn-danger.active.focus, +.open > .dropdown-toggle.btn-danger.focus { + color: #fff; + background-color: #ac2925; + border-color: #761c19; +} +.btn-danger:active, +.btn-danger.active, +.open > .dropdown-toggle.btn-danger { + background-image: none; +} +.btn-danger.disabled:hover, +.btn-danger[disabled]:hover, +fieldset[disabled] .btn-danger:hover, +.btn-danger.disabled:focus, +.btn-danger[disabled]:focus, +fieldset[disabled] .btn-danger:focus, +.btn-danger.disabled.focus, +.btn-danger[disabled].focus, +fieldset[disabled] .btn-danger.focus { + background-color: #d9534f; + border-color: #d43f3a; +} +.btn-danger .badge { + color: #d9534f; + background-color: #fff; +} +.btn-link { + font-weight: normal; + color: #337ab7; + border-radius: 0; +} +.btn-link, +.btn-link:active, +.btn-link.active, +.btn-link[disabled], +fieldset[disabled] .btn-link { + background-color: transparent; + -webkit-box-shadow: none; + box-shadow: none; +} +.btn-link, +.btn-link:hover, +.btn-link:focus, +.btn-link:active { + border-color: transparent; +} +.btn-link:hover, +.btn-link:focus { + color: #23527c; + text-decoration: underline; + background-color: transparent; +} +.btn-link[disabled]:hover, +fieldset[disabled] .btn-link:hover, +.btn-link[disabled]:focus, +fieldset[disabled] .btn-link:focus { + color: #777; + text-decoration: none; +} +.btn-lg, +.btn-group-lg > .btn { + padding: 10px 16px; + font-size: 18px; + line-height: 1.3333333; + border-radius: 6px; +} +.btn-sm, +.btn-group-sm > .btn { + padding: 5px 10px; + font-size: 12px; + line-height: 1.5; + border-radius: 3px; +} +.btn-xs, +.btn-group-xs > .btn { + padding: 1px 5px; + font-size: 12px; + line-height: 1.5; + border-radius: 3px; +} +.btn-block { + display: block; + width: 100%; +} +.btn-block + .btn-block { + margin-top: 5px; +} +input[type="submit"].btn-block, +input[type="reset"].btn-block, +input[type="button"].btn-block { + width: 100%; +} +.fade { + opacity: 0; + -webkit-transition: opacity .15s linear; + -o-transition: opacity .15s linear; + transition: opacity .15s linear; +} +.fade.in { + opacity: 1; +} +.collapse { + display: none; +} +.collapse.in { + display: block; +} +tr.collapse.in { + display: table-row; +} +tbody.collapse.in { + display: table-row-group; +} +.collapsing { + position: relative; + height: 0; + overflow: hidden; + -webkit-transition-timing-function: ease; + -o-transition-timing-function: ease; + transition-timing-function: ease; + -webkit-transition-duration: .35s; + -o-transition-duration: .35s; + transition-duration: .35s; + -webkit-transition-property: height, visibility; + -o-transition-property: height, visibility; + transition-property: height, visibility; +} +.caret { + display: inline-block; + width: 0; + height: 0; + margin-left: 2px; + vertical-align: middle; + border-top: 4px dashed; + border-top: 4px solid \9; + border-right: 4px solid transparent; + border-left: 4px solid transparent; +} +.dropup, +.dropdown { + position: relative; +} +.dropdown-toggle:focus { + outline: 0; +} +.dropdown-menu { + position: absolute; + top: 100%; + left: 0; + z-index: 1000; + display: none; + float: left; + min-width: 160px; + padding: 5px 0; + margin: 2px 0 0; + font-size: 14px; + text-align: left; + list-style: none; + background-color: #fff; + -webkit-background-clip: padding-box; + background-clip: padding-box; + border: 1px solid #ccc; + border: 1px solid rgba(0, 0, 0, .15); + border-radius: 4px; + -webkit-box-shadow: 0 6px 12px rgba(0, 0, 0, .175); + box-shadow: 0 6px 12px rgba(0, 0, 0, .175); +} +.dropdown-menu.pull-right { + right: 0; + left: auto; +} +.dropdown-menu .divider { + height: 1px; + margin: 9px 0; + overflow: hidden; + background-color: #e5e5e5; +} +.dropdown-menu > li > a { + display: block; + padding: 3px 20px; + clear: both; + font-weight: normal; + line-height: 1.42857143; + color: #333; + white-space: nowrap; +} +.dropdown-menu > li > a:hover, +.dropdown-menu > li > a:focus { + color: #262626; + text-decoration: none; + background-color: #f5f5f5; +} +.dropdown-menu > .active > a, +.dropdown-menu > .active > a:hover, +.dropdown-menu > .active > a:focus { + color: #fff; + text-decoration: none; + background-color: #337ab7; + outline: 0; +} +.dropdown-menu > .disabled > a, +.dropdown-menu > .disabled > a:hover, +.dropdown-menu > .disabled > a:focus { + color: #777; +} +.dropdown-menu > .disabled > a:hover, +.dropdown-menu > .disabled > a:focus { + text-decoration: none; + cursor: not-allowed; + background-color: transparent; + background-image: none; + filter: progid:DXImageTransform.Microsoft.gradient(enabled = false); +} +.open > .dropdown-menu { + display: block; +} +.open > a { + outline: 0; +} +.dropdown-menu-right { + right: 0; + left: auto; +} +.dropdown-menu-left { + right: auto; + left: 0; +} +.dropdown-header { + display: block; + padding: 3px 20px; + font-size: 12px; + line-height: 1.42857143; + color: #777; + white-space: nowrap; +} +.dropdown-backdrop { + position: fixed; + top: 0; + right: 0; + bottom: 0; + left: 0; + z-index: 990; +} +.pull-right > .dropdown-menu { + right: 0; + left: auto; +} +.dropup .caret, +.navbar-fixed-bottom .dropdown .caret { + content: ""; + border-top: 0; + border-bottom: 4px dashed; + border-bottom: 4px solid \9; +} +.dropup .dropdown-menu, +.navbar-fixed-bottom .dropdown .dropdown-menu { + top: auto; + bottom: 100%; + margin-bottom: 2px; +} +@media (min-width: 768px) { + .navbar-right .dropdown-menu { + right: 0; + left: auto; + } + .navbar-right .dropdown-menu-left { + right: auto; + left: 0; + } +} +.btn-group, +.btn-group-vertical { + position: relative; + display: inline-block; + vertical-align: middle; +} +.btn-group > .btn, +.btn-group-vertical > .btn { + position: relative; + float: left; +} +.btn-group > .btn:hover, +.btn-group-vertical > .btn:hover, +.btn-group > .btn:focus, +.btn-group-vertical > .btn:focus, +.btn-group > .btn:active, +.btn-group-vertical > .btn:active, +.btn-group > .btn.active, +.btn-group-vertical > .btn.active { + z-index: 2; +} +.btn-group .btn + .btn, +.btn-group .btn + .btn-group, +.btn-group .btn-group + .btn, +.btn-group .btn-group + .btn-group { + margin-left: -1px; +} +.btn-toolbar { + margin-left: -5px; +} +.btn-toolbar .btn, +.btn-toolbar .btn-group, +.btn-toolbar .input-group { + float: left; +} +.btn-toolbar > .btn, +.btn-toolbar > .btn-group, +.btn-toolbar > .input-group { + margin-left: 5px; +} +.btn-group > .btn:not(:first-child):not(:last-child):not(.dropdown-toggle) { + border-radius: 0; +} +.btn-group > .btn:first-child { + margin-left: 0; +} +.btn-group > .btn:first-child:not(:last-child):not(.dropdown-toggle) { + border-top-right-radius: 0; + border-bottom-right-radius: 0; +} +.btn-group > .btn:last-child:not(:first-child), +.btn-group > .dropdown-toggle:not(:first-child) { + border-top-left-radius: 0; + border-bottom-left-radius: 0; +} +.btn-group > .btn-group { + float: left; +} +.btn-group > .btn-group:not(:first-child):not(:last-child) > .btn { + border-radius: 0; +} +.btn-group > .btn-group:first-child:not(:last-child) > .btn:last-child, +.btn-group > .btn-group:first-child:not(:last-child) > .dropdown-toggle { + border-top-right-radius: 0; + border-bottom-right-radius: 0; +} +.btn-group > .btn-group:last-child:not(:first-child) > .btn:first-child { + border-top-left-radius: 0; + border-bottom-left-radius: 0; +} +.btn-group .dropdown-toggle:active, +.btn-group.open .dropdown-toggle { + outline: 0; +} +.btn-group > .btn + .dropdown-toggle { + padding-right: 8px; + padding-left: 8px; +} +.btn-group > .btn-lg + .dropdown-toggle { + padding-right: 12px; + padding-left: 12px; +} +.btn-group.open .dropdown-toggle { + -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125); + box-shadow: inset 0 3px 5px rgba(0, 0, 0, .125); +} +.btn-group.open .dropdown-toggle.btn-link { + -webkit-box-shadow: none; + box-shadow: none; +} +.btn .caret { + margin-left: 0; +} +.btn-lg .caret { + border-width: 5px 5px 0; + border-bottom-width: 0; +} +.dropup .btn-lg .caret { + border-width: 0 5px 5px; +} +.btn-group-vertical > .btn, +.btn-group-vertical > .btn-group, +.btn-group-vertical > .btn-group > .btn { + display: block; + float: none; + width: 100%; + max-width: 100%; +} +.btn-group-vertical > .btn-group > .btn { + float: none; +} +.btn-group-vertical > .btn + .btn, +.btn-group-vertical > .btn + .btn-group, +.btn-group-vertical > .btn-group + .btn, +.btn-group-vertical > .btn-group + .btn-group { + margin-top: -1px; + margin-left: 0; +} +.btn-group-vertical > .btn:not(:first-child):not(:last-child) { + border-radius: 0; +} +.btn-group-vertical > .btn:first-child:not(:last-child) { + border-top-left-radius: 4px; + border-top-right-radius: 4px; + border-bottom-right-radius: 0; + border-bottom-left-radius: 0; +} +.btn-group-vertical > .btn:last-child:not(:first-child) { + border-top-left-radius: 0; + border-top-right-radius: 0; + border-bottom-right-radius: 4px; + border-bottom-left-radius: 4px; +} +.btn-group-vertical > .btn-group:not(:first-child):not(:last-child) > .btn { + border-radius: 0; +} +.btn-group-vertical > .btn-group:first-child:not(:last-child) > .btn:last-child, +.btn-group-vertical > .btn-group:first-child:not(:last-child) > .dropdown-toggle { + border-bottom-right-radius: 0; + border-bottom-left-radius: 0; +} +.btn-group-vertical > .btn-group:last-child:not(:first-child) > .btn:first-child { + border-top-left-radius: 0; + border-top-right-radius: 0; +} +.btn-group-justified { + display: table; + width: 100%; + table-layout: fixed; + border-collapse: separate; +} +.btn-group-justified > .btn, +.btn-group-justified > .btn-group { + display: table-cell; + float: none; + width: 1%; +} +.btn-group-justified > .btn-group .btn { + width: 100%; +} +.btn-group-justified > .btn-group .dropdown-menu { + left: auto; +} +[data-toggle="buttons"] > .btn input[type="radio"], +[data-toggle="buttons"] > .btn-group > .btn input[type="radio"], +[data-toggle="buttons"] > .btn input[type="checkbox"], +[data-toggle="buttons"] > .btn-group > .btn input[type="checkbox"] { + position: absolute; + clip: rect(0, 0, 0, 0); + pointer-events: none; +} +.input-group { + position: relative; + display: table; + border-collapse: separate; +} +.input-group[class*="col-"] { + float: none; + padding-right: 0; + padding-left: 0; +} +.input-group .form-control { + position: relative; + z-index: 2; + float: left; + width: 100%; + margin-bottom: 0; +} +.input-group .form-control:focus { + z-index: 3; +} +.input-group-lg > .form-control, +.input-group-lg > .input-group-addon, +.input-group-lg > .input-group-btn > .btn { + height: 46px; + padding: 10px 16px; + font-size: 18px; + line-height: 1.3333333; + border-radius: 6px; +} +select.input-group-lg > .form-control, +select.input-group-lg > .input-group-addon, +select.input-group-lg > .input-group-btn > .btn { + height: 46px; + line-height: 46px; +} +textarea.input-group-lg > .form-control, +textarea.input-group-lg > .input-group-addon, +textarea.input-group-lg > .input-group-btn > .btn, +select[multiple].input-group-lg > .form-control, +select[multiple].input-group-lg > .input-group-addon, +select[multiple].input-group-lg > .input-group-btn > .btn { + height: auto; +} +.input-group-sm > .form-control, +.input-group-sm > .input-group-addon, +.input-group-sm > .input-group-btn > .btn { + height: 30px; + padding: 5px 10px; + font-size: 12px; + line-height: 1.5; + border-radius: 3px; +} +select.input-group-sm > .form-control, +select.input-group-sm > .input-group-addon, +select.input-group-sm > .input-group-btn > .btn { + height: 30px; + line-height: 30px; +} +textarea.input-group-sm > .form-control, +textarea.input-group-sm > .input-group-addon, +textarea.input-group-sm > .input-group-btn > .btn, +select[multiple].input-group-sm > .form-control, +select[multiple].input-group-sm > .input-group-addon, +select[multiple].input-group-sm > .input-group-btn > .btn { + height: auto; +} +.input-group-addon, +.input-group-btn, +.input-group .form-control { + display: table-cell; +} +.input-group-addon:not(:first-child):not(:last-child), +.input-group-btn:not(:first-child):not(:last-child), +.input-group .form-control:not(:first-child):not(:last-child) { + border-radius: 0; +} +.input-group-addon, +.input-group-btn { + width: 1%; + white-space: nowrap; + vertical-align: middle; +} +.input-group-addon { + padding: 6px 12px; + font-size: 14px; + font-weight: normal; + line-height: 1; + color: #555; + text-align: center; + background-color: #eee; + border: 1px solid #ccc; + border-radius: 4px; +} +.input-group-addon.input-sm { + padding: 5px 10px; + font-size: 12px; + border-radius: 3px; +} +.input-group-addon.input-lg { + padding: 10px 16px; + font-size: 18px; + border-radius: 6px; +} +.input-group-addon input[type="radio"], +.input-group-addon input[type="checkbox"] { + margin-top: 0; +} +.input-group .form-control:first-child, +.input-group-addon:first-child, +.input-group-btn:first-child > .btn, +.input-group-btn:first-child > .btn-group > .btn, +.input-group-btn:first-child > .dropdown-toggle, +.input-group-btn:last-child > .btn:not(:last-child):not(.dropdown-toggle), +.input-group-btn:last-child > .btn-group:not(:last-child) > .btn { + border-top-right-radius: 0; + border-bottom-right-radius: 0; +} +.input-group-addon:first-child { + border-right: 0; +} +.input-group .form-control:last-child, +.input-group-addon:last-child, +.input-group-btn:last-child > .btn, +.input-group-btn:last-child > .btn-group > .btn, +.input-group-btn:last-child > .dropdown-toggle, +.input-group-btn:first-child > .btn:not(:first-child), +.input-group-btn:first-child > .btn-group:not(:first-child) > .btn { + border-top-left-radius: 0; + border-bottom-left-radius: 0; +} +.input-group-addon:last-child { + border-left: 0; +} +.input-group-btn { + position: relative; + font-size: 0; + white-space: nowrap; +} +.input-group-btn > .btn { + position: relative; +} +.input-group-btn > .btn + .btn { + margin-left: -1px; +} +.input-group-btn > .btn:hover, +.input-group-btn > .btn:focus, +.input-group-btn > .btn:active { + z-index: 2; +} +.input-group-btn:first-child > .btn, +.input-group-btn:first-child > .btn-group { + margin-right: -1px; +} +.input-group-btn:last-child > .btn, +.input-group-btn:last-child > .btn-group { + z-index: 2; + margin-left: -1px; +} +.nav { + padding-left: 0; + margin-bottom: 0; + list-style: none; +} +.nav > li { + position: relative; + display: block; +} +.nav > li > a { + position: relative; + display: block; + padding: 10px 15px; +} +.nav > li > a:hover, +.nav > li > a:focus { + text-decoration: none; + background-color: #eee; +} +.nav > li.disabled > a { + color: #777; +} +.nav > li.disabled > a:hover, +.nav > li.disabled > a:focus { + color: #777; + text-decoration: none; + cursor: not-allowed; + background-color: transparent; +} +.nav .open > a, +.nav .open > a:hover, +.nav .open > a:focus { + background-color: #eee; + border-color: #337ab7; +} +.nav .nav-divider { + height: 1px; + margin: 9px 0; + overflow: hidden; + background-color: #e5e5e5; +} +.nav > li > a > img { + max-width: none; +} +.nav-tabs { + border-bottom: 1px solid #ddd; +} +.nav-tabs > li { + float: left; + margin-bottom: -1px; +} +.nav-tabs > li > a { + margin-right: 2px; + line-height: 1.42857143; + border: 1px solid transparent; + border-radius: 4px 4px 0 0; +} +.nav-tabs > li > a:hover { + border-color: #eee #eee #ddd; +} +.nav-tabs > li.active > a, +.nav-tabs > li.active > a:hover, +.nav-tabs > li.active > a:focus { + color: #555; + cursor: default; + background-color: #fff; + border: 1px solid #ddd; + border-bottom-color: transparent; +} +.nav-tabs.nav-justified { + width: 100%; + border-bottom: 0; +} +.nav-tabs.nav-justified > li { + float: none; +} +.nav-tabs.nav-justified > li > a { + margin-bottom: 5px; + text-align: center; +} +.nav-tabs.nav-justified > .dropdown .dropdown-menu { + top: auto; + left: auto; +} +@media (min-width: 768px) { + .nav-tabs.nav-justified > li { + display: table-cell; + width: 1%; + } + .nav-tabs.nav-justified > li > a { + margin-bottom: 0; + } +} +.nav-tabs.nav-justified > li > a { + margin-right: 0; + border-radius: 4px; +} +.nav-tabs.nav-justified > .active > a, +.nav-tabs.nav-justified > .active > a:hover, +.nav-tabs.nav-justified > .active > a:focus { + border: 1px solid #ddd; +} +@media (min-width: 768px) { + .nav-tabs.nav-justified > li > a { + border-bottom: 1px solid #ddd; + border-radius: 4px 4px 0 0; + } + .nav-tabs.nav-justified > .active > a, + .nav-tabs.nav-justified > .active > a:hover, + .nav-tabs.nav-justified > .active > a:focus { + border-bottom-color: #fff; + } +} +.nav-pills > li { + float: left; +} +.nav-pills > li > a { + border-radius: 4px; +} +.nav-pills > li + li { + margin-left: 2px; +} +.nav-pills > li.active > a, +.nav-pills > li.active > a:hover, +.nav-pills > li.active > a:focus { + color: #fff; + background-color: #337ab7; +} +.nav-stacked > li { + float: none; +} +.nav-stacked > li + li { + margin-top: 2px; + margin-left: 0; +} +.nav-justified { + width: 100%; +} +.nav-justified > li { + float: none; +} +.nav-justified > li > a { + margin-bottom: 5px; + text-align: center; +} +.nav-justified > .dropdown .dropdown-menu { + top: auto; + left: auto; +} +@media (min-width: 768px) { + .nav-justified > li { + display: table-cell; + width: 1%; + } + .nav-justified > li > a { + margin-bottom: 0; + } +} +.nav-tabs-justified { + border-bottom: 0; +} +.nav-tabs-justified > li > a { + margin-right: 0; + border-radius: 4px; +} +.nav-tabs-justified > .active > a, +.nav-tabs-justified > .active > a:hover, +.nav-tabs-justified > .active > a:focus { + border: 1px solid #ddd; +} +@media (min-width: 768px) { + .nav-tabs-justified > li > a { + border-bottom: 1px solid #ddd; + border-radius: 4px 4px 0 0; + } + .nav-tabs-justified > .active > a, + .nav-tabs-justified > .active > a:hover, + .nav-tabs-justified > .active > a:focus { + border-bottom-color: #fff; + } +} +.tab-content > .tab-pane { + display: none; +} +.tab-content > .active { + display: block; +} +.nav-tabs .dropdown-menu { + margin-top: -1px; + border-top-left-radius: 0; + border-top-right-radius: 0; +} +.navbar { + position: relative; + min-height: 50px; + margin-bottom: 20px; + border: 1px solid transparent; +} +@media (min-width: 768px) { + .navbar { + border-radius: 4px; + } +} +@media (min-width: 768px) { + .navbar-header { + float: left; + } +} +.navbar-collapse { + padding-right: 15px; + padding-left: 15px; + overflow-x: visible; + -webkit-overflow-scrolling: touch; + border-top: 1px solid transparent; + -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1); + box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1); +} +.navbar-collapse.in { + overflow-y: auto; +} +@media (min-width: 768px) { + .navbar-collapse { + width: auto; + border-top: 0; + -webkit-box-shadow: none; + box-shadow: none; + } + .navbar-collapse.collapse { + display: block !important; + height: auto !important; + padding-bottom: 0; + overflow: visible !important; + } + .navbar-collapse.in { + overflow-y: visible; + } + .navbar-fixed-top .navbar-collapse, + .navbar-static-top .navbar-collapse, + .navbar-fixed-bottom .navbar-collapse { + padding-right: 0; + padding-left: 0; + } +} +.navbar-fixed-top .navbar-collapse, +.navbar-fixed-bottom .navbar-collapse { + max-height: 340px; +} +@media (max-device-width: 480px) and (orientation: landscape) { + .navbar-fixed-top .navbar-collapse, + .navbar-fixed-bottom .navbar-collapse { + max-height: 200px; + } +} +.container > .navbar-header, +.container-fluid > .navbar-header, +.container > .navbar-collapse, +.container-fluid > .navbar-collapse { + margin-right: -15px; + margin-left: -15px; +} +@media (min-width: 768px) { + .container > .navbar-header, + .container-fluid > .navbar-header, + .container > .navbar-collapse, + .container-fluid > .navbar-collapse { + margin-right: 0; + margin-left: 0; + } +} +.navbar-static-top { + z-index: 1000; + border-width: 0 0 1px; +} +@media (min-width: 768px) { + .navbar-static-top { + border-radius: 0; + } +} +.navbar-fixed-top, +.navbar-fixed-bottom { + position: fixed; + right: 0; + left: 0; + z-index: 1030; +} +@media (min-width: 768px) { + .navbar-fixed-top, + .navbar-fixed-bottom { + border-radius: 0; + } +} +.navbar-fixed-top { + top: 0; + border-width: 0 0 1px; +} +.navbar-fixed-bottom { + bottom: 0; + margin-bottom: 0; + border-width: 1px 0 0; +} +.navbar-brand { + float: left; + height: 50px; + padding: 15px 15px; + font-size: 18px; + line-height: 20px; +} +.navbar-brand:hover, +.navbar-brand:focus { + text-decoration: none; +} +.navbar-brand > img { + display: block; +} +@media (min-width: 768px) { + .navbar > .container .navbar-brand, + .navbar > .container-fluid .navbar-brand { + margin-left: -15px; + } +} +.navbar-toggle { + position: relative; + float: right; + padding: 9px 10px; + margin-top: 8px; + margin-right: 15px; + margin-bottom: 8px; + background-color: transparent; + background-image: none; + border: 1px solid transparent; + border-radius: 4px; +} +.navbar-toggle:focus { + outline: 0; +} +.navbar-toggle .icon-bar { + display: block; + width: 22px; + height: 2px; + border-radius: 1px; +} +.navbar-toggle .icon-bar + .icon-bar { + margin-top: 4px; +} +@media (min-width: 768px) { + .navbar-toggle { + display: none; + } +} +.navbar-nav { + margin: 7.5px -15px; +} +.navbar-nav > li > a { + padding-top: 10px; + padding-bottom: 10px; + line-height: 20px; +} +@media (max-width: 767px) { + .navbar-nav .open .dropdown-menu { + position: static; + float: none; + width: auto; + margin-top: 0; + background-color: transparent; + border: 0; + -webkit-box-shadow: none; + box-shadow: none; + } + .navbar-nav .open .dropdown-menu > li > a, + .navbar-nav .open .dropdown-menu .dropdown-header { + padding: 5px 15px 5px 25px; + } + .navbar-nav .open .dropdown-menu > li > a { + line-height: 20px; + } + .navbar-nav .open .dropdown-menu > li > a:hover, + .navbar-nav .open .dropdown-menu > li > a:focus { + background-image: none; + } +} +@media (min-width: 768px) { + .navbar-nav { + float: left; + margin: 0; + } + .navbar-nav > li { + float: left; + } + .navbar-nav > li > a { + padding-top: 15px; + padding-bottom: 15px; + } +} +.navbar-form { + padding: 10px 15px; + margin-top: 8px; + margin-right: -15px; + margin-bottom: 8px; + margin-left: -15px; + border-top: 1px solid transparent; + border-bottom: 1px solid transparent; + -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1), 0 1px 0 rgba(255, 255, 255, .1); + box-shadow: inset 0 1px 0 rgba(255, 255, 255, .1), 0 1px 0 rgba(255, 255, 255, .1); +} +@media (min-width: 768px) { + .navbar-form .form-group { + display: inline-block; + margin-bottom: 0; + vertical-align: middle; + } + .navbar-form .form-control { + display: inline-block; + width: auto; + vertical-align: middle; + } + .navbar-form .form-control-static { + display: inline-block; + } + .navbar-form .input-group { + display: inline-table; + vertical-align: middle; + } + .navbar-form .input-group .input-group-addon, + .navbar-form .input-group .input-group-btn, + .navbar-form .input-group .form-control { + width: auto; + } + .navbar-form .input-group > .form-control { + width: 100%; + } + .navbar-form .control-label { + margin-bottom: 0; + vertical-align: middle; + } + .navbar-form .radio, + .navbar-form .checkbox { + display: inline-block; + margin-top: 0; + margin-bottom: 0; + vertical-align: middle; + } + .navbar-form .radio label, + .navbar-form .checkbox label { + padding-left: 0; + } + .navbar-form .radio input[type="radio"], + .navbar-form .checkbox input[type="checkbox"] { + position: relative; + margin-left: 0; + } + .navbar-form .has-feedback .form-control-feedback { + top: 0; + } +} +@media (max-width: 767px) { + .navbar-form .form-group { + margin-bottom: 5px; + } + .navbar-form .form-group:last-child { + margin-bottom: 0; + } +} +@media (min-width: 768px) { + .navbar-form { + width: auto; + padding-top: 0; + padding-bottom: 0; + margin-right: 0; + margin-left: 0; + border: 0; + -webkit-box-shadow: none; + box-shadow: none; + } +} +.navbar-nav > li > .dropdown-menu { + margin-top: 0; + border-top-left-radius: 0; + border-top-right-radius: 0; +} +.navbar-fixed-bottom .navbar-nav > li > .dropdown-menu { + margin-bottom: 0; + border-top-left-radius: 4px; + border-top-right-radius: 4px; + border-bottom-right-radius: 0; + border-bottom-left-radius: 0; +} +.navbar-btn { + margin-top: 8px; + margin-bottom: 8px; +} +.navbar-btn.btn-sm { + margin-top: 10px; + margin-bottom: 10px; +} +.navbar-btn.btn-xs { + margin-top: 14px; + margin-bottom: 14px; +} +.navbar-text { + margin-top: 15px; + margin-bottom: 15px; +} +@media (min-width: 768px) { + .navbar-text { + float: left; + margin-right: 15px; + margin-left: 15px; + } +} +@media (min-width: 768px) { + .navbar-left { + float: left !important; + } + .navbar-right { + float: right !important; + margin-right: -15px; + } + .navbar-right ~ .navbar-right { + margin-right: 0; + } +} +.navbar-default { + background-color: #f8f8f8; + border-color: #e7e7e7; +} +.navbar-default .navbar-brand { + color: #777; +} +.navbar-default .navbar-brand:hover, +.navbar-default .navbar-brand:focus { + color: #5e5e5e; + background-color: transparent; +} +.navbar-default .navbar-text { + color: #777; +} +.navbar-default .navbar-nav > li > a { + color: #777; +} +.navbar-default .navbar-nav > li > a:hover, +.navbar-default .navbar-nav > li > a:focus { + color: #333; + background-color: transparent; +} +.navbar-default .navbar-nav > .active > a, +.navbar-default .navbar-nav > .active > a:hover, +.navbar-default .navbar-nav > .active > a:focus { + color: #555; + background-color: #e7e7e7; +} +.navbar-default .navbar-nav > .disabled > a, +.navbar-default .navbar-nav > .disabled > a:hover, +.navbar-default .navbar-nav > .disabled > a:focus { + color: #ccc; + background-color: transparent; +} +.navbar-default .navbar-toggle { + border-color: #ddd; +} +.navbar-default .navbar-toggle:hover, +.navbar-default .navbar-toggle:focus { + background-color: #ddd; +} +.navbar-default .navbar-toggle .icon-bar { + background-color: #888; +} +.navbar-default .navbar-collapse, +.navbar-default .navbar-form { + border-color: #e7e7e7; +} +.navbar-default .navbar-nav > .open > a, +.navbar-default .navbar-nav > .open > a:hover, +.navbar-default .navbar-nav > .open > a:focus { + color: #555; + background-color: #e7e7e7; +} +@media (max-width: 767px) { + .navbar-default .navbar-nav .open .dropdown-menu > li > a { + color: #777; + } + .navbar-default .navbar-nav .open .dropdown-menu > li > a:hover, + .navbar-default .navbar-nav .open .dropdown-menu > li > a:focus { + color: #333; + background-color: transparent; + } + .navbar-default .navbar-nav .open .dropdown-menu > .active > a, + .navbar-default .navbar-nav .open .dropdown-menu > .active > a:hover, + .navbar-default .navbar-nav .open .dropdown-menu > .active > a:focus { + color: #555; + background-color: #e7e7e7; + } + .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a, + .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:hover, + .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:focus { + color: #ccc; + background-color: transparent; + } +} +.navbar-default .navbar-link { + color: #777; +} +.navbar-default .navbar-link:hover { + color: #333; +} +.navbar-default .btn-link { + color: #777; +} +.navbar-default .btn-link:hover, +.navbar-default .btn-link:focus { + color: #333; +} +.navbar-default .btn-link[disabled]:hover, +fieldset[disabled] .navbar-default .btn-link:hover, +.navbar-default .btn-link[disabled]:focus, +fieldset[disabled] .navbar-default .btn-link:focus { + color: #ccc; +} +.navbar-inverse { + background-color: #222; + border-color: #080808; +} +.navbar-inverse .navbar-brand { + color: #9d9d9d; +} +.navbar-inverse .navbar-brand:hover, +.navbar-inverse .navbar-brand:focus { + color: #fff; + background-color: transparent; +} +.navbar-inverse .navbar-text { + color: #9d9d9d; +} +.navbar-inverse .navbar-nav > li > a { + color: #9d9d9d; +} +.navbar-inverse .navbar-nav > li > a:hover, +.navbar-inverse .navbar-nav > li > a:focus { + color: #fff; + background-color: transparent; +} +.navbar-inverse .navbar-nav > .active > a, +.navbar-inverse .navbar-nav > .active > a:hover, +.navbar-inverse .navbar-nav > .active > a:focus { + color: #fff; + background-color: #080808; +} +.navbar-inverse .navbar-nav > .disabled > a, +.navbar-inverse .navbar-nav > .disabled > a:hover, +.navbar-inverse .navbar-nav > .disabled > a:focus { + color: #444; + background-color: transparent; +} +.navbar-inverse .navbar-toggle { + border-color: #333; +} +.navbar-inverse .navbar-toggle:hover, +.navbar-inverse .navbar-toggle:focus { + background-color: #333; +} +.navbar-inverse .navbar-toggle .icon-bar { + background-color: #fff; +} +.navbar-inverse .navbar-collapse, +.navbar-inverse .navbar-form { + border-color: #101010; +} +.navbar-inverse .navbar-nav > .open > a, +.navbar-inverse .navbar-nav > .open > a:hover, +.navbar-inverse .navbar-nav > .open > a:focus { + color: #fff; + background-color: #080808; +} +@media (max-width: 767px) { + .navbar-inverse .navbar-nav .open .dropdown-menu > .dropdown-header { + border-color: #080808; + } + .navbar-inverse .navbar-nav .open .dropdown-menu .divider { + background-color: #080808; + } + .navbar-inverse .navbar-nav .open .dropdown-menu > li > a { + color: #9d9d9d; + } + .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:hover, + .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:focus { + color: #fff; + background-color: transparent; + } + .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a, + .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:hover, + .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:focus { + color: #fff; + background-color: #080808; + } + .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a, + .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:hover, + .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:focus { + color: #444; + background-color: transparent; + } +} +.navbar-inverse .navbar-link { + color: #9d9d9d; +} +.navbar-inverse .navbar-link:hover { + color: #fff; +} +.navbar-inverse .btn-link { + color: #9d9d9d; +} +.navbar-inverse .btn-link:hover, +.navbar-inverse .btn-link:focus { + color: #fff; +} +.navbar-inverse .btn-link[disabled]:hover, +fieldset[disabled] .navbar-inverse .btn-link:hover, +.navbar-inverse .btn-link[disabled]:focus, +fieldset[disabled] .navbar-inverse .btn-link:focus { + color: #444; +} +.breadcrumb { + padding: 8px 15px; + margin-bottom: 20px; + list-style: none; + background-color: #f5f5f5; + border-radius: 4px; +} +.breadcrumb > li { + display: inline-block; +} +.breadcrumb > li + li:before { + padding: 0 5px; + color: #ccc; + content: "/\00a0"; +} +.breadcrumb > .active { + color: #777; +} +.pagination { + display: inline-block; + padding-left: 0; + margin: 20px 0; + border-radius: 4px; +} +.pagination > li { + display: inline; +} +.pagination > li > a, +.pagination > li > span { + position: relative; + float: left; + padding: 6px 12px; + margin-left: -1px; + line-height: 1.42857143; + color: #337ab7; + text-decoration: none; + background-color: #fff; + border: 1px solid #ddd; +} +.pagination > li:first-child > a, +.pagination > li:first-child > span { + margin-left: 0; + border-top-left-radius: 4px; + border-bottom-left-radius: 4px; +} +.pagination > li:last-child > a, +.pagination > li:last-child > span { + border-top-right-radius: 4px; + border-bottom-right-radius: 4px; +} +.pagination > li > a:hover, +.pagination > li > span:hover, +.pagination > li > a:focus, +.pagination > li > span:focus { + z-index: 2; + color: #23527c; + background-color: #eee; + border-color: #ddd; +} +.pagination > .active > a, +.pagination > .active > span, +.pagination > .active > a:hover, +.pagination > .active > span:hover, +.pagination > .active > a:focus, +.pagination > .active > span:focus { + z-index: 3; + color: #fff; + cursor: default; + background-color: #337ab7; + border-color: #337ab7; +} +.pagination > .disabled > span, +.pagination > .disabled > span:hover, +.pagination > .disabled > span:focus, +.pagination > .disabled > a, +.pagination > .disabled > a:hover, +.pagination > .disabled > a:focus { + color: #777; + cursor: not-allowed; + background-color: #fff; + border-color: #ddd; +} +.pagination-lg > li > a, +.pagination-lg > li > span { + padding: 10px 16px; + font-size: 18px; + line-height: 1.3333333; +} +.pagination-lg > li:first-child > a, +.pagination-lg > li:first-child > span { + border-top-left-radius: 6px; + border-bottom-left-radius: 6px; +} +.pagination-lg > li:last-child > a, +.pagination-lg > li:last-child > span { + border-top-right-radius: 6px; + border-bottom-right-radius: 6px; +} +.pagination-sm > li > a, +.pagination-sm > li > span { + padding: 5px 10px; + font-size: 12px; + line-height: 1.5; +} +.pagination-sm > li:first-child > a, +.pagination-sm > li:first-child > span { + border-top-left-radius: 3px; + border-bottom-left-radius: 3px; +} +.pagination-sm > li:last-child > a, +.pagination-sm > li:last-child > span { + border-top-right-radius: 3px; + border-bottom-right-radius: 3px; +} +.pager { + padding-left: 0; + margin: 20px 0; + text-align: center; + list-style: none; +} +.pager li { + display: inline; +} +.pager li > a, +.pager li > span { + display: inline-block; + padding: 5px 14px; + background-color: #fff; + border: 1px solid #ddd; + border-radius: 15px; +} +.pager li > a:hover, +.pager li > a:focus { + text-decoration: none; + background-color: #eee; +} +.pager .next > a, +.pager .next > span { + float: right; +} +.pager .previous > a, +.pager .previous > span { + float: left; +} +.pager .disabled > a, +.pager .disabled > a:hover, +.pager .disabled > a:focus, +.pager .disabled > span { + color: #777; + cursor: not-allowed; + background-color: #fff; +} +.label { + display: inline; + padding: .2em .6em .3em; + font-size: 75%; + font-weight: bold; + line-height: 1; + color: #fff; + text-align: center; + white-space: nowrap; + vertical-align: baseline; + border-radius: .25em; +} +a.label:hover, +a.label:focus { + color: #fff; + text-decoration: none; + cursor: pointer; +} +.label:empty { + display: none; +} +.btn .label { + position: relative; + top: -1px; +} +.label-default { + background-color: #777; +} +.label-default[href]:hover, +.label-default[href]:focus { + background-color: #5e5e5e; +} +.label-primary { + background-color: #337ab7; +} +.label-primary[href]:hover, +.label-primary[href]:focus { + background-color: #286090; +} +.label-success { + background-color: #5cb85c; +} +.label-success[href]:hover, +.label-success[href]:focus { + background-color: #449d44; +} +.label-info { + background-color: #5bc0de; +} +.label-info[href]:hover, +.label-info[href]:focus { + background-color: #31b0d5; +} +.label-warning { + background-color: #f0ad4e; +} +.label-warning[href]:hover, +.label-warning[href]:focus { + background-color: #ec971f; +} +.label-danger { + background-color: #d9534f; +} +.label-danger[href]:hover, +.label-danger[href]:focus { + background-color: #c9302c; +} +.badge { + display: inline-block; + min-width: 10px; + padding: 3px 7px; + font-size: 12px; + font-weight: bold; + line-height: 1; + color: #fff; + text-align: center; + white-space: nowrap; + vertical-align: middle; + background-color: #777; + border-radius: 10px; +} +.badge:empty { + display: none; +} +.btn .badge { + position: relative; + top: -1px; +} +.btn-xs .badge, +.btn-group-xs > .btn .badge { + top: 0; + padding: 1px 5px; +} +a.badge:hover, +a.badge:focus { + color: #fff; + text-decoration: none; + cursor: pointer; +} +.list-group-item.active > .badge, +.nav-pills > .active > a > .badge { + color: #337ab7; + background-color: #fff; +} +.list-group-item > .badge { + float: right; +} +.list-group-item > .badge + .badge { + margin-right: 5px; +} +.nav-pills > li > a > .badge { + margin-left: 3px; +} +.jumbotron { + padding-top: 30px; + padding-bottom: 30px; + margin-bottom: 30px; + color: inherit; + background-color: #eee; +} +.jumbotron h1, +.jumbotron .h1 { + color: inherit; +} +.jumbotron p { + margin-bottom: 15px; + font-size: 21px; + font-weight: 200; +} +.jumbotron > hr { + border-top-color: #d5d5d5; +} +.container .jumbotron, +.container-fluid .jumbotron { + padding-right: 15px; + padding-left: 15px; + border-radius: 6px; +} +.jumbotron .container { + max-width: 100%; +} +@media screen and (min-width: 768px) { + .jumbotron { + padding-top: 48px; + padding-bottom: 48px; + } + .container .jumbotron, + .container-fluid .jumbotron { + padding-right: 60px; + padding-left: 60px; + } + .jumbotron h1, + .jumbotron .h1 { + font-size: 63px; + } +} +.thumbnail { + display: block; + padding: 4px; + margin-bottom: 20px; + line-height: 1.42857143; + background-color: #fff; + border: 1px solid #ddd; + border-radius: 4px; + -webkit-transition: border .2s ease-in-out; + -o-transition: border .2s ease-in-out; + transition: border .2s ease-in-out; +} +.thumbnail > img, +.thumbnail a > img { + margin-right: auto; + margin-left: auto; +} +a.thumbnail:hover, +a.thumbnail:focus, +a.thumbnail.active { + border-color: #337ab7; +} +.thumbnail .caption { + padding: 9px; + color: #333; +} +.alert { + padding: 15px; + margin-bottom: 20px; + border: 1px solid transparent; + border-radius: 4px; +} +.alert h4 { + margin-top: 0; + color: inherit; +} +.alert .alert-link { + font-weight: bold; +} +.alert > p, +.alert > ul { + margin-bottom: 0; +} +.alert > p + p { + margin-top: 5px; +} +.alert-dismissable, +.alert-dismissible { + padding-right: 35px; +} +.alert-dismissable .close, +.alert-dismissible .close { + position: relative; + top: -2px; + right: -21px; + color: inherit; +} +.alert-success { + color: #3c763d; + background-color: #dff0d8; + border-color: #d6e9c6; +} +.alert-success hr { + border-top-color: #c9e2b3; +} +.alert-success .alert-link { + color: #2b542c; +} +.alert-info { + color: #31708f; + background-color: #d9edf7; + border-color: #bce8f1; +} +.alert-info hr { + border-top-color: #a6e1ec; +} +.alert-info .alert-link { + color: #245269; +} +.alert-warning { + color: #8a6d3b; + background-color: #fcf8e3; + border-color: #faebcc; +} +.alert-warning hr { + border-top-color: #f7e1b5; +} +.alert-warning .alert-link { + color: #66512c; +} +.alert-danger { + color: #a94442; + background-color: #f2dede; + border-color: #ebccd1; +} +.alert-danger hr { + border-top-color: #e4b9c0; +} +.alert-danger .alert-link { + color: #843534; +} +@-webkit-keyframes progress-bar-stripes { + from { + background-position: 40px 0; + } + to { + background-position: 0 0; + } +} +@-o-keyframes progress-bar-stripes { + from { + background-position: 40px 0; + } + to { + background-position: 0 0; + } +} +@keyframes progress-bar-stripes { + from { + background-position: 40px 0; + } + to { + background-position: 0 0; + } +} +.progress { + height: 20px; + margin-bottom: 20px; + overflow: hidden; + background-color: #f5f5f5; + border-radius: 4px; + -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, .1); + box-shadow: inset 0 1px 2px rgba(0, 0, 0, .1); +} +.progress-bar { + float: left; + width: 0; + height: 100%; + font-size: 12px; + line-height: 20px; + color: #fff; + text-align: center; + background-color: #337ab7; + -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .15); + box-shadow: inset 0 -1px 0 rgba(0, 0, 0, .15); + -webkit-transition: width .6s ease; + -o-transition: width .6s ease; + transition: width .6s ease; +} +.progress-striped .progress-bar, +.progress-bar-striped { + background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + -webkit-background-size: 40px 40px; + background-size: 40px 40px; +} +.progress.active .progress-bar, +.progress-bar.active { + -webkit-animation: progress-bar-stripes 2s linear infinite; + -o-animation: progress-bar-stripes 2s linear infinite; + animation: progress-bar-stripes 2s linear infinite; +} +.progress-bar-success { + background-color: #5cb85c; +} +.progress-striped .progress-bar-success { + background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); +} +.progress-bar-info { + background-color: #5bc0de; +} +.progress-striped .progress-bar-info { + background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); +} +.progress-bar-warning { + background-color: #f0ad4e; +} +.progress-striped .progress-bar-warning { + background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); +} +.progress-bar-danger { + background-color: #d9534f; +} +.progress-striped .progress-bar-danger { + background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); + background-image: linear-gradient(45deg, rgba(255, 255, 255, .15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, .15) 50%, rgba(255, 255, 255, .15) 75%, transparent 75%, transparent); +} +.media { + margin-top: 15px; +} +.media:first-child { + margin-top: 0; +} +.media, +.media-body { + overflow: hidden; + zoom: 1; +} +.media-body { + width: 10000px; +} +.media-object { + display: block; +} +.media-object.img-thumbnail { + max-width: none; +} +.media-right, +.media > .pull-right { + padding-left: 10px; +} +.media-left, +.media > .pull-left { + padding-right: 10px; +} +.media-left, +.media-right, +.media-body { + display: table-cell; + vertical-align: top; +} +.media-middle { + vertical-align: middle; +} +.media-bottom { + vertical-align: bottom; +} +.media-heading { + margin-top: 0; + margin-bottom: 5px; +} +.media-list { + padding-left: 0; + list-style: none; +} +.list-group { + padding-left: 0; + margin-bottom: 20px; +} +.list-group-item { + position: relative; + display: block; + padding: 10px 15px; + margin-bottom: -1px; + background-color: #fff; + border: 1px solid #ddd; +} +.list-group-item:first-child { + border-top-left-radius: 4px; + border-top-right-radius: 4px; +} +.list-group-item:last-child { + margin-bottom: 0; + border-bottom-right-radius: 4px; + border-bottom-left-radius: 4px; +} +a.list-group-item, +button.list-group-item { + color: #555; +} +a.list-group-item .list-group-item-heading, +button.list-group-item .list-group-item-heading { + color: #333; +} +a.list-group-item:hover, +button.list-group-item:hover, +a.list-group-item:focus, +button.list-group-item:focus { + color: #555; + text-decoration: none; + background-color: #f5f5f5; +} +button.list-group-item { + width: 100%; + text-align: left; +} +.list-group-item.disabled, +.list-group-item.disabled:hover, +.list-group-item.disabled:focus { + color: #777; + cursor: not-allowed; + background-color: #eee; +} +.list-group-item.disabled .list-group-item-heading, +.list-group-item.disabled:hover .list-group-item-heading, +.list-group-item.disabled:focus .list-group-item-heading { + color: inherit; +} +.list-group-item.disabled .list-group-item-text, +.list-group-item.disabled:hover .list-group-item-text, +.list-group-item.disabled:focus .list-group-item-text { + color: #777; +} +.list-group-item.active, +.list-group-item.active:hover, +.list-group-item.active:focus { + z-index: 2; + color: #fff; + background-color: #337ab7; + border-color: #337ab7; +} +.list-group-item.active .list-group-item-heading, +.list-group-item.active:hover .list-group-item-heading, +.list-group-item.active:focus .list-group-item-heading, +.list-group-item.active .list-group-item-heading > small, +.list-group-item.active:hover .list-group-item-heading > small, +.list-group-item.active:focus .list-group-item-heading > small, +.list-group-item.active .list-group-item-heading > .small, +.list-group-item.active:hover .list-group-item-heading > .small, +.list-group-item.active:focus .list-group-item-heading > .small { + color: inherit; +} +.list-group-item.active .list-group-item-text, +.list-group-item.active:hover .list-group-item-text, +.list-group-item.active:focus .list-group-item-text { + color: #c7ddef; +} +.list-group-item-success { + color: #3c763d; + background-color: #dff0d8; +} +a.list-group-item-success, +button.list-group-item-success { + color: #3c763d; +} +a.list-group-item-success .list-group-item-heading, +button.list-group-item-success .list-group-item-heading { + color: inherit; +} +a.list-group-item-success:hover, +button.list-group-item-success:hover, +a.list-group-item-success:focus, +button.list-group-item-success:focus { + color: #3c763d; + background-color: #d0e9c6; +} +a.list-group-item-success.active, +button.list-group-item-success.active, +a.list-group-item-success.active:hover, +button.list-group-item-success.active:hover, +a.list-group-item-success.active:focus, +button.list-group-item-success.active:focus { + color: #fff; + background-color: #3c763d; + border-color: #3c763d; +} +.list-group-item-info { + color: #31708f; + background-color: #d9edf7; +} +a.list-group-item-info, +button.list-group-item-info { + color: #31708f; +} +a.list-group-item-info .list-group-item-heading, +button.list-group-item-info .list-group-item-heading { + color: inherit; +} +a.list-group-item-info:hover, +button.list-group-item-info:hover, +a.list-group-item-info:focus, +button.list-group-item-info:focus { + color: #31708f; + background-color: #c4e3f3; +} +a.list-group-item-info.active, +button.list-group-item-info.active, +a.list-group-item-info.active:hover, +button.list-group-item-info.active:hover, +a.list-group-item-info.active:focus, +button.list-group-item-info.active:focus { + color: #fff; + background-color: #31708f; + border-color: #31708f; +} +.list-group-item-warning { + color: #8a6d3b; + background-color: #fcf8e3; +} +a.list-group-item-warning, +button.list-group-item-warning { + color: #8a6d3b; +} +a.list-group-item-warning .list-group-item-heading, +button.list-group-item-warning .list-group-item-heading { + color: inherit; +} +a.list-group-item-warning:hover, +button.list-group-item-warning:hover, +a.list-group-item-warning:focus, +button.list-group-item-warning:focus { + color: #8a6d3b; + background-color: #faf2cc; +} +a.list-group-item-warning.active, +button.list-group-item-warning.active, +a.list-group-item-warning.active:hover, +button.list-group-item-warning.active:hover, +a.list-group-item-warning.active:focus, +button.list-group-item-warning.active:focus { + color: #fff; + background-color: #8a6d3b; + border-color: #8a6d3b; +} +.list-group-item-danger { + color: #a94442; + background-color: #f2dede; +} +a.list-group-item-danger, +button.list-group-item-danger { + color: #a94442; +} +a.list-group-item-danger .list-group-item-heading, +button.list-group-item-danger .list-group-item-heading { + color: inherit; +} +a.list-group-item-danger:hover, +button.list-group-item-danger:hover, +a.list-group-item-danger:focus, +button.list-group-item-danger:focus { + color: #a94442; + background-color: #ebcccc; +} +a.list-group-item-danger.active, +button.list-group-item-danger.active, +a.list-group-item-danger.active:hover, +button.list-group-item-danger.active:hover, +a.list-group-item-danger.active:focus, +button.list-group-item-danger.active:focus { + color: #fff; + background-color: #a94442; + border-color: #a94442; +} +.list-group-item-heading { + margin-top: 0; + margin-bottom: 5px; +} +.list-group-item-text { + margin-bottom: 0; + line-height: 1.3; +} +.panel { + margin-bottom: 20px; + background-color: #fff; + border: 1px solid transparent; + border-radius: 4px; + -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, .05); + box-shadow: 0 1px 1px rgba(0, 0, 0, .05); +} +.panel-body { + padding: 15px; +} +.panel-heading { + padding: 10px 15px; + border-bottom: 1px solid transparent; + border-top-left-radius: 3px; + border-top-right-radius: 3px; +} +.panel-heading > .dropdown .dropdown-toggle { + color: inherit; +} +.panel-title { + margin-top: 0; + margin-bottom: 0; + font-size: 16px; + color: inherit; +} +.panel-title > a, +.panel-title > small, +.panel-title > .small, +.panel-title > small > a, +.panel-title > .small > a { + color: inherit; +} +.panel-footer { + padding: 10px 15px; + background-color: #f5f5f5; + border-top: 1px solid #ddd; + border-bottom-right-radius: 3px; + border-bottom-left-radius: 3px; +} +.panel > .list-group, +.panel > .panel-collapse > .list-group { + margin-bottom: 0; +} +.panel > .list-group .list-group-item, +.panel > .panel-collapse > .list-group .list-group-item { + border-width: 1px 0; + border-radius: 0; +} +.panel > .list-group:first-child .list-group-item:first-child, +.panel > .panel-collapse > .list-group:first-child .list-group-item:first-child { + border-top: 0; + border-top-left-radius: 3px; + border-top-right-radius: 3px; +} +.panel > .list-group:last-child .list-group-item:last-child, +.panel > .panel-collapse > .list-group:last-child .list-group-item:last-child { + border-bottom: 0; + border-bottom-right-radius: 3px; + border-bottom-left-radius: 3px; +} +.panel > .panel-heading + .panel-collapse > .list-group .list-group-item:first-child { + border-top-left-radius: 0; + border-top-right-radius: 0; +} +.panel-heading + .list-group .list-group-item:first-child { + border-top-width: 0; +} +.list-group + .panel-footer { + border-top-width: 0; +} +.panel > .table, +.panel > .table-responsive > .table, +.panel > .panel-collapse > .table { + margin-bottom: 0; +} +.panel > .table caption, +.panel > .table-responsive > .table caption, +.panel > .panel-collapse > .table caption { + padding-right: 15px; + padding-left: 15px; +} +.panel > .table:first-child, +.panel > .table-responsive:first-child > .table:first-child { + border-top-left-radius: 3px; + border-top-right-radius: 3px; +} +.panel > .table:first-child > thead:first-child > tr:first-child, +.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child, +.panel > .table:first-child > tbody:first-child > tr:first-child, +.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child { + border-top-left-radius: 3px; + border-top-right-radius: 3px; +} +.panel > .table:first-child > thead:first-child > tr:first-child td:first-child, +.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:first-child, +.panel > .table:first-child > tbody:first-child > tr:first-child td:first-child, +.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:first-child, +.panel > .table:first-child > thead:first-child > tr:first-child th:first-child, +.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:first-child, +.panel > .table:first-child > tbody:first-child > tr:first-child th:first-child, +.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:first-child { + border-top-left-radius: 3px; +} +.panel > .table:first-child > thead:first-child > tr:first-child td:last-child, +.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:last-child, +.panel > .table:first-child > tbody:first-child > tr:first-child td:last-child, +.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:last-child, +.panel > .table:first-child > thead:first-child > tr:first-child th:last-child, +.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:last-child, +.panel > .table:first-child > tbody:first-child > tr:first-child th:last-child, +.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:last-child { + border-top-right-radius: 3px; +} +.panel > .table:last-child, +.panel > .table-responsive:last-child > .table:last-child { + border-bottom-right-radius: 3px; + border-bottom-left-radius: 3px; +} +.panel > .table:last-child > tbody:last-child > tr:last-child, +.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child, +.panel > .table:last-child > tfoot:last-child > tr:last-child, +.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child { + border-bottom-right-radius: 3px; + border-bottom-left-radius: 3px; +} +.panel > .table:last-child > tbody:last-child > tr:last-child td:first-child, +.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:first-child, +.panel > .table:last-child > tfoot:last-child > tr:last-child td:first-child, +.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:first-child, +.panel > .table:last-child > tbody:last-child > tr:last-child th:first-child, +.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:first-child, +.panel > .table:last-child > tfoot:last-child > tr:last-child th:first-child, +.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:first-child { + border-bottom-left-radius: 3px; +} +.panel > .table:last-child > tbody:last-child > tr:last-child td:last-child, +.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:last-child, +.panel > .table:last-child > tfoot:last-child > tr:last-child td:last-child, +.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:last-child, +.panel > .table:last-child > tbody:last-child > tr:last-child th:last-child, +.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:last-child, +.panel > .table:last-child > tfoot:last-child > tr:last-child th:last-child, +.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:last-child { + border-bottom-right-radius: 3px; +} +.panel > .panel-body + .table, +.panel > .panel-body + .table-responsive, +.panel > .table + .panel-body, +.panel > .table-responsive + .panel-body { + border-top: 1px solid #ddd; +} +.panel > .table > tbody:first-child > tr:first-child th, +.panel > .table > tbody:first-child > tr:first-child td { + border-top: 0; +} +.panel > .table-bordered, +.panel > .table-responsive > .table-bordered { + border: 0; +} +.panel > .table-bordered > thead > tr > th:first-child, +.panel > .table-responsive > .table-bordered > thead > tr > th:first-child, +.panel > .table-bordered > tbody > tr > th:first-child, +.panel > .table-responsive > .table-bordered > tbody > tr > th:first-child, +.panel > .table-bordered > tfoot > tr > th:first-child, +.panel > .table-responsive > .table-bordered > tfoot > tr > th:first-child, +.panel > .table-bordered > thead > tr > td:first-child, +.panel > .table-responsive > .table-bordered > thead > tr > td:first-child, +.panel > .table-bordered > tbody > tr > td:first-child, +.panel > .table-responsive > .table-bordered > tbody > tr > td:first-child, +.panel > .table-bordered > tfoot > tr > td:first-child, +.panel > .table-responsive > .table-bordered > tfoot > tr > td:first-child { + border-left: 0; +} +.panel > .table-bordered > thead > tr > th:last-child, +.panel > .table-responsive > .table-bordered > thead > tr > th:last-child, +.panel > .table-bordered > tbody > tr > th:last-child, +.panel > .table-responsive > .table-bordered > tbody > tr > th:last-child, +.panel > .table-bordered > tfoot > tr > th:last-child, +.panel > .table-responsive > .table-bordered > tfoot > tr > th:last-child, +.panel > .table-bordered > thead > tr > td:last-child, +.panel > .table-responsive > .table-bordered > thead > tr > td:last-child, +.panel > .table-bordered > tbody > tr > td:last-child, +.panel > .table-responsive > .table-bordered > tbody > tr > td:last-child, +.panel > .table-bordered > tfoot > tr > td:last-child, +.panel > .table-responsive > .table-bordered > tfoot > tr > td:last-child { + border-right: 0; +} +.panel > .table-bordered > thead > tr:first-child > td, +.panel > .table-responsive > .table-bordered > thead > tr:first-child > td, +.panel > .table-bordered > tbody > tr:first-child > td, +.panel > .table-responsive > .table-bordered > tbody > tr:first-child > td, +.panel > .table-bordered > thead > tr:first-child > th, +.panel > .table-responsive > .table-bordered > thead > tr:first-child > th, +.panel > .table-bordered > tbody > tr:first-child > th, +.panel > .table-responsive > .table-bordered > tbody > tr:first-child > th { + border-bottom: 0; +} +.panel > .table-bordered > tbody > tr:last-child > td, +.panel > .table-responsive > .table-bordered > tbody > tr:last-child > td, +.panel > .table-bordered > tfoot > tr:last-child > td, +.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > td, +.panel > .table-bordered > tbody > tr:last-child > th, +.panel > .table-responsive > .table-bordered > tbody > tr:last-child > th, +.panel > .table-bordered > tfoot > tr:last-child > th, +.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > th { + border-bottom: 0; +} +.panel > .table-responsive { + margin-bottom: 0; + border: 0; +} +.panel-group { + margin-bottom: 20px; +} +.panel-group .panel { + margin-bottom: 0; + border-radius: 4px; +} +.panel-group .panel + .panel { + margin-top: 5px; +} +.panel-group .panel-heading { + border-bottom: 0; +} +.panel-group .panel-heading + .panel-collapse > .panel-body, +.panel-group .panel-heading + .panel-collapse > .list-group { + border-top: 1px solid #ddd; +} +.panel-group .panel-footer { + border-top: 0; +} +.panel-group .panel-footer + .panel-collapse .panel-body { + border-bottom: 1px solid #ddd; +} +.panel-default { + border-color: #ddd; +} +.panel-default > .panel-heading { + color: #333; + background-color: #f5f5f5; + border-color: #ddd; +} +.panel-default > .panel-heading + .panel-collapse > .panel-body { + border-top-color: #ddd; +} +.panel-default > .panel-heading .badge { + color: #f5f5f5; + background-color: #333; +} +.panel-default > .panel-footer + .panel-collapse > .panel-body { + border-bottom-color: #ddd; +} +.panel-primary { + border-color: #337ab7; +} +.panel-primary > .panel-heading { + color: #fff; + background-color: #337ab7; + border-color: #337ab7; +} +.panel-primary > .panel-heading + .panel-collapse > .panel-body { + border-top-color: #337ab7; +} +.panel-primary > .panel-heading .badge { + color: #337ab7; + background-color: #fff; +} +.panel-primary > .panel-footer + .panel-collapse > .panel-body { + border-bottom-color: #337ab7; +} +.panel-success { + border-color: #d6e9c6; +} +.panel-success > .panel-heading { + color: #3c763d; + background-color: #dff0d8; + border-color: #d6e9c6; +} +.panel-success > .panel-heading + .panel-collapse > .panel-body { + border-top-color: #d6e9c6; +} +.panel-success > .panel-heading .badge { + color: #dff0d8; + background-color: #3c763d; +} +.panel-success > .panel-footer + .panel-collapse > .panel-body { + border-bottom-color: #d6e9c6; +} +.panel-info { + border-color: #bce8f1; +} +.panel-info > .panel-heading { + color: #31708f; + background-color: #d9edf7; + border-color: #bce8f1; +} +.panel-info > .panel-heading + .panel-collapse > .panel-body { + border-top-color: #bce8f1; +} +.panel-info > .panel-heading .badge { + color: #d9edf7; + background-color: #31708f; +} +.panel-info > .panel-footer + .panel-collapse > .panel-body { + border-bottom-color: #bce8f1; +} +.panel-warning { + border-color: #faebcc; +} +.panel-warning > .panel-heading { + color: #8a6d3b; + background-color: #fcf8e3; + border-color: #faebcc; +} +.panel-warning > .panel-heading + .panel-collapse > .panel-body { + border-top-color: #faebcc; +} +.panel-warning > .panel-heading .badge { + color: #fcf8e3; + background-color: #8a6d3b; +} +.panel-warning > .panel-footer + .panel-collapse > .panel-body { + border-bottom-color: #faebcc; +} +.panel-danger { + border-color: #ebccd1; +} +.panel-danger > .panel-heading { + color: #a94442; + background-color: #f2dede; + border-color: #ebccd1; +} +.panel-danger > .panel-heading + .panel-collapse > .panel-body { + border-top-color: #ebccd1; +} +.panel-danger > .panel-heading .badge { + color: #f2dede; + background-color: #a94442; +} +.panel-danger > .panel-footer + .panel-collapse > .panel-body { + border-bottom-color: #ebccd1; +} +.embed-responsive { + position: relative; + display: block; + height: 0; + padding: 0; + overflow: hidden; +} +.embed-responsive .embed-responsive-item, +.embed-responsive iframe, +.embed-responsive embed, +.embed-responsive object, +.embed-responsive video { + position: absolute; + top: 0; + bottom: 0; + left: 0; + width: 100%; + height: 100%; + border: 0; +} +.embed-responsive-16by9 { + padding-bottom: 56.25%; +} +.embed-responsive-4by3 { + padding-bottom: 75%; +} +.well { + min-height: 20px; + padding: 19px; + margin-bottom: 20px; + background-color: #f5f5f5; + border: 1px solid #e3e3e3; + border-radius: 4px; + -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, .05); + box-shadow: inset 0 1px 1px rgba(0, 0, 0, .05); +} +.well blockquote { + border-color: #ddd; + border-color: rgba(0, 0, 0, .15); +} +.well-lg { + padding: 24px; + border-radius: 6px; +} +.well-sm { + padding: 9px; + border-radius: 3px; +} +.close { + float: right; + font-size: 21px; + font-weight: bold; + line-height: 1; + color: #000; + text-shadow: 0 1px 0 #fff; + filter: alpha(opacity=20); + opacity: .2; +} +.close:hover, +.close:focus { + color: #000; + text-decoration: none; + cursor: pointer; + filter: alpha(opacity=50); + opacity: .5; +} +button.close { + -webkit-appearance: none; + padding: 0; + cursor: pointer; + background: transparent; + border: 0; +} +.modal-open { + overflow: hidden; +} +.modal { + position: fixed; + top: 0; + right: 0; + bottom: 0; + left: 0; + z-index: 1050; + display: none; + overflow: hidden; + -webkit-overflow-scrolling: touch; + outline: 0; +} +.modal.fade .modal-dialog { + -webkit-transition: -webkit-transform .3s ease-out; + -o-transition: -o-transform .3s ease-out; + transition: transform .3s ease-out; + -webkit-transform: translate(0, -25%); + -ms-transform: translate(0, -25%); + -o-transform: translate(0, -25%); + transform: translate(0, -25%); +} +.modal.in .modal-dialog { + -webkit-transform: translate(0, 0); + -ms-transform: translate(0, 0); + -o-transform: translate(0, 0); + transform: translate(0, 0); +} +.modal-open .modal { + overflow-x: hidden; + overflow-y: auto; +} +.modal-dialog { + position: relative; + width: auto; + margin: 10px; +} +.modal-content { + position: relative; + background-color: #fff; + -webkit-background-clip: padding-box; + background-clip: padding-box; + border: 1px solid #999; + border: 1px solid rgba(0, 0, 0, .2); + border-radius: 6px; + outline: 0; + -webkit-box-shadow: 0 3px 9px rgba(0, 0, 0, .5); + box-shadow: 0 3px 9px rgba(0, 0, 0, .5); +} +.modal-backdrop { + position: fixed; + top: 0; + right: 0; + bottom: 0; + left: 0; + z-index: 1040; + background-color: #000; +} +.modal-backdrop.fade { + filter: alpha(opacity=0); + opacity: 0; +} +.modal-backdrop.in { + filter: alpha(opacity=50); + opacity: .5; +} +.modal-header { + padding: 15px; + border-bottom: 1px solid #e5e5e5; +} +.modal-header .close { + margin-top: -2px; +} +.modal-title { + margin: 0; + line-height: 1.42857143; +} +.modal-body { + position: relative; + padding: 15px; +} +.modal-footer { + padding: 15px; + text-align: right; + border-top: 1px solid #e5e5e5; +} +.modal-footer .btn + .btn { + margin-bottom: 0; + margin-left: 5px; +} +.modal-footer .btn-group .btn + .btn { + margin-left: -1px; +} +.modal-footer .btn-block + .btn-block { + margin-left: 0; +} +.modal-scrollbar-measure { + position: absolute; + top: -9999px; + width: 50px; + height: 50px; + overflow: scroll; +} +@media (min-width: 768px) { + .modal-dialog { + width: 600px; + margin: 30px auto; + } + .modal-content { + -webkit-box-shadow: 0 5px 15px rgba(0, 0, 0, .5); + box-shadow: 0 5px 15px rgba(0, 0, 0, .5); + } + .modal-sm { + width: 300px; + } +} +@media (min-width: 992px) { + .modal-lg { + width: 900px; + } +} +.tooltip { + position: absolute; + z-index: 1070; + display: block; + font-family: "Helvetica Neue", Helvetica, Arial, sans-serif; + font-size: 12px; + font-style: normal; + font-weight: normal; + line-height: 1.42857143; + text-align: left; + text-align: start; + text-decoration: none; + text-shadow: none; + text-transform: none; + letter-spacing: normal; + word-break: normal; + word-spacing: normal; + word-wrap: normal; + white-space: normal; + filter: alpha(opacity=0); + opacity: 0; + + line-break: auto; +} +.tooltip.in { + filter: alpha(opacity=90); + opacity: .9; +} +.tooltip.top { + padding: 5px 0; + margin-top: -3px; +} +.tooltip.right { + padding: 0 5px; + margin-left: 3px; +} +.tooltip.bottom { + padding: 5px 0; + margin-top: 3px; +} +.tooltip.left { + padding: 0 5px; + margin-left: -3px; +} +.tooltip-inner { + max-width: 200px; + padding: 3px 8px; + color: #fff; + text-align: center; + background-color: #000; + border-radius: 4px; +} +.tooltip-arrow { + position: absolute; + width: 0; + height: 0; + border-color: transparent; + border-style: solid; +} +.tooltip.top .tooltip-arrow { + bottom: 0; + left: 50%; + margin-left: -5px; + border-width: 5px 5px 0; + border-top-color: #000; +} +.tooltip.top-left .tooltip-arrow { + right: 5px; + bottom: 0; + margin-bottom: -5px; + border-width: 5px 5px 0; + border-top-color: #000; +} +.tooltip.top-right .tooltip-arrow { + bottom: 0; + left: 5px; + margin-bottom: -5px; + border-width: 5px 5px 0; + border-top-color: #000; +} +.tooltip.right .tooltip-arrow { + top: 50%; + left: 0; + margin-top: -5px; + border-width: 5px 5px 5px 0; + border-right-color: #000; +} +.tooltip.left .tooltip-arrow { + top: 50%; + right: 0; + margin-top: -5px; + border-width: 5px 0 5px 5px; + border-left-color: #000; +} +.tooltip.bottom .tooltip-arrow { + top: 0; + left: 50%; + margin-left: -5px; + border-width: 0 5px 5px; + border-bottom-color: #000; +} +.tooltip.bottom-left .tooltip-arrow { + top: 0; + right: 5px; + margin-top: -5px; + border-width: 0 5px 5px; + border-bottom-color: #000; +} +.tooltip.bottom-right .tooltip-arrow { + top: 0; + left: 5px; + margin-top: -5px; + border-width: 0 5px 5px; + border-bottom-color: #000; +} +.popover { + position: absolute; + top: 0; + left: 0; + z-index: 1060; + display: none; + max-width: 276px; + padding: 1px; + font-family: "Helvetica Neue", Helvetica, Arial, sans-serif; + font-size: 14px; + font-style: normal; + font-weight: normal; + line-height: 1.42857143; + text-align: left; + text-align: start; + text-decoration: none; + text-shadow: none; + text-transform: none; + letter-spacing: normal; + word-break: normal; + word-spacing: normal; + word-wrap: normal; + white-space: normal; + background-color: #fff; + -webkit-background-clip: padding-box; + background-clip: padding-box; + border: 1px solid #ccc; + border: 1px solid rgba(0, 0, 0, .2); + border-radius: 6px; + -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, .2); + box-shadow: 0 5px 10px rgba(0, 0, 0, .2); + + line-break: auto; +} +.popover.top { + margin-top: -10px; +} +.popover.right { + margin-left: 10px; +} +.popover.bottom { + margin-top: 10px; +} +.popover.left { + margin-left: -10px; +} +.popover-title { + padding: 8px 14px; + margin: 0; + font-size: 14px; + background-color: #f7f7f7; + border-bottom: 1px solid #ebebeb; + border-radius: 5px 5px 0 0; +} +.popover-content { + padding: 9px 14px; +} +.popover > .arrow, +.popover > .arrow:after { + position: absolute; + display: block; + width: 0; + height: 0; + border-color: transparent; + border-style: solid; +} +.popover > .arrow { + border-width: 11px; +} +.popover > .arrow:after { + content: ""; + border-width: 10px; +} +.popover.top > .arrow { + bottom: -11px; + left: 50%; + margin-left: -11px; + border-top-color: #999; + border-top-color: rgba(0, 0, 0, .25); + border-bottom-width: 0; +} +.popover.top > .arrow:after { + bottom: 1px; + margin-left: -10px; + content: " "; + border-top-color: #fff; + border-bottom-width: 0; +} +.popover.right > .arrow { + top: 50%; + left: -11px; + margin-top: -11px; + border-right-color: #999; + border-right-color: rgba(0, 0, 0, .25); + border-left-width: 0; +} +.popover.right > .arrow:after { + bottom: -10px; + left: 1px; + content: " "; + border-right-color: #fff; + border-left-width: 0; +} +.popover.bottom > .arrow { + top: -11px; + left: 50%; + margin-left: -11px; + border-top-width: 0; + border-bottom-color: #999; + border-bottom-color: rgba(0, 0, 0, .25); +} +.popover.bottom > .arrow:after { + top: 1px; + margin-left: -10px; + content: " "; + border-top-width: 0; + border-bottom-color: #fff; +} +.popover.left > .arrow { + top: 50%; + right: -11px; + margin-top: -11px; + border-right-width: 0; + border-left-color: #999; + border-left-color: rgba(0, 0, 0, .25); +} +.popover.left > .arrow:after { + right: 1px; + bottom: -10px; + content: " "; + border-right-width: 0; + border-left-color: #fff; +} +.carousel { + position: relative; +} +.carousel-inner { + position: relative; + width: 100%; + overflow: hidden; +} +.carousel-inner > .item { + position: relative; + display: none; + -webkit-transition: .6s ease-in-out left; + -o-transition: .6s ease-in-out left; + transition: .6s ease-in-out left; +} +.carousel-inner > .item > img, +.carousel-inner > .item > a > img { + line-height: 1; +} +@media all and (transform-3d), (-webkit-transform-3d) { + .carousel-inner > .item { + -webkit-transition: -webkit-transform .6s ease-in-out; + -o-transition: -o-transform .6s ease-in-out; + transition: transform .6s ease-in-out; + + -webkit-backface-visibility: hidden; + backface-visibility: hidden; + -webkit-perspective: 1000px; + perspective: 1000px; + } + .carousel-inner > .item.next, + .carousel-inner > .item.active.right { + left: 0; + -webkit-transform: translate3d(100%, 0, 0); + transform: translate3d(100%, 0, 0); + } + .carousel-inner > .item.prev, + .carousel-inner > .item.active.left { + left: 0; + -webkit-transform: translate3d(-100%, 0, 0); + transform: translate3d(-100%, 0, 0); + } + .carousel-inner > .item.next.left, + .carousel-inner > .item.prev.right, + .carousel-inner > .item.active { + left: 0; + -webkit-transform: translate3d(0, 0, 0); + transform: translate3d(0, 0, 0); + } +} +.carousel-inner > .active, +.carousel-inner > .next, +.carousel-inner > .prev { + display: block; +} +.carousel-inner > .active { + left: 0; +} +.carousel-inner > .next, +.carousel-inner > .prev { + position: absolute; + top: 0; + width: 100%; +} +.carousel-inner > .next { + left: 100%; +} +.carousel-inner > .prev { + left: -100%; +} +.carousel-inner > .next.left, +.carousel-inner > .prev.right { + left: 0; +} +.carousel-inner > .active.left { + left: -100%; +} +.carousel-inner > .active.right { + left: 100%; +} +.carousel-control { + position: absolute; + top: 0; + bottom: 0; + left: 0; + width: 15%; + font-size: 20px; + color: #fff; + text-align: center; + text-shadow: 0 1px 2px rgba(0, 0, 0, .6); + background-color: rgba(0, 0, 0, 0); + filter: alpha(opacity=50); + opacity: .5; +} +.carousel-control.left { + background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, .5) 0%, rgba(0, 0, 0, .0001) 100%); + background-image: -o-linear-gradient(left, rgba(0, 0, 0, .5) 0%, rgba(0, 0, 0, .0001) 100%); + background-image: -webkit-gradient(linear, left top, right top, from(rgba(0, 0, 0, .5)), to(rgba(0, 0, 0, .0001))); + background-image: linear-gradient(to right, rgba(0, 0, 0, .5) 0%, rgba(0, 0, 0, .0001) 100%); + filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1); + background-repeat: repeat-x; +} +.carousel-control.right { + right: 0; + left: auto; + background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, .0001) 0%, rgba(0, 0, 0, .5) 100%); + background-image: -o-linear-gradient(left, rgba(0, 0, 0, .0001) 0%, rgba(0, 0, 0, .5) 100%); + background-image: -webkit-gradient(linear, left top, right top, from(rgba(0, 0, 0, .0001)), to(rgba(0, 0, 0, .5))); + background-image: linear-gradient(to right, rgba(0, 0, 0, .0001) 0%, rgba(0, 0, 0, .5) 100%); + filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1); + background-repeat: repeat-x; +} +.carousel-control:hover, +.carousel-control:focus { + color: #fff; + text-decoration: none; + filter: alpha(opacity=90); + outline: 0; + opacity: .9; +} +.carousel-control .icon-prev, +.carousel-control .icon-next, +.carousel-control .glyphicon-chevron-left, +.carousel-control .glyphicon-chevron-right { + position: absolute; + top: 50%; + z-index: 5; + display: inline-block; + margin-top: -10px; +} +.carousel-control .icon-prev, +.carousel-control .glyphicon-chevron-left { + left: 50%; + margin-left: -10px; +} +.carousel-control .icon-next, +.carousel-control .glyphicon-chevron-right { + right: 50%; + margin-right: -10px; +} +.carousel-control .icon-prev, +.carousel-control .icon-next { + width: 20px; + height: 20px; + font-family: serif; + line-height: 1; +} +.carousel-control .icon-prev:before { + content: '\2039'; +} +.carousel-control .icon-next:before { + content: '\203a'; +} +.carousel-indicators { + position: absolute; + bottom: 10px; + left: 50%; + z-index: 15; + width: 60%; + padding-left: 0; + margin-left: -30%; + text-align: center; + list-style: none; +} +.carousel-indicators li { + display: inline-block; + width: 10px; + height: 10px; + margin: 1px; + text-indent: -999px; + cursor: pointer; + background-color: #000 \9; + background-color: rgba(0, 0, 0, 0); + border: 1px solid #fff; + border-radius: 10px; +} +.carousel-indicators .active { + width: 12px; + height: 12px; + margin: 0; + background-color: #fff; +} +.carousel-caption { + position: absolute; + right: 15%; + bottom: 20px; + left: 15%; + z-index: 10; + padding-top: 20px; + padding-bottom: 20px; + color: #fff; + text-align: center; + text-shadow: 0 1px 2px rgba(0, 0, 0, .6); +} +.carousel-caption .btn { + text-shadow: none; +} +@media screen and (min-width: 768px) { + .carousel-control .glyphicon-chevron-left, + .carousel-control .glyphicon-chevron-right, + .carousel-control .icon-prev, + .carousel-control .icon-next { + width: 30px; + height: 30px; + margin-top: -10px; + font-size: 30px; + } + .carousel-control .glyphicon-chevron-left, + .carousel-control .icon-prev { + margin-left: -10px; + } + .carousel-control .glyphicon-chevron-right, + .carousel-control .icon-next { + margin-right: -10px; + } + .carousel-caption { + right: 20%; + left: 20%; + padding-bottom: 30px; + } + .carousel-indicators { + bottom: 20px; + } +} +.clearfix:before, +.clearfix:after, +.dl-horizontal dd:before, +.dl-horizontal dd:after, +.container:before, +.container:after, +.container-fluid:before, +.container-fluid:after, +.row:before, +.row:after, +.form-horizontal .form-group:before, +.form-horizontal .form-group:after, +.btn-toolbar:before, +.btn-toolbar:after, +.btn-group-vertical > .btn-group:before, +.btn-group-vertical > .btn-group:after, +.nav:before, +.nav:after, +.navbar:before, +.navbar:after, +.navbar-header:before, +.navbar-header:after, +.navbar-collapse:before, +.navbar-collapse:after, +.pager:before, +.pager:after, +.panel-body:before, +.panel-body:after, +.modal-header:before, +.modal-header:after, +.modal-footer:before, +.modal-footer:after { + display: table; + content: " "; +} +.clearfix:after, +.dl-horizontal dd:after, +.container:after, +.container-fluid:after, +.row:after, +.form-horizontal .form-group:after, +.btn-toolbar:after, +.btn-group-vertical > .btn-group:after, +.nav:after, +.navbar:after, +.navbar-header:after, +.navbar-collapse:after, +.pager:after, +.panel-body:after, +.modal-header:after, +.modal-footer:after { + clear: both; +} +.center-block { + display: block; + margin-right: auto; + margin-left: auto; +} +.pull-right { + float: right !important; +} +.pull-left { + float: left !important; +} +.hide { + display: none !important; +} +.show { + display: block !important; +} +.invisible { + visibility: hidden; +} +.text-hide { + font: 0/0 a; + color: transparent; + text-shadow: none; + background-color: transparent; + border: 0; +} +.hidden { + display: none !important; +} +.affix { + position: fixed; +} +@-ms-viewport { + width: device-width; +} +.visible-xs, +.visible-sm, +.visible-md, +.visible-lg { + display: none !important; +} +.visible-xs-block, +.visible-xs-inline, +.visible-xs-inline-block, +.visible-sm-block, +.visible-sm-inline, +.visible-sm-inline-block, +.visible-md-block, +.visible-md-inline, +.visible-md-inline-block, +.visible-lg-block, +.visible-lg-inline, +.visible-lg-inline-block { + display: none !important; +} +@media (max-width: 767px) { + .visible-xs { + display: block !important; + } + table.visible-xs { + display: table !important; + } + tr.visible-xs { + display: table-row !important; + } + th.visible-xs, + td.visible-xs { + display: table-cell !important; + } +} +@media (max-width: 767px) { + .visible-xs-block { + display: block !important; + } +} +@media (max-width: 767px) { + .visible-xs-inline { + display: inline !important; + } +} +@media (max-width: 767px) { + .visible-xs-inline-block { + display: inline-block !important; + } +} +@media (min-width: 768px) and (max-width: 991px) { + .visible-sm { + display: block !important; + } + table.visible-sm { + display: table !important; + } + tr.visible-sm { + display: table-row !important; + } + th.visible-sm, + td.visible-sm { + display: table-cell !important; + } +} +@media (min-width: 768px) and (max-width: 991px) { + .visible-sm-block { + display: block !important; + } +} +@media (min-width: 768px) and (max-width: 991px) { + .visible-sm-inline { + display: inline !important; + } +} +@media (min-width: 768px) and (max-width: 991px) { + .visible-sm-inline-block { + display: inline-block !important; + } +} +@media (min-width: 992px) and (max-width: 1199px) { + .visible-md { + display: block !important; + } + table.visible-md { + display: table !important; + } + tr.visible-md { + display: table-row !important; + } + th.visible-md, + td.visible-md { + display: table-cell !important; + } +} +@media (min-width: 992px) and (max-width: 1199px) { + .visible-md-block { + display: block !important; + } +} +@media (min-width: 992px) and (max-width: 1199px) { + .visible-md-inline { + display: inline !important; + } +} +@media (min-width: 992px) and (max-width: 1199px) { + .visible-md-inline-block { + display: inline-block !important; + } +} +@media (min-width: 1200px) { + .visible-lg { + display: block !important; + } + table.visible-lg { + display: table !important; + } + tr.visible-lg { + display: table-row !important; + } + th.visible-lg, + td.visible-lg { + display: table-cell !important; + } +} +@media (min-width: 1200px) { + .visible-lg-block { + display: block !important; + } +} +@media (min-width: 1200px) { + .visible-lg-inline { + display: inline !important; + } +} +@media (min-width: 1200px) { + .visible-lg-inline-block { + display: inline-block !important; + } +} +@media (max-width: 767px) { + .hidden-xs { + display: none !important; + } +} +@media (min-width: 768px) and (max-width: 991px) { + .hidden-sm { + display: none !important; + } +} +@media (min-width: 992px) and (max-width: 1199px) { + .hidden-md { + display: none !important; + } +} +@media (min-width: 1200px) { + .hidden-lg { + display: none !important; + } +} +.visible-print { + display: none !important; +} +@media print { + .visible-print { + display: block !important; + } + table.visible-print { + display: table !important; + } + tr.visible-print { + display: table-row !important; + } + th.visible-print, + td.visible-print { + display: table-cell !important; + } +} +.visible-print-block { + display: none !important; +} +@media print { + .visible-print-block { + display: block !important; + } +} +.visible-print-inline { + display: none !important; +} +@media print { + .visible-print-inline { + display: inline !important; + } +} +.visible-print-inline-block { + display: none !important; +} +@media print { + .visible-print-inline-block { + display: inline-block !important; + } +} +@media print { + .hidden-print { + display: none !important; + } +} +/*# sourceMappingURL=bootstrap.css.map */ diff --git a/css/jumbotron.css b/src/static/css/custom.css similarity index 100% rename from css/jumbotron.css rename to src/static/css/custom.css diff --git a/fonts/glyphicons-halflings-regular.eot b/src/static/fonts/glyphicons-halflings-regular.eot similarity index 100% rename from fonts/glyphicons-halflings-regular.eot rename to src/static/fonts/glyphicons-halflings-regular.eot diff --git a/fonts/glyphicons-halflings-regular.svg b/src/static/fonts/glyphicons-halflings-regular.svg similarity index 100% rename from fonts/glyphicons-halflings-regular.svg rename to src/static/fonts/glyphicons-halflings-regular.svg diff --git a/fonts/glyphicons-halflings-regular.ttf b/src/static/fonts/glyphicons-halflings-regular.ttf similarity index 100% rename from fonts/glyphicons-halflings-regular.ttf rename to src/static/fonts/glyphicons-halflings-regular.ttf diff --git a/fonts/glyphicons-halflings-regular.woff b/src/static/fonts/glyphicons-halflings-regular.woff similarity index 100% rename from fonts/glyphicons-halflings-regular.woff rename to src/static/fonts/glyphicons-halflings-regular.woff diff --git a/fonts/glyphicons-halflings-regular.woff2 b/src/static/fonts/glyphicons-halflings-regular.woff2 similarity index 100% rename from fonts/glyphicons-halflings-regular.woff2 rename to src/static/fonts/glyphicons-halflings-regular.woff2 diff --git a/img/ada-lovelace.jpg b/src/static/img/ada-lovelace.jpg similarity index 100% rename from img/ada-lovelace.jpg rename to src/static/img/ada-lovelace.jpg diff --git a/img/favicon.png b/src/static/img/favicon.png similarity index 100% rename from img/favicon.png rename to src/static/img/favicon.png diff --git a/img/logo.png b/src/static/img/logo.png similarity index 100% rename from img/logo.png rename to src/static/img/logo.png diff --git a/src/static/js/bootstrap.js b/src/static/js/bootstrap.js new file mode 100644 index 0000000..8a2e99a --- /dev/null +++ b/src/static/js/bootstrap.js @@ -0,0 +1,2377 @@ +/*! + * Bootstrap v3.3.7 (http://getbootstrap.com) + * Copyright 2011-2016 Twitter, Inc. + * Licensed under the MIT license + */ + +if (typeof jQuery === 'undefined') { + throw new Error('Bootstrap\'s JavaScript requires jQuery') +} + ++function ($) { + 'use strict'; + var version = $.fn.jquery.split(' ')[0].split('.') + if ((version[0] < 2 && version[1] < 9) || (version[0] == 1 && version[1] == 9 && version[2] < 1) || (version[0] > 3)) { + throw new Error('Bootstrap\'s JavaScript requires jQuery version 1.9.1 or higher, but lower than version 4') + } +}(jQuery); + +/* ======================================================================== + * Bootstrap: transition.js v3.3.7 + * http://getbootstrap.com/javascript/#transitions + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // CSS TRANSITION SUPPORT (Shoutout: http://www.modernizr.com/) + // ============================================================ + + function transitionEnd() { + var el = document.createElement('bootstrap') + + var transEndEventNames = { + WebkitTransition : 'webkitTransitionEnd', + MozTransition : 'transitionend', + OTransition : 'oTransitionEnd otransitionend', + transition : 'transitionend' + } + + for (var name in transEndEventNames) { + if (el.style[name] !== undefined) { + return { end: transEndEventNames[name] } + } + } + + return false // explicit for ie8 ( ._.) + } + + // http://blog.alexmaccaw.com/css-transitions + $.fn.emulateTransitionEnd = function (duration) { + var called = false + var $el = this + $(this).one('bsTransitionEnd', function () { called = true }) + var callback = function () { if (!called) $($el).trigger($.support.transition.end) } + setTimeout(callback, duration) + return this + } + + $(function () { + $.support.transition = transitionEnd() + + if (!$.support.transition) return + + $.event.special.bsTransitionEnd = { + bindType: $.support.transition.end, + delegateType: $.support.transition.end, + handle: function (e) { + if ($(e.target).is(this)) return e.handleObj.handler.apply(this, arguments) + } + } + }) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: alert.js v3.3.7 + * http://getbootstrap.com/javascript/#alerts + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // ALERT CLASS DEFINITION + // ====================== + + var dismiss = '[data-dismiss="alert"]' + var Alert = function (el) { + $(el).on('click', dismiss, this.close) + } + + Alert.VERSION = '3.3.7' + + Alert.TRANSITION_DURATION = 150 + + Alert.prototype.close = function (e) { + var $this = $(this) + var selector = $this.attr('data-target') + + if (!selector) { + selector = $this.attr('href') + selector = selector && selector.replace(/.*(?=#[^\s]*$)/, '') // strip for ie7 + } + + var $parent = $(selector === '#' ? [] : selector) + + if (e) e.preventDefault() + + if (!$parent.length) { + $parent = $this.closest('.alert') + } + + $parent.trigger(e = $.Event('close.bs.alert')) + + if (e.isDefaultPrevented()) return + + $parent.removeClass('in') + + function removeElement() { + // detach from parent, fire event then clean up data + $parent.detach().trigger('closed.bs.alert').remove() + } + + $.support.transition && $parent.hasClass('fade') ? + $parent + .one('bsTransitionEnd', removeElement) + .emulateTransitionEnd(Alert.TRANSITION_DURATION) : + removeElement() + } + + + // ALERT PLUGIN DEFINITION + // ======================= + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.alert') + + if (!data) $this.data('bs.alert', (data = new Alert(this))) + if (typeof option == 'string') data[option].call($this) + }) + } + + var old = $.fn.alert + + $.fn.alert = Plugin + $.fn.alert.Constructor = Alert + + + // ALERT NO CONFLICT + // ================= + + $.fn.alert.noConflict = function () { + $.fn.alert = old + return this + } + + + // ALERT DATA-API + // ============== + + $(document).on('click.bs.alert.data-api', dismiss, Alert.prototype.close) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: button.js v3.3.7 + * http://getbootstrap.com/javascript/#buttons + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // BUTTON PUBLIC CLASS DEFINITION + // ============================== + + var Button = function (element, options) { + this.$element = $(element) + this.options = $.extend({}, Button.DEFAULTS, options) + this.isLoading = false + } + + Button.VERSION = '3.3.7' + + Button.DEFAULTS = { + loadingText: 'loading...' + } + + Button.prototype.setState = function (state) { + var d = 'disabled' + var $el = this.$element + var val = $el.is('input') ? 'val' : 'html' + var data = $el.data() + + state += 'Text' + + if (data.resetText == null) $el.data('resetText', $el[val]()) + + // push to event loop to allow forms to submit + setTimeout($.proxy(function () { + $el[val](data[state] == null ? this.options[state] : data[state]) + + if (state == 'loadingText') { + this.isLoading = true + $el.addClass(d).attr(d, d).prop(d, true) + } else if (this.isLoading) { + this.isLoading = false + $el.removeClass(d).removeAttr(d).prop(d, false) + } + }, this), 0) + } + + Button.prototype.toggle = function () { + var changed = true + var $parent = this.$element.closest('[data-toggle="buttons"]') + + if ($parent.length) { + var $input = this.$element.find('input') + if ($input.prop('type') == 'radio') { + if ($input.prop('checked')) changed = false + $parent.find('.active').removeClass('active') + this.$element.addClass('active') + } else if ($input.prop('type') == 'checkbox') { + if (($input.prop('checked')) !== this.$element.hasClass('active')) changed = false + this.$element.toggleClass('active') + } + $input.prop('checked', this.$element.hasClass('active')) + if (changed) $input.trigger('change') + } else { + this.$element.attr('aria-pressed', !this.$element.hasClass('active')) + this.$element.toggleClass('active') + } + } + + + // BUTTON PLUGIN DEFINITION + // ======================== + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.button') + var options = typeof option == 'object' && option + + if (!data) $this.data('bs.button', (data = new Button(this, options))) + + if (option == 'toggle') data.toggle() + else if (option) data.setState(option) + }) + } + + var old = $.fn.button + + $.fn.button = Plugin + $.fn.button.Constructor = Button + + + // BUTTON NO CONFLICT + // ================== + + $.fn.button.noConflict = function () { + $.fn.button = old + return this + } + + + // BUTTON DATA-API + // =============== + + $(document) + .on('click.bs.button.data-api', '[data-toggle^="button"]', function (e) { + var $btn = $(e.target).closest('.btn') + Plugin.call($btn, 'toggle') + if (!($(e.target).is('input[type="radio"], input[type="checkbox"]'))) { + // Prevent double click on radios, and the double selections (so cancellation) on checkboxes + e.preventDefault() + // The target component still receive the focus + if ($btn.is('input,button')) $btn.trigger('focus') + else $btn.find('input:visible,button:visible').first().trigger('focus') + } + }) + .on('focus.bs.button.data-api blur.bs.button.data-api', '[data-toggle^="button"]', function (e) { + $(e.target).closest('.btn').toggleClass('focus', /^focus(in)?$/.test(e.type)) + }) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: carousel.js v3.3.7 + * http://getbootstrap.com/javascript/#carousel + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // CAROUSEL CLASS DEFINITION + // ========================= + + var Carousel = function (element, options) { + this.$element = $(element) + this.$indicators = this.$element.find('.carousel-indicators') + this.options = options + this.paused = null + this.sliding = null + this.interval = null + this.$active = null + this.$items = null + + this.options.keyboard && this.$element.on('keydown.bs.carousel', $.proxy(this.keydown, this)) + + this.options.pause == 'hover' && !('ontouchstart' in document.documentElement) && this.$element + .on('mouseenter.bs.carousel', $.proxy(this.pause, this)) + .on('mouseleave.bs.carousel', $.proxy(this.cycle, this)) + } + + Carousel.VERSION = '3.3.7' + + Carousel.TRANSITION_DURATION = 600 + + Carousel.DEFAULTS = { + interval: 5000, + pause: 'hover', + wrap: true, + keyboard: true + } + + Carousel.prototype.keydown = function (e) { + if (/input|textarea/i.test(e.target.tagName)) return + switch (e.which) { + case 37: this.prev(); break + case 39: this.next(); break + default: return + } + + e.preventDefault() + } + + Carousel.prototype.cycle = function (e) { + e || (this.paused = false) + + this.interval && clearInterval(this.interval) + + this.options.interval + && !this.paused + && (this.interval = setInterval($.proxy(this.next, this), this.options.interval)) + + return this + } + + Carousel.prototype.getItemIndex = function (item) { + this.$items = item.parent().children('.item') + return this.$items.index(item || this.$active) + } + + Carousel.prototype.getItemForDirection = function (direction, active) { + var activeIndex = this.getItemIndex(active) + var willWrap = (direction == 'prev' && activeIndex === 0) + || (direction == 'next' && activeIndex == (this.$items.length - 1)) + if (willWrap && !this.options.wrap) return active + var delta = direction == 'prev' ? -1 : 1 + var itemIndex = (activeIndex + delta) % this.$items.length + return this.$items.eq(itemIndex) + } + + Carousel.prototype.to = function (pos) { + var that = this + var activeIndex = this.getItemIndex(this.$active = this.$element.find('.item.active')) + + if (pos > (this.$items.length - 1) || pos < 0) return + + if (this.sliding) return this.$element.one('slid.bs.carousel', function () { that.to(pos) }) // yes, "slid" + if (activeIndex == pos) return this.pause().cycle() + + return this.slide(pos > activeIndex ? 'next' : 'prev', this.$items.eq(pos)) + } + + Carousel.prototype.pause = function (e) { + e || (this.paused = true) + + if (this.$element.find('.next, .prev').length && $.support.transition) { + this.$element.trigger($.support.transition.end) + this.cycle(true) + } + + this.interval = clearInterval(this.interval) + + return this + } + + Carousel.prototype.next = function () { + if (this.sliding) return + return this.slide('next') + } + + Carousel.prototype.prev = function () { + if (this.sliding) return + return this.slide('prev') + } + + Carousel.prototype.slide = function (type, next) { + var $active = this.$element.find('.item.active') + var $next = next || this.getItemForDirection(type, $active) + var isCycling = this.interval + var direction = type == 'next' ? 'left' : 'right' + var that = this + + if ($next.hasClass('active')) return (this.sliding = false) + + var relatedTarget = $next[0] + var slideEvent = $.Event('slide.bs.carousel', { + relatedTarget: relatedTarget, + direction: direction + }) + this.$element.trigger(slideEvent) + if (slideEvent.isDefaultPrevented()) return + + this.sliding = true + + isCycling && this.pause() + + if (this.$indicators.length) { + this.$indicators.find('.active').removeClass('active') + var $nextIndicator = $(this.$indicators.children()[this.getItemIndex($next)]) + $nextIndicator && $nextIndicator.addClass('active') + } + + var slidEvent = $.Event('slid.bs.carousel', { relatedTarget: relatedTarget, direction: direction }) // yes, "slid" + if ($.support.transition && this.$element.hasClass('slide')) { + $next.addClass(type) + $next[0].offsetWidth // force reflow + $active.addClass(direction) + $next.addClass(direction) + $active + .one('bsTransitionEnd', function () { + $next.removeClass([type, direction].join(' ')).addClass('active') + $active.removeClass(['active', direction].join(' ')) + that.sliding = false + setTimeout(function () { + that.$element.trigger(slidEvent) + }, 0) + }) + .emulateTransitionEnd(Carousel.TRANSITION_DURATION) + } else { + $active.removeClass('active') + $next.addClass('active') + this.sliding = false + this.$element.trigger(slidEvent) + } + + isCycling && this.cycle() + + return this + } + + + // CAROUSEL PLUGIN DEFINITION + // ========================== + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.carousel') + var options = $.extend({}, Carousel.DEFAULTS, $this.data(), typeof option == 'object' && option) + var action = typeof option == 'string' ? option : options.slide + + if (!data) $this.data('bs.carousel', (data = new Carousel(this, options))) + if (typeof option == 'number') data.to(option) + else if (action) data[action]() + else if (options.interval) data.pause().cycle() + }) + } + + var old = $.fn.carousel + + $.fn.carousel = Plugin + $.fn.carousel.Constructor = Carousel + + + // CAROUSEL NO CONFLICT + // ==================== + + $.fn.carousel.noConflict = function () { + $.fn.carousel = old + return this + } + + + // CAROUSEL DATA-API + // ================= + + var clickHandler = function (e) { + var href + var $this = $(this) + var $target = $($this.attr('data-target') || (href = $this.attr('href')) && href.replace(/.*(?=#[^\s]+$)/, '')) // strip for ie7 + if (!$target.hasClass('carousel')) return + var options = $.extend({}, $target.data(), $this.data()) + var slideIndex = $this.attr('data-slide-to') + if (slideIndex) options.interval = false + + Plugin.call($target, options) + + if (slideIndex) { + $target.data('bs.carousel').to(slideIndex) + } + + e.preventDefault() + } + + $(document) + .on('click.bs.carousel.data-api', '[data-slide]', clickHandler) + .on('click.bs.carousel.data-api', '[data-slide-to]', clickHandler) + + $(window).on('load', function () { + $('[data-ride="carousel"]').each(function () { + var $carousel = $(this) + Plugin.call($carousel, $carousel.data()) + }) + }) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: collapse.js v3.3.7 + * http://getbootstrap.com/javascript/#collapse + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + +/* jshint latedef: false */ + ++function ($) { + 'use strict'; + + // COLLAPSE PUBLIC CLASS DEFINITION + // ================================ + + var Collapse = function (element, options) { + this.$element = $(element) + this.options = $.extend({}, Collapse.DEFAULTS, options) + this.$trigger = $('[data-toggle="collapse"][href="#' + element.id + '"],' + + '[data-toggle="collapse"][data-target="#' + element.id + '"]') + this.transitioning = null + + if (this.options.parent) { + this.$parent = this.getParent() + } else { + this.addAriaAndCollapsedClass(this.$element, this.$trigger) + } + + if (this.options.toggle) this.toggle() + } + + Collapse.VERSION = '3.3.7' + + Collapse.TRANSITION_DURATION = 350 + + Collapse.DEFAULTS = { + toggle: true + } + + Collapse.prototype.dimension = function () { + var hasWidth = this.$element.hasClass('width') + return hasWidth ? 'width' : 'height' + } + + Collapse.prototype.show = function () { + if (this.transitioning || this.$element.hasClass('in')) return + + var activesData + var actives = this.$parent && this.$parent.children('.panel').children('.in, .collapsing') + + if (actives && actives.length) { + activesData = actives.data('bs.collapse') + if (activesData && activesData.transitioning) return + } + + var startEvent = $.Event('show.bs.collapse') + this.$element.trigger(startEvent) + if (startEvent.isDefaultPrevented()) return + + if (actives && actives.length) { + Plugin.call(actives, 'hide') + activesData || actives.data('bs.collapse', null) + } + + var dimension = this.dimension() + + this.$element + .removeClass('collapse') + .addClass('collapsing')[dimension](0) + .attr('aria-expanded', true) + + this.$trigger + .removeClass('collapsed') + .attr('aria-expanded', true) + + this.transitioning = 1 + + var complete = function () { + this.$element + .removeClass('collapsing') + .addClass('collapse in')[dimension]('') + this.transitioning = 0 + this.$element + .trigger('shown.bs.collapse') + } + + if (!$.support.transition) return complete.call(this) + + var scrollSize = $.camelCase(['scroll', dimension].join('-')) + + this.$element + .one('bsTransitionEnd', $.proxy(complete, this)) + .emulateTransitionEnd(Collapse.TRANSITION_DURATION)[dimension](this.$element[0][scrollSize]) + } + + Collapse.prototype.hide = function () { + if (this.transitioning || !this.$element.hasClass('in')) return + + var startEvent = $.Event('hide.bs.collapse') + this.$element.trigger(startEvent) + if (startEvent.isDefaultPrevented()) return + + var dimension = this.dimension() + + this.$element[dimension](this.$element[dimension]())[0].offsetHeight + + this.$element + .addClass('collapsing') + .removeClass('collapse in') + .attr('aria-expanded', false) + + this.$trigger + .addClass('collapsed') + .attr('aria-expanded', false) + + this.transitioning = 1 + + var complete = function () { + this.transitioning = 0 + this.$element + .removeClass('collapsing') + .addClass('collapse') + .trigger('hidden.bs.collapse') + } + + if (!$.support.transition) return complete.call(this) + + this.$element + [dimension](0) + .one('bsTransitionEnd', $.proxy(complete, this)) + .emulateTransitionEnd(Collapse.TRANSITION_DURATION) + } + + Collapse.prototype.toggle = function () { + this[this.$element.hasClass('in') ? 'hide' : 'show']() + } + + Collapse.prototype.getParent = function () { + return $(this.options.parent) + .find('[data-toggle="collapse"][data-parent="' + this.options.parent + '"]') + .each($.proxy(function (i, element) { + var $element = $(element) + this.addAriaAndCollapsedClass(getTargetFromTrigger($element), $element) + }, this)) + .end() + } + + Collapse.prototype.addAriaAndCollapsedClass = function ($element, $trigger) { + var isOpen = $element.hasClass('in') + + $element.attr('aria-expanded', isOpen) + $trigger + .toggleClass('collapsed', !isOpen) + .attr('aria-expanded', isOpen) + } + + function getTargetFromTrigger($trigger) { + var href + var target = $trigger.attr('data-target') + || (href = $trigger.attr('href')) && href.replace(/.*(?=#[^\s]+$)/, '') // strip for ie7 + + return $(target) + } + + + // COLLAPSE PLUGIN DEFINITION + // ========================== + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.collapse') + var options = $.extend({}, Collapse.DEFAULTS, $this.data(), typeof option == 'object' && option) + + if (!data && options.toggle && /show|hide/.test(option)) options.toggle = false + if (!data) $this.data('bs.collapse', (data = new Collapse(this, options))) + if (typeof option == 'string') data[option]() + }) + } + + var old = $.fn.collapse + + $.fn.collapse = Plugin + $.fn.collapse.Constructor = Collapse + + + // COLLAPSE NO CONFLICT + // ==================== + + $.fn.collapse.noConflict = function () { + $.fn.collapse = old + return this + } + + + // COLLAPSE DATA-API + // ================= + + $(document).on('click.bs.collapse.data-api', '[data-toggle="collapse"]', function (e) { + var $this = $(this) + + if (!$this.attr('data-target')) e.preventDefault() + + var $target = getTargetFromTrigger($this) + var data = $target.data('bs.collapse') + var option = data ? 'toggle' : $this.data() + + Plugin.call($target, option) + }) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: dropdown.js v3.3.7 + * http://getbootstrap.com/javascript/#dropdowns + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // DROPDOWN CLASS DEFINITION + // ========================= + + var backdrop = '.dropdown-backdrop' + var toggle = '[data-toggle="dropdown"]' + var Dropdown = function (element) { + $(element).on('click.bs.dropdown', this.toggle) + } + + Dropdown.VERSION = '3.3.7' + + function getParent($this) { + var selector = $this.attr('data-target') + + if (!selector) { + selector = $this.attr('href') + selector = selector && /#[A-Za-z]/.test(selector) && selector.replace(/.*(?=#[^\s]*$)/, '') // strip for ie7 + } + + var $parent = selector && $(selector) + + return $parent && $parent.length ? $parent : $this.parent() + } + + function clearMenus(e) { + if (e && e.which === 3) return + $(backdrop).remove() + $(toggle).each(function () { + var $this = $(this) + var $parent = getParent($this) + var relatedTarget = { relatedTarget: this } + + if (!$parent.hasClass('open')) return + + if (e && e.type == 'click' && /input|textarea/i.test(e.target.tagName) && $.contains($parent[0], e.target)) return + + $parent.trigger(e = $.Event('hide.bs.dropdown', relatedTarget)) + + if (e.isDefaultPrevented()) return + + $this.attr('aria-expanded', 'false') + $parent.removeClass('open').trigger($.Event('hidden.bs.dropdown', relatedTarget)) + }) + } + + Dropdown.prototype.toggle = function (e) { + var $this = $(this) + + if ($this.is('.disabled, :disabled')) return + + var $parent = getParent($this) + var isActive = $parent.hasClass('open') + + clearMenus() + + if (!isActive) { + if ('ontouchstart' in document.documentElement && !$parent.closest('.navbar-nav').length) { + // if mobile we use a backdrop because click events don't delegate + $(document.createElement('div')) + .addClass('dropdown-backdrop') + .insertAfter($(this)) + .on('click', clearMenus) + } + + var relatedTarget = { relatedTarget: this } + $parent.trigger(e = $.Event('show.bs.dropdown', relatedTarget)) + + if (e.isDefaultPrevented()) return + + $this + .trigger('focus') + .attr('aria-expanded', 'true') + + $parent + .toggleClass('open') + .trigger($.Event('shown.bs.dropdown', relatedTarget)) + } + + return false + } + + Dropdown.prototype.keydown = function (e) { + if (!/(38|40|27|32)/.test(e.which) || /input|textarea/i.test(e.target.tagName)) return + + var $this = $(this) + + e.preventDefault() + e.stopPropagation() + + if ($this.is('.disabled, :disabled')) return + + var $parent = getParent($this) + var isActive = $parent.hasClass('open') + + if (!isActive && e.which != 27 || isActive && e.which == 27) { + if (e.which == 27) $parent.find(toggle).trigger('focus') + return $this.trigger('click') + } + + var desc = ' li:not(.disabled):visible a' + var $items = $parent.find('.dropdown-menu' + desc) + + if (!$items.length) return + + var index = $items.index(e.target) + + if (e.which == 38 && index > 0) index-- // up + if (e.which == 40 && index < $items.length - 1) index++ // down + if (!~index) index = 0 + + $items.eq(index).trigger('focus') + } + + + // DROPDOWN PLUGIN DEFINITION + // ========================== + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.dropdown') + + if (!data) $this.data('bs.dropdown', (data = new Dropdown(this))) + if (typeof option == 'string') data[option].call($this) + }) + } + + var old = $.fn.dropdown + + $.fn.dropdown = Plugin + $.fn.dropdown.Constructor = Dropdown + + + // DROPDOWN NO CONFLICT + // ==================== + + $.fn.dropdown.noConflict = function () { + $.fn.dropdown = old + return this + } + + + // APPLY TO STANDARD DROPDOWN ELEMENTS + // =================================== + + $(document) + .on('click.bs.dropdown.data-api', clearMenus) + .on('click.bs.dropdown.data-api', '.dropdown form', function (e) { e.stopPropagation() }) + .on('click.bs.dropdown.data-api', toggle, Dropdown.prototype.toggle) + .on('keydown.bs.dropdown.data-api', toggle, Dropdown.prototype.keydown) + .on('keydown.bs.dropdown.data-api', '.dropdown-menu', Dropdown.prototype.keydown) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: modal.js v3.3.7 + * http://getbootstrap.com/javascript/#modals + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // MODAL CLASS DEFINITION + // ====================== + + var Modal = function (element, options) { + this.options = options + this.$body = $(document.body) + this.$element = $(element) + this.$dialog = this.$element.find('.modal-dialog') + this.$backdrop = null + this.isShown = null + this.originalBodyPad = null + this.scrollbarWidth = 0 + this.ignoreBackdropClick = false + + if (this.options.remote) { + this.$element + .find('.modal-content') + .load(this.options.remote, $.proxy(function () { + this.$element.trigger('loaded.bs.modal') + }, this)) + } + } + + Modal.VERSION = '3.3.7' + + Modal.TRANSITION_DURATION = 300 + Modal.BACKDROP_TRANSITION_DURATION = 150 + + Modal.DEFAULTS = { + backdrop: true, + keyboard: true, + show: true + } + + Modal.prototype.toggle = function (_relatedTarget) { + return this.isShown ? this.hide() : this.show(_relatedTarget) + } + + Modal.prototype.show = function (_relatedTarget) { + var that = this + var e = $.Event('show.bs.modal', { relatedTarget: _relatedTarget }) + + this.$element.trigger(e) + + if (this.isShown || e.isDefaultPrevented()) return + + this.isShown = true + + this.checkScrollbar() + this.setScrollbar() + this.$body.addClass('modal-open') + + this.escape() + this.resize() + + this.$element.on('click.dismiss.bs.modal', '[data-dismiss="modal"]', $.proxy(this.hide, this)) + + this.$dialog.on('mousedown.dismiss.bs.modal', function () { + that.$element.one('mouseup.dismiss.bs.modal', function (e) { + if ($(e.target).is(that.$element)) that.ignoreBackdropClick = true + }) + }) + + this.backdrop(function () { + var transition = $.support.transition && that.$element.hasClass('fade') + + if (!that.$element.parent().length) { + that.$element.appendTo(that.$body) // don't move modals dom position + } + + that.$element + .show() + .scrollTop(0) + + that.adjustDialog() + + if (transition) { + that.$element[0].offsetWidth // force reflow + } + + that.$element.addClass('in') + + that.enforceFocus() + + var e = $.Event('shown.bs.modal', { relatedTarget: _relatedTarget }) + + transition ? + that.$dialog // wait for modal to slide in + .one('bsTransitionEnd', function () { + that.$element.trigger('focus').trigger(e) + }) + .emulateTransitionEnd(Modal.TRANSITION_DURATION) : + that.$element.trigger('focus').trigger(e) + }) + } + + Modal.prototype.hide = function (e) { + if (e) e.preventDefault() + + e = $.Event('hide.bs.modal') + + this.$element.trigger(e) + + if (!this.isShown || e.isDefaultPrevented()) return + + this.isShown = false + + this.escape() + this.resize() + + $(document).off('focusin.bs.modal') + + this.$element + .removeClass('in') + .off('click.dismiss.bs.modal') + .off('mouseup.dismiss.bs.modal') + + this.$dialog.off('mousedown.dismiss.bs.modal') + + $.support.transition && this.$element.hasClass('fade') ? + this.$element + .one('bsTransitionEnd', $.proxy(this.hideModal, this)) + .emulateTransitionEnd(Modal.TRANSITION_DURATION) : + this.hideModal() + } + + Modal.prototype.enforceFocus = function () { + $(document) + .off('focusin.bs.modal') // guard against infinite focus loop + .on('focusin.bs.modal', $.proxy(function (e) { + if (document !== e.target && + this.$element[0] !== e.target && + !this.$element.has(e.target).length) { + this.$element.trigger('focus') + } + }, this)) + } + + Modal.prototype.escape = function () { + if (this.isShown && this.options.keyboard) { + this.$element.on('keydown.dismiss.bs.modal', $.proxy(function (e) { + e.which == 27 && this.hide() + }, this)) + } else if (!this.isShown) { + this.$element.off('keydown.dismiss.bs.modal') + } + } + + Modal.prototype.resize = function () { + if (this.isShown) { + $(window).on('resize.bs.modal', $.proxy(this.handleUpdate, this)) + } else { + $(window).off('resize.bs.modal') + } + } + + Modal.prototype.hideModal = function () { + var that = this + this.$element.hide() + this.backdrop(function () { + that.$body.removeClass('modal-open') + that.resetAdjustments() + that.resetScrollbar() + that.$element.trigger('hidden.bs.modal') + }) + } + + Modal.prototype.removeBackdrop = function () { + this.$backdrop && this.$backdrop.remove() + this.$backdrop = null + } + + Modal.prototype.backdrop = function (callback) { + var that = this + var animate = this.$element.hasClass('fade') ? 'fade' : '' + + if (this.isShown && this.options.backdrop) { + var doAnimate = $.support.transition && animate + + this.$backdrop = $(document.createElement('div')) + .addClass('modal-backdrop ' + animate) + .appendTo(this.$body) + + this.$element.on('click.dismiss.bs.modal', $.proxy(function (e) { + if (this.ignoreBackdropClick) { + this.ignoreBackdropClick = false + return + } + if (e.target !== e.currentTarget) return + this.options.backdrop == 'static' + ? this.$element[0].focus() + : this.hide() + }, this)) + + if (doAnimate) this.$backdrop[0].offsetWidth // force reflow + + this.$backdrop.addClass('in') + + if (!callback) return + + doAnimate ? + this.$backdrop + .one('bsTransitionEnd', callback) + .emulateTransitionEnd(Modal.BACKDROP_TRANSITION_DURATION) : + callback() + + } else if (!this.isShown && this.$backdrop) { + this.$backdrop.removeClass('in') + + var callbackRemove = function () { + that.removeBackdrop() + callback && callback() + } + $.support.transition && this.$element.hasClass('fade') ? + this.$backdrop + .one('bsTransitionEnd', callbackRemove) + .emulateTransitionEnd(Modal.BACKDROP_TRANSITION_DURATION) : + callbackRemove() + + } else if (callback) { + callback() + } + } + + // these following methods are used to handle overflowing modals + + Modal.prototype.handleUpdate = function () { + this.adjustDialog() + } + + Modal.prototype.adjustDialog = function () { + var modalIsOverflowing = this.$element[0].scrollHeight > document.documentElement.clientHeight + + this.$element.css({ + paddingLeft: !this.bodyIsOverflowing && modalIsOverflowing ? this.scrollbarWidth : '', + paddingRight: this.bodyIsOverflowing && !modalIsOverflowing ? this.scrollbarWidth : '' + }) + } + + Modal.prototype.resetAdjustments = function () { + this.$element.css({ + paddingLeft: '', + paddingRight: '' + }) + } + + Modal.prototype.checkScrollbar = function () { + var fullWindowWidth = window.innerWidth + if (!fullWindowWidth) { // workaround for missing window.innerWidth in IE8 + var documentElementRect = document.documentElement.getBoundingClientRect() + fullWindowWidth = documentElementRect.right - Math.abs(documentElementRect.left) + } + this.bodyIsOverflowing = document.body.clientWidth < fullWindowWidth + this.scrollbarWidth = this.measureScrollbar() + } + + Modal.prototype.setScrollbar = function () { + var bodyPad = parseInt((this.$body.css('padding-right') || 0), 10) + this.originalBodyPad = document.body.style.paddingRight || '' + if (this.bodyIsOverflowing) this.$body.css('padding-right', bodyPad + this.scrollbarWidth) + } + + Modal.prototype.resetScrollbar = function () { + this.$body.css('padding-right', this.originalBodyPad) + } + + Modal.prototype.measureScrollbar = function () { // thx walsh + var scrollDiv = document.createElement('div') + scrollDiv.className = 'modal-scrollbar-measure' + this.$body.append(scrollDiv) + var scrollbarWidth = scrollDiv.offsetWidth - scrollDiv.clientWidth + this.$body[0].removeChild(scrollDiv) + return scrollbarWidth + } + + + // MODAL PLUGIN DEFINITION + // ======================= + + function Plugin(option, _relatedTarget) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.modal') + var options = $.extend({}, Modal.DEFAULTS, $this.data(), typeof option == 'object' && option) + + if (!data) $this.data('bs.modal', (data = new Modal(this, options))) + if (typeof option == 'string') data[option](_relatedTarget) + else if (options.show) data.show(_relatedTarget) + }) + } + + var old = $.fn.modal + + $.fn.modal = Plugin + $.fn.modal.Constructor = Modal + + + // MODAL NO CONFLICT + // ================= + + $.fn.modal.noConflict = function () { + $.fn.modal = old + return this + } + + + // MODAL DATA-API + // ============== + + $(document).on('click.bs.modal.data-api', '[data-toggle="modal"]', function (e) { + var $this = $(this) + var href = $this.attr('href') + var $target = $($this.attr('data-target') || (href && href.replace(/.*(?=#[^\s]+$)/, ''))) // strip for ie7 + var option = $target.data('bs.modal') ? 'toggle' : $.extend({ remote: !/#/.test(href) && href }, $target.data(), $this.data()) + + if ($this.is('a')) e.preventDefault() + + $target.one('show.bs.modal', function (showEvent) { + if (showEvent.isDefaultPrevented()) return // only register focus restorer if modal will actually get shown + $target.one('hidden.bs.modal', function () { + $this.is(':visible') && $this.trigger('focus') + }) + }) + Plugin.call($target, option, this) + }) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: tooltip.js v3.3.7 + * http://getbootstrap.com/javascript/#tooltip + * Inspired by the original jQuery.tipsy by Jason Frame + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // TOOLTIP PUBLIC CLASS DEFINITION + // =============================== + + var Tooltip = function (element, options) { + this.type = null + this.options = null + this.enabled = null + this.timeout = null + this.hoverState = null + this.$element = null + this.inState = null + + this.init('tooltip', element, options) + } + + Tooltip.VERSION = '3.3.7' + + Tooltip.TRANSITION_DURATION = 150 + + Tooltip.DEFAULTS = { + animation: true, + placement: 'top', + selector: false, + template: '', + trigger: 'hover focus', + title: '', + delay: 0, + html: false, + container: false, + viewport: { + selector: 'body', + padding: 0 + } + } + + Tooltip.prototype.init = function (type, element, options) { + this.enabled = true + this.type = type + this.$element = $(element) + this.options = this.getOptions(options) + this.$viewport = this.options.viewport && $($.isFunction(this.options.viewport) ? this.options.viewport.call(this, this.$element) : (this.options.viewport.selector || this.options.viewport)) + this.inState = { click: false, hover: false, focus: false } + + if (this.$element[0] instanceof document.constructor && !this.options.selector) { + throw new Error('`selector` option must be specified when initializing ' + this.type + ' on the window.document object!') + } + + var triggers = this.options.trigger.split(' ') + + for (var i = triggers.length; i--;) { + var trigger = triggers[i] + + if (trigger == 'click') { + this.$element.on('click.' + this.type, this.options.selector, $.proxy(this.toggle, this)) + } else if (trigger != 'manual') { + var eventIn = trigger == 'hover' ? 'mouseenter' : 'focusin' + var eventOut = trigger == 'hover' ? 'mouseleave' : 'focusout' + + this.$element.on(eventIn + '.' + this.type, this.options.selector, $.proxy(this.enter, this)) + this.$element.on(eventOut + '.' + this.type, this.options.selector, $.proxy(this.leave, this)) + } + } + + this.options.selector ? + (this._options = $.extend({}, this.options, { trigger: 'manual', selector: '' })) : + this.fixTitle() + } + + Tooltip.prototype.getDefaults = function () { + return Tooltip.DEFAULTS + } + + Tooltip.prototype.getOptions = function (options) { + options = $.extend({}, this.getDefaults(), this.$element.data(), options) + + if (options.delay && typeof options.delay == 'number') { + options.delay = { + show: options.delay, + hide: options.delay + } + } + + return options + } + + Tooltip.prototype.getDelegateOptions = function () { + var options = {} + var defaults = this.getDefaults() + + this._options && $.each(this._options, function (key, value) { + if (defaults[key] != value) options[key] = value + }) + + return options + } + + Tooltip.prototype.enter = function (obj) { + var self = obj instanceof this.constructor ? + obj : $(obj.currentTarget).data('bs.' + this.type) + + if (!self) { + self = new this.constructor(obj.currentTarget, this.getDelegateOptions()) + $(obj.currentTarget).data('bs.' + this.type, self) + } + + if (obj instanceof $.Event) { + self.inState[obj.type == 'focusin' ? 'focus' : 'hover'] = true + } + + if (self.tip().hasClass('in') || self.hoverState == 'in') { + self.hoverState = 'in' + return + } + + clearTimeout(self.timeout) + + self.hoverState = 'in' + + if (!self.options.delay || !self.options.delay.show) return self.show() + + self.timeout = setTimeout(function () { + if (self.hoverState == 'in') self.show() + }, self.options.delay.show) + } + + Tooltip.prototype.isInStateTrue = function () { + for (var key in this.inState) { + if (this.inState[key]) return true + } + + return false + } + + Tooltip.prototype.leave = function (obj) { + var self = obj instanceof this.constructor ? + obj : $(obj.currentTarget).data('bs.' + this.type) + + if (!self) { + self = new this.constructor(obj.currentTarget, this.getDelegateOptions()) + $(obj.currentTarget).data('bs.' + this.type, self) + } + + if (obj instanceof $.Event) { + self.inState[obj.type == 'focusout' ? 'focus' : 'hover'] = false + } + + if (self.isInStateTrue()) return + + clearTimeout(self.timeout) + + self.hoverState = 'out' + + if (!self.options.delay || !self.options.delay.hide) return self.hide() + + self.timeout = setTimeout(function () { + if (self.hoverState == 'out') self.hide() + }, self.options.delay.hide) + } + + Tooltip.prototype.show = function () { + var e = $.Event('show.bs.' + this.type) + + if (this.hasContent() && this.enabled) { + this.$element.trigger(e) + + var inDom = $.contains(this.$element[0].ownerDocument.documentElement, this.$element[0]) + if (e.isDefaultPrevented() || !inDom) return + var that = this + + var $tip = this.tip() + + var tipId = this.getUID(this.type) + + this.setContent() + $tip.attr('id', tipId) + this.$element.attr('aria-describedby', tipId) + + if (this.options.animation) $tip.addClass('fade') + + var placement = typeof this.options.placement == 'function' ? + this.options.placement.call(this, $tip[0], this.$element[0]) : + this.options.placement + + var autoToken = /\s?auto?\s?/i + var autoPlace = autoToken.test(placement) + if (autoPlace) placement = placement.replace(autoToken, '') || 'top' + + $tip + .detach() + .css({ top: 0, left: 0, display: 'block' }) + .addClass(placement) + .data('bs.' + this.type, this) + + this.options.container ? $tip.appendTo(this.options.container) : $tip.insertAfter(this.$element) + this.$element.trigger('inserted.bs.' + this.type) + + var pos = this.getPosition() + var actualWidth = $tip[0].offsetWidth + var actualHeight = $tip[0].offsetHeight + + if (autoPlace) { + var orgPlacement = placement + var viewportDim = this.getPosition(this.$viewport) + + placement = placement == 'bottom' && pos.bottom + actualHeight > viewportDim.bottom ? 'top' : + placement == 'top' && pos.top - actualHeight < viewportDim.top ? 'bottom' : + placement == 'right' && pos.right + actualWidth > viewportDim.width ? 'left' : + placement == 'left' && pos.left - actualWidth < viewportDim.left ? 'right' : + placement + + $tip + .removeClass(orgPlacement) + .addClass(placement) + } + + var calculatedOffset = this.getCalculatedOffset(placement, pos, actualWidth, actualHeight) + + this.applyPlacement(calculatedOffset, placement) + + var complete = function () { + var prevHoverState = that.hoverState + that.$element.trigger('shown.bs.' + that.type) + that.hoverState = null + + if (prevHoverState == 'out') that.leave(that) + } + + $.support.transition && this.$tip.hasClass('fade') ? + $tip + .one('bsTransitionEnd', complete) + .emulateTransitionEnd(Tooltip.TRANSITION_DURATION) : + complete() + } + } + + Tooltip.prototype.applyPlacement = function (offset, placement) { + var $tip = this.tip() + var width = $tip[0].offsetWidth + var height = $tip[0].offsetHeight + + // manually read margins because getBoundingClientRect includes difference + var marginTop = parseInt($tip.css('margin-top'), 10) + var marginLeft = parseInt($tip.css('margin-left'), 10) + + // we must check for NaN for ie 8/9 + if (isNaN(marginTop)) marginTop = 0 + if (isNaN(marginLeft)) marginLeft = 0 + + offset.top += marginTop + offset.left += marginLeft + + // $.fn.offset doesn't round pixel values + // so we use setOffset directly with our own function B-0 + $.offset.setOffset($tip[0], $.extend({ + using: function (props) { + $tip.css({ + top: Math.round(props.top), + left: Math.round(props.left) + }) + } + }, offset), 0) + + $tip.addClass('in') + + // check to see if placing tip in new offset caused the tip to resize itself + var actualWidth = $tip[0].offsetWidth + var actualHeight = $tip[0].offsetHeight + + if (placement == 'top' && actualHeight != height) { + offset.top = offset.top + height - actualHeight + } + + var delta = this.getViewportAdjustedDelta(placement, offset, actualWidth, actualHeight) + + if (delta.left) offset.left += delta.left + else offset.top += delta.top + + var isVertical = /top|bottom/.test(placement) + var arrowDelta = isVertical ? delta.left * 2 - width + actualWidth : delta.top * 2 - height + actualHeight + var arrowOffsetPosition = isVertical ? 'offsetWidth' : 'offsetHeight' + + $tip.offset(offset) + this.replaceArrow(arrowDelta, $tip[0][arrowOffsetPosition], isVertical) + } + + Tooltip.prototype.replaceArrow = function (delta, dimension, isVertical) { + this.arrow() + .css(isVertical ? 'left' : 'top', 50 * (1 - delta / dimension) + '%') + .css(isVertical ? 'top' : 'left', '') + } + + Tooltip.prototype.setContent = function () { + var $tip = this.tip() + var title = this.getTitle() + + $tip.find('.tooltip-inner')[this.options.html ? 'html' : 'text'](title) + $tip.removeClass('fade in top bottom left right') + } + + Tooltip.prototype.hide = function (callback) { + var that = this + var $tip = $(this.$tip) + var e = $.Event('hide.bs.' + this.type) + + function complete() { + if (that.hoverState != 'in') $tip.detach() + if (that.$element) { // TODO: Check whether guarding this code with this `if` is really necessary. + that.$element + .removeAttr('aria-describedby') + .trigger('hidden.bs.' + that.type) + } + callback && callback() + } + + this.$element.trigger(e) + + if (e.isDefaultPrevented()) return + + $tip.removeClass('in') + + $.support.transition && $tip.hasClass('fade') ? + $tip + .one('bsTransitionEnd', complete) + .emulateTransitionEnd(Tooltip.TRANSITION_DURATION) : + complete() + + this.hoverState = null + + return this + } + + Tooltip.prototype.fixTitle = function () { + var $e = this.$element + if ($e.attr('title') || typeof $e.attr('data-original-title') != 'string') { + $e.attr('data-original-title', $e.attr('title') || '').attr('title', '') + } + } + + Tooltip.prototype.hasContent = function () { + return this.getTitle() + } + + Tooltip.prototype.getPosition = function ($element) { + $element = $element || this.$element + + var el = $element[0] + var isBody = el.tagName == 'BODY' + + var elRect = el.getBoundingClientRect() + if (elRect.width == null) { + // width and height are missing in IE8, so compute them manually; see https://github.com/twbs/bootstrap/issues/14093 + elRect = $.extend({}, elRect, { width: elRect.right - elRect.left, height: elRect.bottom - elRect.top }) + } + var isSvg = window.SVGElement && el instanceof window.SVGElement + // Avoid using $.offset() on SVGs since it gives incorrect results in jQuery 3. + // See https://github.com/twbs/bootstrap/issues/20280 + var elOffset = isBody ? { top: 0, left: 0 } : (isSvg ? null : $element.offset()) + var scroll = { scroll: isBody ? document.documentElement.scrollTop || document.body.scrollTop : $element.scrollTop() } + var outerDims = isBody ? { width: $(window).width(), height: $(window).height() } : null + + return $.extend({}, elRect, scroll, outerDims, elOffset) + } + + Tooltip.prototype.getCalculatedOffset = function (placement, pos, actualWidth, actualHeight) { + return placement == 'bottom' ? { top: pos.top + pos.height, left: pos.left + pos.width / 2 - actualWidth / 2 } : + placement == 'top' ? { top: pos.top - actualHeight, left: pos.left + pos.width / 2 - actualWidth / 2 } : + placement == 'left' ? { top: pos.top + pos.height / 2 - actualHeight / 2, left: pos.left - actualWidth } : + /* placement == 'right' */ { top: pos.top + pos.height / 2 - actualHeight / 2, left: pos.left + pos.width } + + } + + Tooltip.prototype.getViewportAdjustedDelta = function (placement, pos, actualWidth, actualHeight) { + var delta = { top: 0, left: 0 } + if (!this.$viewport) return delta + + var viewportPadding = this.options.viewport && this.options.viewport.padding || 0 + var viewportDimensions = this.getPosition(this.$viewport) + + if (/right|left/.test(placement)) { + var topEdgeOffset = pos.top - viewportPadding - viewportDimensions.scroll + var bottomEdgeOffset = pos.top + viewportPadding - viewportDimensions.scroll + actualHeight + if (topEdgeOffset < viewportDimensions.top) { // top overflow + delta.top = viewportDimensions.top - topEdgeOffset + } else if (bottomEdgeOffset > viewportDimensions.top + viewportDimensions.height) { // bottom overflow + delta.top = viewportDimensions.top + viewportDimensions.height - bottomEdgeOffset + } + } else { + var leftEdgeOffset = pos.left - viewportPadding + var rightEdgeOffset = pos.left + viewportPadding + actualWidth + if (leftEdgeOffset < viewportDimensions.left) { // left overflow + delta.left = viewportDimensions.left - leftEdgeOffset + } else if (rightEdgeOffset > viewportDimensions.right) { // right overflow + delta.left = viewportDimensions.left + viewportDimensions.width - rightEdgeOffset + } + } + + return delta + } + + Tooltip.prototype.getTitle = function () { + var title + var $e = this.$element + var o = this.options + + title = $e.attr('data-original-title') + || (typeof o.title == 'function' ? o.title.call($e[0]) : o.title) + + return title + } + + Tooltip.prototype.getUID = function (prefix) { + do prefix += ~~(Math.random() * 1000000) + while (document.getElementById(prefix)) + return prefix + } + + Tooltip.prototype.tip = function () { + if (!this.$tip) { + this.$tip = $(this.options.template) + if (this.$tip.length != 1) { + throw new Error(this.type + ' `template` option must consist of exactly 1 top-level element!') + } + } + return this.$tip + } + + Tooltip.prototype.arrow = function () { + return (this.$arrow = this.$arrow || this.tip().find('.tooltip-arrow')) + } + + Tooltip.prototype.enable = function () { + this.enabled = true + } + + Tooltip.prototype.disable = function () { + this.enabled = false + } + + Tooltip.prototype.toggleEnabled = function () { + this.enabled = !this.enabled + } + + Tooltip.prototype.toggle = function (e) { + var self = this + if (e) { + self = $(e.currentTarget).data('bs.' + this.type) + if (!self) { + self = new this.constructor(e.currentTarget, this.getDelegateOptions()) + $(e.currentTarget).data('bs.' + this.type, self) + } + } + + if (e) { + self.inState.click = !self.inState.click + if (self.isInStateTrue()) self.enter(self) + else self.leave(self) + } else { + self.tip().hasClass('in') ? self.leave(self) : self.enter(self) + } + } + + Tooltip.prototype.destroy = function () { + var that = this + clearTimeout(this.timeout) + this.hide(function () { + that.$element.off('.' + that.type).removeData('bs.' + that.type) + if (that.$tip) { + that.$tip.detach() + } + that.$tip = null + that.$arrow = null + that.$viewport = null + that.$element = null + }) + } + + + // TOOLTIP PLUGIN DEFINITION + // ========================= + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.tooltip') + var options = typeof option == 'object' && option + + if (!data && /destroy|hide/.test(option)) return + if (!data) $this.data('bs.tooltip', (data = new Tooltip(this, options))) + if (typeof option == 'string') data[option]() + }) + } + + var old = $.fn.tooltip + + $.fn.tooltip = Plugin + $.fn.tooltip.Constructor = Tooltip + + + // TOOLTIP NO CONFLICT + // =================== + + $.fn.tooltip.noConflict = function () { + $.fn.tooltip = old + return this + } + +}(jQuery); + +/* ======================================================================== + * Bootstrap: popover.js v3.3.7 + * http://getbootstrap.com/javascript/#popovers + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // POPOVER PUBLIC CLASS DEFINITION + // =============================== + + var Popover = function (element, options) { + this.init('popover', element, options) + } + + if (!$.fn.tooltip) throw new Error('Popover requires tooltip.js') + + Popover.VERSION = '3.3.7' + + Popover.DEFAULTS = $.extend({}, $.fn.tooltip.Constructor.DEFAULTS, { + placement: 'right', + trigger: 'click', + content: '', + template: '' + }) + + + // NOTE: POPOVER EXTENDS tooltip.js + // ================================ + + Popover.prototype = $.extend({}, $.fn.tooltip.Constructor.prototype) + + Popover.prototype.constructor = Popover + + Popover.prototype.getDefaults = function () { + return Popover.DEFAULTS + } + + Popover.prototype.setContent = function () { + var $tip = this.tip() + var title = this.getTitle() + var content = this.getContent() + + $tip.find('.popover-title')[this.options.html ? 'html' : 'text'](title) + $tip.find('.popover-content').children().detach().end()[ // we use append for html objects to maintain js events + this.options.html ? (typeof content == 'string' ? 'html' : 'append') : 'text' + ](content) + + $tip.removeClass('fade top bottom left right in') + + // IE8 doesn't accept hiding via the `:empty` pseudo selector, we have to do + // this manually by checking the contents. + if (!$tip.find('.popover-title').html()) $tip.find('.popover-title').hide() + } + + Popover.prototype.hasContent = function () { + return this.getTitle() || this.getContent() + } + + Popover.prototype.getContent = function () { + var $e = this.$element + var o = this.options + + return $e.attr('data-content') + || (typeof o.content == 'function' ? + o.content.call($e[0]) : + o.content) + } + + Popover.prototype.arrow = function () { + return (this.$arrow = this.$arrow || this.tip().find('.arrow')) + } + + + // POPOVER PLUGIN DEFINITION + // ========================= + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.popover') + var options = typeof option == 'object' && option + + if (!data && /destroy|hide/.test(option)) return + if (!data) $this.data('bs.popover', (data = new Popover(this, options))) + if (typeof option == 'string') data[option]() + }) + } + + var old = $.fn.popover + + $.fn.popover = Plugin + $.fn.popover.Constructor = Popover + + + // POPOVER NO CONFLICT + // =================== + + $.fn.popover.noConflict = function () { + $.fn.popover = old + return this + } + +}(jQuery); + +/* ======================================================================== + * Bootstrap: scrollspy.js v3.3.7 + * http://getbootstrap.com/javascript/#scrollspy + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // SCROLLSPY CLASS DEFINITION + // ========================== + + function ScrollSpy(element, options) { + this.$body = $(document.body) + this.$scrollElement = $(element).is(document.body) ? $(window) : $(element) + this.options = $.extend({}, ScrollSpy.DEFAULTS, options) + this.selector = (this.options.target || '') + ' .nav li > a' + this.offsets = [] + this.targets = [] + this.activeTarget = null + this.scrollHeight = 0 + + this.$scrollElement.on('scroll.bs.scrollspy', $.proxy(this.process, this)) + this.refresh() + this.process() + } + + ScrollSpy.VERSION = '3.3.7' + + ScrollSpy.DEFAULTS = { + offset: 10 + } + + ScrollSpy.prototype.getScrollHeight = function () { + return this.$scrollElement[0].scrollHeight || Math.max(this.$body[0].scrollHeight, document.documentElement.scrollHeight) + } + + ScrollSpy.prototype.refresh = function () { + var that = this + var offsetMethod = 'offset' + var offsetBase = 0 + + this.offsets = [] + this.targets = [] + this.scrollHeight = this.getScrollHeight() + + if (!$.isWindow(this.$scrollElement[0])) { + offsetMethod = 'position' + offsetBase = this.$scrollElement.scrollTop() + } + + this.$body + .find(this.selector) + .map(function () { + var $el = $(this) + var href = $el.data('target') || $el.attr('href') + var $href = /^#./.test(href) && $(href) + + return ($href + && $href.length + && $href.is(':visible') + && [[$href[offsetMethod]().top + offsetBase, href]]) || null + }) + .sort(function (a, b) { return a[0] - b[0] }) + .each(function () { + that.offsets.push(this[0]) + that.targets.push(this[1]) + }) + } + + ScrollSpy.prototype.process = function () { + var scrollTop = this.$scrollElement.scrollTop() + this.options.offset + var scrollHeight = this.getScrollHeight() + var maxScroll = this.options.offset + scrollHeight - this.$scrollElement.height() + var offsets = this.offsets + var targets = this.targets + var activeTarget = this.activeTarget + var i + + if (this.scrollHeight != scrollHeight) { + this.refresh() + } + + if (scrollTop >= maxScroll) { + return activeTarget != (i = targets[targets.length - 1]) && this.activate(i) + } + + if (activeTarget && scrollTop < offsets[0]) { + this.activeTarget = null + return this.clear() + } + + for (i = offsets.length; i--;) { + activeTarget != targets[i] + && scrollTop >= offsets[i] + && (offsets[i + 1] === undefined || scrollTop < offsets[i + 1]) + && this.activate(targets[i]) + } + } + + ScrollSpy.prototype.activate = function (target) { + this.activeTarget = target + + this.clear() + + var selector = this.selector + + '[data-target="' + target + '"],' + + this.selector + '[href="' + target + '"]' + + var active = $(selector) + .parents('li') + .addClass('active') + + if (active.parent('.dropdown-menu').length) { + active = active + .closest('li.dropdown') + .addClass('active') + } + + active.trigger('activate.bs.scrollspy') + } + + ScrollSpy.prototype.clear = function () { + $(this.selector) + .parentsUntil(this.options.target, '.active') + .removeClass('active') + } + + + // SCROLLSPY PLUGIN DEFINITION + // =========================== + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.scrollspy') + var options = typeof option == 'object' && option + + if (!data) $this.data('bs.scrollspy', (data = new ScrollSpy(this, options))) + if (typeof option == 'string') data[option]() + }) + } + + var old = $.fn.scrollspy + + $.fn.scrollspy = Plugin + $.fn.scrollspy.Constructor = ScrollSpy + + + // SCROLLSPY NO CONFLICT + // ===================== + + $.fn.scrollspy.noConflict = function () { + $.fn.scrollspy = old + return this + } + + + // SCROLLSPY DATA-API + // ================== + + $(window).on('load.bs.scrollspy.data-api', function () { + $('[data-spy="scroll"]').each(function () { + var $spy = $(this) + Plugin.call($spy, $spy.data()) + }) + }) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: tab.js v3.3.7 + * http://getbootstrap.com/javascript/#tabs + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // TAB CLASS DEFINITION + // ==================== + + var Tab = function (element) { + // jscs:disable requireDollarBeforejQueryAssignment + this.element = $(element) + // jscs:enable requireDollarBeforejQueryAssignment + } + + Tab.VERSION = '3.3.7' + + Tab.TRANSITION_DURATION = 150 + + Tab.prototype.show = function () { + var $this = this.element + var $ul = $this.closest('ul:not(.dropdown-menu)') + var selector = $this.data('target') + + if (!selector) { + selector = $this.attr('href') + selector = selector && selector.replace(/.*(?=#[^\s]*$)/, '') // strip for ie7 + } + + if ($this.parent('li').hasClass('active')) return + + var $previous = $ul.find('.active:last a') + var hideEvent = $.Event('hide.bs.tab', { + relatedTarget: $this[0] + }) + var showEvent = $.Event('show.bs.tab', { + relatedTarget: $previous[0] + }) + + $previous.trigger(hideEvent) + $this.trigger(showEvent) + + if (showEvent.isDefaultPrevented() || hideEvent.isDefaultPrevented()) return + + var $target = $(selector) + + this.activate($this.closest('li'), $ul) + this.activate($target, $target.parent(), function () { + $previous.trigger({ + type: 'hidden.bs.tab', + relatedTarget: $this[0] + }) + $this.trigger({ + type: 'shown.bs.tab', + relatedTarget: $previous[0] + }) + }) + } + + Tab.prototype.activate = function (element, container, callback) { + var $active = container.find('> .active') + var transition = callback + && $.support.transition + && ($active.length && $active.hasClass('fade') || !!container.find('> .fade').length) + + function next() { + $active + .removeClass('active') + .find('> .dropdown-menu > .active') + .removeClass('active') + .end() + .find('[data-toggle="tab"]') + .attr('aria-expanded', false) + + element + .addClass('active') + .find('[data-toggle="tab"]') + .attr('aria-expanded', true) + + if (transition) { + element[0].offsetWidth // reflow for transition + element.addClass('in') + } else { + element.removeClass('fade') + } + + if (element.parent('.dropdown-menu').length) { + element + .closest('li.dropdown') + .addClass('active') + .end() + .find('[data-toggle="tab"]') + .attr('aria-expanded', true) + } + + callback && callback() + } + + $active.length && transition ? + $active + .one('bsTransitionEnd', next) + .emulateTransitionEnd(Tab.TRANSITION_DURATION) : + next() + + $active.removeClass('in') + } + + + // TAB PLUGIN DEFINITION + // ===================== + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.tab') + + if (!data) $this.data('bs.tab', (data = new Tab(this))) + if (typeof option == 'string') data[option]() + }) + } + + var old = $.fn.tab + + $.fn.tab = Plugin + $.fn.tab.Constructor = Tab + + + // TAB NO CONFLICT + // =============== + + $.fn.tab.noConflict = function () { + $.fn.tab = old + return this + } + + + // TAB DATA-API + // ============ + + var clickHandler = function (e) { + e.preventDefault() + Plugin.call($(this), 'show') + } + + $(document) + .on('click.bs.tab.data-api', '[data-toggle="tab"]', clickHandler) + .on('click.bs.tab.data-api', '[data-toggle="pill"]', clickHandler) + +}(jQuery); + +/* ======================================================================== + * Bootstrap: affix.js v3.3.7 + * http://getbootstrap.com/javascript/#affix + * ======================================================================== + * Copyright 2011-2016 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + * ======================================================================== */ + + ++function ($) { + 'use strict'; + + // AFFIX CLASS DEFINITION + // ====================== + + var Affix = function (element, options) { + this.options = $.extend({}, Affix.DEFAULTS, options) + + this.$target = $(this.options.target) + .on('scroll.bs.affix.data-api', $.proxy(this.checkPosition, this)) + .on('click.bs.affix.data-api', $.proxy(this.checkPositionWithEventLoop, this)) + + this.$element = $(element) + this.affixed = null + this.unpin = null + this.pinnedOffset = null + + this.checkPosition() + } + + Affix.VERSION = '3.3.7' + + Affix.RESET = 'affix affix-top affix-bottom' + + Affix.DEFAULTS = { + offset: 0, + target: window + } + + Affix.prototype.getState = function (scrollHeight, height, offsetTop, offsetBottom) { + var scrollTop = this.$target.scrollTop() + var position = this.$element.offset() + var targetHeight = this.$target.height() + + if (offsetTop != null && this.affixed == 'top') return scrollTop < offsetTop ? 'top' : false + + if (this.affixed == 'bottom') { + if (offsetTop != null) return (scrollTop + this.unpin <= position.top) ? false : 'bottom' + return (scrollTop + targetHeight <= scrollHeight - offsetBottom) ? false : 'bottom' + } + + var initializing = this.affixed == null + var colliderTop = initializing ? scrollTop : position.top + var colliderHeight = initializing ? targetHeight : height + + if (offsetTop != null && scrollTop <= offsetTop) return 'top' + if (offsetBottom != null && (colliderTop + colliderHeight >= scrollHeight - offsetBottom)) return 'bottom' + + return false + } + + Affix.prototype.getPinnedOffset = function () { + if (this.pinnedOffset) return this.pinnedOffset + this.$element.removeClass(Affix.RESET).addClass('affix') + var scrollTop = this.$target.scrollTop() + var position = this.$element.offset() + return (this.pinnedOffset = position.top - scrollTop) + } + + Affix.prototype.checkPositionWithEventLoop = function () { + setTimeout($.proxy(this.checkPosition, this), 1) + } + + Affix.prototype.checkPosition = function () { + if (!this.$element.is(':visible')) return + + var height = this.$element.height() + var offset = this.options.offset + var offsetTop = offset.top + var offsetBottom = offset.bottom + var scrollHeight = Math.max($(document).height(), $(document.body).height()) + + if (typeof offset != 'object') offsetBottom = offsetTop = offset + if (typeof offsetTop == 'function') offsetTop = offset.top(this.$element) + if (typeof offsetBottom == 'function') offsetBottom = offset.bottom(this.$element) + + var affix = this.getState(scrollHeight, height, offsetTop, offsetBottom) + + if (this.affixed != affix) { + if (this.unpin != null) this.$element.css('top', '') + + var affixType = 'affix' + (affix ? '-' + affix : '') + var e = $.Event(affixType + '.bs.affix') + + this.$element.trigger(e) + + if (e.isDefaultPrevented()) return + + this.affixed = affix + this.unpin = affix == 'bottom' ? this.getPinnedOffset() : null + + this.$element + .removeClass(Affix.RESET) + .addClass(affixType) + .trigger(affixType.replace('affix', 'affixed') + '.bs.affix') + } + + if (affix == 'bottom') { + this.$element.offset({ + top: scrollHeight - height - offsetBottom + }) + } + } + + + // AFFIX PLUGIN DEFINITION + // ======================= + + function Plugin(option) { + return this.each(function () { + var $this = $(this) + var data = $this.data('bs.affix') + var options = typeof option == 'object' && option + + if (!data) $this.data('bs.affix', (data = new Affix(this, options))) + if (typeof option == 'string') data[option]() + }) + } + + var old = $.fn.affix + + $.fn.affix = Plugin + $.fn.affix.Constructor = Affix + + + // AFFIX NO CONFLICT + // ================= + + $.fn.affix.noConflict = function () { + $.fn.affix = old + return this + } + + + // AFFIX DATA-API + // ============== + + $(window).on('load', function () { + $('[data-spy="affix"]').each(function () { + var $spy = $(this) + var data = $spy.data() + + data.offset = data.offset || {} + + if (data.offsetBottom != null) data.offset.bottom = data.offsetBottom + if (data.offsetTop != null) data.offset.top = data.offsetTop + + Plugin.call($spy, data) + }) + }) + +}(jQuery); diff --git a/src/static/js/jquery.js b/src/static/js/jquery.js new file mode 100644 index 0000000..072e308 --- /dev/null +++ b/src/static/js/jquery.js @@ -0,0 +1,10220 @@ +/*! + * jQuery JavaScript Library v3.1.1 + * https://jquery.com/ + * + * Includes Sizzle.js + * https://sizzlejs.com/ + * + * Copyright jQuery Foundation and other contributors + * Released under the MIT license + * https://jquery.org/license + * + * Date: 2016-09-22T22:30Z + */ +( function( global, factory ) { + + "use strict"; + + if ( typeof module === "object" && typeof module.exports === "object" ) { + + // For CommonJS and CommonJS-like environments where a proper `window` + // is present, execute the factory and get jQuery. + // For environments that do not have a `window` with a `document` + // (such as Node.js), expose a factory as module.exports. + // This accentuates the need for the creation of a real `window`. + // e.g. var jQuery = require("jquery")(window); + // See ticket #14549 for more info. + module.exports = global.document ? + factory( global, true ) : + function( w ) { + if ( !w.document ) { + throw new Error( "jQuery requires a window with a document" ); + } + return factory( w ); + }; + } else { + factory( global ); + } + +// Pass this if window is not defined yet +} )( typeof window !== "undefined" ? window : this, function( window, noGlobal ) { + +// Edge <= 12 - 13+, Firefox <=18 - 45+, IE 10 - 11, Safari 5.1 - 9+, iOS 6 - 9.1 +// throw exceptions when non-strict code (e.g., ASP.NET 4.5) accesses strict mode +// arguments.callee.caller (trac-13335). But as of jQuery 3.0 (2016), strict mode should be common +// enough that all such attempts are guarded in a try block. +"use strict"; + +var arr = []; + +var document = window.document; + +var getProto = Object.getPrototypeOf; + +var slice = arr.slice; + +var concat = arr.concat; + +var push = arr.push; + +var indexOf = arr.indexOf; + +var class2type = {}; + +var toString = class2type.toString; + +var hasOwn = class2type.hasOwnProperty; + +var fnToString = hasOwn.toString; + +var ObjectFunctionString = fnToString.call( Object ); + +var support = {}; + + + + function DOMEval( code, doc ) { + doc = doc || document; + + var script = doc.createElement( "script" ); + + script.text = code; + doc.head.appendChild( script ).parentNode.removeChild( script ); + } +/* global Symbol */ +// Defining this global in .eslintrc.json would create a danger of using the global +// unguarded in another place, it seems safer to define global only for this module + + + +var + version = "3.1.1", + + // Define a local copy of jQuery + jQuery = function( selector, context ) { + + // The jQuery object is actually just the init constructor 'enhanced' + // Need init if jQuery is called (just allow error to be thrown if not included) + return new jQuery.fn.init( selector, context ); + }, + + // Support: Android <=4.0 only + // Make sure we trim BOM and NBSP + rtrim = /^[\s\uFEFF\xA0]+|[\s\uFEFF\xA0]+$/g, + + // Matches dashed string for camelizing + rmsPrefix = /^-ms-/, + rdashAlpha = /-([a-z])/g, + + // Used by jQuery.camelCase as callback to replace() + fcamelCase = function( all, letter ) { + return letter.toUpperCase(); + }; + +jQuery.fn = jQuery.prototype = { + + // The current version of jQuery being used + jquery: version, + + constructor: jQuery, + + // The default length of a jQuery object is 0 + length: 0, + + toArray: function() { + return slice.call( this ); + }, + + // Get the Nth element in the matched element set OR + // Get the whole matched element set as a clean array + get: function( num ) { + + // Return all the elements in a clean array + if ( num == null ) { + return slice.call( this ); + } + + // Return just the one element from the set + return num < 0 ? this[ num + this.length ] : this[ num ]; + }, + + // Take an array of elements and push it onto the stack + // (returning the new matched element set) + pushStack: function( elems ) { + + // Build a new jQuery matched element set + var ret = jQuery.merge( this.constructor(), elems ); + + // Add the old object onto the stack (as a reference) + ret.prevObject = this; + + // Return the newly-formed element set + return ret; + }, + + // Execute a callback for every element in the matched set. + each: function( callback ) { + return jQuery.each( this, callback ); + }, + + map: function( callback ) { + return this.pushStack( jQuery.map( this, function( elem, i ) { + return callback.call( elem, i, elem ); + } ) ); + }, + + slice: function() { + return this.pushStack( slice.apply( this, arguments ) ); + }, + + first: function() { + return this.eq( 0 ); + }, + + last: function() { + return this.eq( -1 ); + }, + + eq: function( i ) { + var len = this.length, + j = +i + ( i < 0 ? len : 0 ); + return this.pushStack( j >= 0 && j < len ? [ this[ j ] ] : [] ); + }, + + end: function() { + return this.prevObject || this.constructor(); + }, + + // For internal use only. + // Behaves like an Array's method, not like a jQuery method. + push: push, + sort: arr.sort, + splice: arr.splice +}; + +jQuery.extend = jQuery.fn.extend = function() { + var options, name, src, copy, copyIsArray, clone, + target = arguments[ 0 ] || {}, + i = 1, + length = arguments.length, + deep = false; + + // Handle a deep copy situation + if ( typeof target === "boolean" ) { + deep = target; + + // Skip the boolean and the target + target = arguments[ i ] || {}; + i++; + } + + // Handle case when target is a string or something (possible in deep copy) + if ( typeof target !== "object" && !jQuery.isFunction( target ) ) { + target = {}; + } + + // Extend jQuery itself if only one argument is passed + if ( i === length ) { + target = this; + i--; + } + + for ( ; i < length; i++ ) { + + // Only deal with non-null/undefined values + if ( ( options = arguments[ i ] ) != null ) { + + // Extend the base object + for ( name in options ) { + src = target[ name ]; + copy = options[ name ]; + + // Prevent never-ending loop + if ( target === copy ) { + continue; + } + + // Recurse if we're merging plain objects or arrays + if ( deep && copy && ( jQuery.isPlainObject( copy ) || + ( copyIsArray = jQuery.isArray( copy ) ) ) ) { + + if ( copyIsArray ) { + copyIsArray = false; + clone = src && jQuery.isArray( src ) ? src : []; + + } else { + clone = src && jQuery.isPlainObject( src ) ? src : {}; + } + + // Never move original objects, clone them + target[ name ] = jQuery.extend( deep, clone, copy ); + + // Don't bring in undefined values + } else if ( copy !== undefined ) { + target[ name ] = copy; + } + } + } + } + + // Return the modified object + return target; +}; + +jQuery.extend( { + + // Unique for each copy of jQuery on the page + expando: "jQuery" + ( version + Math.random() ).replace( /\D/g, "" ), + + // Assume jQuery is ready without the ready module + isReady: true, + + error: function( msg ) { + throw new Error( msg ); + }, + + noop: function() {}, + + isFunction: function( obj ) { + return jQuery.type( obj ) === "function"; + }, + + isArray: Array.isArray, + + isWindow: function( obj ) { + return obj != null && obj === obj.window; + }, + + isNumeric: function( obj ) { + + // As of jQuery 3.0, isNumeric is limited to + // strings and numbers (primitives or objects) + // that can be coerced to finite numbers (gh-2662) + var type = jQuery.type( obj ); + return ( type === "number" || type === "string" ) && + + // parseFloat NaNs numeric-cast false positives ("") + // ...but misinterprets leading-number strings, particularly hex literals ("0x...") + // subtraction forces infinities to NaN + !isNaN( obj - parseFloat( obj ) ); + }, + + isPlainObject: function( obj ) { + var proto, Ctor; + + // Detect obvious negatives + // Use toString instead of jQuery.type to catch host objects + if ( !obj || toString.call( obj ) !== "[object Object]" ) { + return false; + } + + proto = getProto( obj ); + + // Objects with no prototype (e.g., `Object.create( null )`) are plain + if ( !proto ) { + return true; + } + + // Objects with prototype are plain iff they were constructed by a global Object function + Ctor = hasOwn.call( proto, "constructor" ) && proto.constructor; + return typeof Ctor === "function" && fnToString.call( Ctor ) === ObjectFunctionString; + }, + + isEmptyObject: function( obj ) { + + /* eslint-disable no-unused-vars */ + // See https://github.com/eslint/eslint/issues/6125 + var name; + + for ( name in obj ) { + return false; + } + return true; + }, + + type: function( obj ) { + if ( obj == null ) { + return obj + ""; + } + + // Support: Android <=2.3 only (functionish RegExp) + return typeof obj === "object" || typeof obj === "function" ? + class2type[ toString.call( obj ) ] || "object" : + typeof obj; + }, + + // Evaluates a script in a global context + globalEval: function( code ) { + DOMEval( code ); + }, + + // Convert dashed to camelCase; used by the css and data modules + // Support: IE <=9 - 11, Edge 12 - 13 + // Microsoft forgot to hump their vendor prefix (#9572) + camelCase: function( string ) { + return string.replace( rmsPrefix, "ms-" ).replace( rdashAlpha, fcamelCase ); + }, + + nodeName: function( elem, name ) { + return elem.nodeName && elem.nodeName.toLowerCase() === name.toLowerCase(); + }, + + each: function( obj, callback ) { + var length, i = 0; + + if ( isArrayLike( obj ) ) { + length = obj.length; + for ( ; i < length; i++ ) { + if ( callback.call( obj[ i ], i, obj[ i ] ) === false ) { + break; + } + } + } else { + for ( i in obj ) { + if ( callback.call( obj[ i ], i, obj[ i ] ) === false ) { + break; + } + } + } + + return obj; + }, + + // Support: Android <=4.0 only + trim: function( text ) { + return text == null ? + "" : + ( text + "" ).replace( rtrim, "" ); + }, + + // results is for internal usage only + makeArray: function( arr, results ) { + var ret = results || []; + + if ( arr != null ) { + if ( isArrayLike( Object( arr ) ) ) { + jQuery.merge( ret, + typeof arr === "string" ? + [ arr ] : arr + ); + } else { + push.call( ret, arr ); + } + } + + return ret; + }, + + inArray: function( elem, arr, i ) { + return arr == null ? -1 : indexOf.call( arr, elem, i ); + }, + + // Support: Android <=4.0 only, PhantomJS 1 only + // push.apply(_, arraylike) throws on ancient WebKit + merge: function( first, second ) { + var len = +second.length, + j = 0, + i = first.length; + + for ( ; j < len; j++ ) { + first[ i++ ] = second[ j ]; + } + + first.length = i; + + return first; + }, + + grep: function( elems, callback, invert ) { + var callbackInverse, + matches = [], + i = 0, + length = elems.length, + callbackExpect = !invert; + + // Go through the array, only saving the items + // that pass the validator function + for ( ; i < length; i++ ) { + callbackInverse = !callback( elems[ i ], i ); + if ( callbackInverse !== callbackExpect ) { + matches.push( elems[ i ] ); + } + } + + return matches; + }, + + // arg is for internal usage only + map: function( elems, callback, arg ) { + var length, value, + i = 0, + ret = []; + + // Go through the array, translating each of the items to their new values + if ( isArrayLike( elems ) ) { + length = elems.length; + for ( ; i < length; i++ ) { + value = callback( elems[ i ], i, arg ); + + if ( value != null ) { + ret.push( value ); + } + } + + // Go through every key on the object, + } else { + for ( i in elems ) { + value = callback( elems[ i ], i, arg ); + + if ( value != null ) { + ret.push( value ); + } + } + } + + // Flatten any nested arrays + return concat.apply( [], ret ); + }, + + // A global GUID counter for objects + guid: 1, + + // Bind a function to a context, optionally partially applying any + // arguments. + proxy: function( fn, context ) { + var tmp, args, proxy; + + if ( typeof context === "string" ) { + tmp = fn[ context ]; + context = fn; + fn = tmp; + } + + // Quick check to determine if target is callable, in the spec + // this throws a TypeError, but we will just return undefined. + if ( !jQuery.isFunction( fn ) ) { + return undefined; + } + + // Simulated bind + args = slice.call( arguments, 2 ); + proxy = function() { + return fn.apply( context || this, args.concat( slice.call( arguments ) ) ); + }; + + // Set the guid of unique handler to the same of original handler, so it can be removed + proxy.guid = fn.guid = fn.guid || jQuery.guid++; + + return proxy; + }, + + now: Date.now, + + // jQuery.support is not used in Core but other projects attach their + // properties to it so it needs to exist. + support: support +} ); + +if ( typeof Symbol === "function" ) { + jQuery.fn[ Symbol.iterator ] = arr[ Symbol.iterator ]; +} + +// Populate the class2type map +jQuery.each( "Boolean Number String Function Array Date RegExp Object Error Symbol".split( " " ), +function( i, name ) { + class2type[ "[object " + name + "]" ] = name.toLowerCase(); +} ); + +function isArrayLike( obj ) { + + // Support: real iOS 8.2 only (not reproducible in simulator) + // `in` check used to prevent JIT error (gh-2145) + // hasOwn isn't used here due to false negatives + // regarding Nodelist length in IE + var length = !!obj && "length" in obj && obj.length, + type = jQuery.type( obj ); + + if ( type === "function" || jQuery.isWindow( obj ) ) { + return false; + } + + return type === "array" || length === 0 || + typeof length === "number" && length > 0 && ( length - 1 ) in obj; +} +var Sizzle = +/*! + * Sizzle CSS Selector Engine v2.3.3 + * https://sizzlejs.com/ + * + * Copyright jQuery Foundation and other contributors + * Released under the MIT license + * http://jquery.org/license + * + * Date: 2016-08-08 + */ +(function( window ) { + +var i, + support, + Expr, + getText, + isXML, + tokenize, + compile, + select, + outermostContext, + sortInput, + hasDuplicate, + + // Local document vars + setDocument, + document, + docElem, + documentIsHTML, + rbuggyQSA, + rbuggyMatches, + matches, + contains, + + // Instance-specific data + expando = "sizzle" + 1 * new Date(), + preferredDoc = window.document, + dirruns = 0, + done = 0, + classCache = createCache(), + tokenCache = createCache(), + compilerCache = createCache(), + sortOrder = function( a, b ) { + if ( a === b ) { + hasDuplicate = true; + } + return 0; + }, + + // Instance methods + hasOwn = ({}).hasOwnProperty, + arr = [], + pop = arr.pop, + push_native = arr.push, + push = arr.push, + slice = arr.slice, + // Use a stripped-down indexOf as it's faster than native + // https://jsperf.com/thor-indexof-vs-for/5 + indexOf = function( list, elem ) { + var i = 0, + len = list.length; + for ( ; i < len; i++ ) { + if ( list[i] === elem ) { + return i; + } + } + return -1; + }, + + booleans = "checked|selected|async|autofocus|autoplay|controls|defer|disabled|hidden|ismap|loop|multiple|open|readonly|required|scoped", + + // Regular expressions + + // http://www.w3.org/TR/css3-selectors/#whitespace + whitespace = "[\\x20\\t\\r\\n\\f]", + + // http://www.w3.org/TR/CSS21/syndata.html#value-def-identifier + identifier = "(?:\\\\.|[\\w-]|[^\0-\\xa0])+", + + // Attribute selectors: http://www.w3.org/TR/selectors/#attribute-selectors + attributes = "\\[" + whitespace + "*(" + identifier + ")(?:" + whitespace + + // Operator (capture 2) + "*([*^$|!~]?=)" + whitespace + + // "Attribute values must be CSS identifiers [capture 5] or strings [capture 3 or capture 4]" + "*(?:'((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\"|(" + identifier + "))|)" + whitespace + + "*\\]", + + pseudos = ":(" + identifier + ")(?:\\((" + + // To reduce the number of selectors needing tokenize in the preFilter, prefer arguments: + // 1. quoted (capture 3; capture 4 or capture 5) + "('((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\")|" + + // 2. simple (capture 6) + "((?:\\\\.|[^\\\\()[\\]]|" + attributes + ")*)|" + + // 3. anything else (capture 2) + ".*" + + ")\\)|)", + + // Leading and non-escaped trailing whitespace, capturing some non-whitespace characters preceding the latter + rwhitespace = new RegExp( whitespace + "+", "g" ), + rtrim = new RegExp( "^" + whitespace + "+|((?:^|[^\\\\])(?:\\\\.)*)" + whitespace + "+$", "g" ), + + rcomma = new RegExp( "^" + whitespace + "*," + whitespace + "*" ), + rcombinators = new RegExp( "^" + whitespace + "*([>+~]|" + whitespace + ")" + whitespace + "*" ), + + rattributeQuotes = new RegExp( "=" + whitespace + "*([^\\]'\"]*?)" + whitespace + "*\\]", "g" ), + + rpseudo = new RegExp( pseudos ), + ridentifier = new RegExp( "^" + identifier + "$" ), + + matchExpr = { + "ID": new RegExp( "^#(" + identifier + ")" ), + "CLASS": new RegExp( "^\\.(" + identifier + ")" ), + "TAG": new RegExp( "^(" + identifier + "|[*])" ), + "ATTR": new RegExp( "^" + attributes ), + "PSEUDO": new RegExp( "^" + pseudos ), + "CHILD": new RegExp( "^:(only|first|last|nth|nth-last)-(child|of-type)(?:\\(" + whitespace + + "*(even|odd|(([+-]|)(\\d*)n|)" + whitespace + "*(?:([+-]|)" + whitespace + + "*(\\d+)|))" + whitespace + "*\\)|)", "i" ), + "bool": new RegExp( "^(?:" + booleans + ")$", "i" ), + // For use in libraries implementing .is() + // We use this for POS matching in `select` + "needsContext": new RegExp( "^" + whitespace + "*[>+~]|:(even|odd|eq|gt|lt|nth|first|last)(?:\\(" + + whitespace + "*((?:-\\d)?\\d*)" + whitespace + "*\\)|)(?=[^-]|$)", "i" ) + }, + + rinputs = /^(?:input|select|textarea|button)$/i, + rheader = /^h\d$/i, + + rnative = /^[^{]+\{\s*\[native \w/, + + // Easily-parseable/retrievable ID or TAG or CLASS selectors + rquickExpr = /^(?:#([\w-]+)|(\w+)|\.([\w-]+))$/, + + rsibling = /[+~]/, + + // CSS escapes + // http://www.w3.org/TR/CSS21/syndata.html#escaped-characters + runescape = new RegExp( "\\\\([\\da-f]{1,6}" + whitespace + "?|(" + whitespace + ")|.)", "ig" ), + funescape = function( _, escaped, escapedWhitespace ) { + var high = "0x" + escaped - 0x10000; + // NaN means non-codepoint + // Support: Firefox<24 + // Workaround erroneous numeric interpretation of +"0x" + return high !== high || escapedWhitespace ? + escaped : + high < 0 ? + // BMP codepoint + String.fromCharCode( high + 0x10000 ) : + // Supplemental Plane codepoint (surrogate pair) + String.fromCharCode( high >> 10 | 0xD800, high & 0x3FF | 0xDC00 ); + }, + + // CSS string/identifier serialization + // https://drafts.csswg.org/cssom/#common-serializing-idioms + rcssescape = /([\0-\x1f\x7f]|^-?\d)|^-$|[^\0-\x1f\x7f-\uFFFF\w-]/g, + fcssescape = function( ch, asCodePoint ) { + if ( asCodePoint ) { + + // U+0000 NULL becomes U+FFFD REPLACEMENT CHARACTER + if ( ch === "\0" ) { + return "\uFFFD"; + } + + // Control characters and (dependent upon position) numbers get escaped as code points + return ch.slice( 0, -1 ) + "\\" + ch.charCodeAt( ch.length - 1 ).toString( 16 ) + " "; + } + + // Other potentially-special ASCII characters get backslash-escaped + return "\\" + ch; + }, + + // Used for iframes + // See setDocument() + // Removing the function wrapper causes a "Permission Denied" + // error in IE + unloadHandler = function() { + setDocument(); + }, + + disabledAncestor = addCombinator( + function( elem ) { + return elem.disabled === true && ("form" in elem || "label" in elem); + }, + { dir: "parentNode", next: "legend" } + ); + +// Optimize for push.apply( _, NodeList ) +try { + push.apply( + (arr = slice.call( preferredDoc.childNodes )), + preferredDoc.childNodes + ); + // Support: Android<4.0 + // Detect silently failing push.apply + arr[ preferredDoc.childNodes.length ].nodeType; +} catch ( e ) { + push = { apply: arr.length ? + + // Leverage slice if possible + function( target, els ) { + push_native.apply( target, slice.call(els) ); + } : + + // Support: IE<9 + // Otherwise append directly + function( target, els ) { + var j = target.length, + i = 0; + // Can't trust NodeList.length + while ( (target[j++] = els[i++]) ) {} + target.length = j - 1; + } + }; +} + +function Sizzle( selector, context, results, seed ) { + var m, i, elem, nid, match, groups, newSelector, + newContext = context && context.ownerDocument, + + // nodeType defaults to 9, since context defaults to document + nodeType = context ? context.nodeType : 9; + + results = results || []; + + // Return early from calls with invalid selector or context + if ( typeof selector !== "string" || !selector || + nodeType !== 1 && nodeType !== 9 && nodeType !== 11 ) { + + return results; + } + + // Try to shortcut find operations (as opposed to filters) in HTML documents + if ( !seed ) { + + if ( ( context ? context.ownerDocument || context : preferredDoc ) !== document ) { + setDocument( context ); + } + context = context || document; + + if ( documentIsHTML ) { + + // If the selector is sufficiently simple, try using a "get*By*" DOM method + // (excepting DocumentFragment context, where the methods don't exist) + if ( nodeType !== 11 && (match = rquickExpr.exec( selector )) ) { + + // ID selector + if ( (m = match[1]) ) { + + // Document context + if ( nodeType === 9 ) { + if ( (elem = context.getElementById( m )) ) { + + // Support: IE, Opera, Webkit + // TODO: identify versions + // getElementById can match elements by name instead of ID + if ( elem.id === m ) { + results.push( elem ); + return results; + } + } else { + return results; + } + + // Element context + } else { + + // Support: IE, Opera, Webkit + // TODO: identify versions + // getElementById can match elements by name instead of ID + if ( newContext && (elem = newContext.getElementById( m )) && + contains( context, elem ) && + elem.id === m ) { + + results.push( elem ); + return results; + } + } + + // Type selector + } else if ( match[2] ) { + push.apply( results, context.getElementsByTagName( selector ) ); + return results; + + // Class selector + } else if ( (m = match[3]) && support.getElementsByClassName && + context.getElementsByClassName ) { + + push.apply( results, context.getElementsByClassName( m ) ); + return results; + } + } + + // Take advantage of querySelectorAll + if ( support.qsa && + !compilerCache[ selector + " " ] && + (!rbuggyQSA || !rbuggyQSA.test( selector )) ) { + + if ( nodeType !== 1 ) { + newContext = context; + newSelector = selector; + + // qSA looks outside Element context, which is not what we want + // Thanks to Andrew Dupont for this workaround technique + // Support: IE <=8 + // Exclude object elements + } else if ( context.nodeName.toLowerCase() !== "object" ) { + + // Capture the context ID, setting it first if necessary + if ( (nid = context.getAttribute( "id" )) ) { + nid = nid.replace( rcssescape, fcssescape ); + } else { + context.setAttribute( "id", (nid = expando) ); + } + + // Prefix every selector in the list + groups = tokenize( selector ); + i = groups.length; + while ( i-- ) { + groups[i] = "#" + nid + " " + toSelector( groups[i] ); + } + newSelector = groups.join( "," ); + + // Expand context for sibling selectors + newContext = rsibling.test( selector ) && testContext( context.parentNode ) || + context; + } + + if ( newSelector ) { + try { + push.apply( results, + newContext.querySelectorAll( newSelector ) + ); + return results; + } catch ( qsaError ) { + } finally { + if ( nid === expando ) { + context.removeAttribute( "id" ); + } + } + } + } + } + } + + // All others + return select( selector.replace( rtrim, "$1" ), context, results, seed ); +} + +/** + * Create key-value caches of limited size + * @returns {function(string, object)} Returns the Object data after storing it on itself with + * property name the (space-suffixed) string and (if the cache is larger than Expr.cacheLength) + * deleting the oldest entry + */ +function createCache() { + var keys = []; + + function cache( key, value ) { + // Use (key + " ") to avoid collision with native prototype properties (see Issue #157) + if ( keys.push( key + " " ) > Expr.cacheLength ) { + // Only keep the most recent entries + delete cache[ keys.shift() ]; + } + return (cache[ key + " " ] = value); + } + return cache; +} + +/** + * Mark a function for special use by Sizzle + * @param {Function} fn The function to mark + */ +function markFunction( fn ) { + fn[ expando ] = true; + return fn; +} + +/** + * Support testing using an element + * @param {Function} fn Passed the created element and returns a boolean result + */ +function assert( fn ) { + var el = document.createElement("fieldset"); + + try { + return !!fn( el ); + } catch (e) { + return false; + } finally { + // Remove from its parent by default + if ( el.parentNode ) { + el.parentNode.removeChild( el ); + } + // release memory in IE + el = null; + } +} + +/** + * Adds the same handler for all of the specified attrs + * @param {String} attrs Pipe-separated list of attributes + * @param {Function} handler The method that will be applied + */ +function addHandle( attrs, handler ) { + var arr = attrs.split("|"), + i = arr.length; + + while ( i-- ) { + Expr.attrHandle[ arr[i] ] = handler; + } +} + +/** + * Checks document order of two siblings + * @param {Element} a + * @param {Element} b + * @returns {Number} Returns less than 0 if a precedes b, greater than 0 if a follows b + */ +function siblingCheck( a, b ) { + var cur = b && a, + diff = cur && a.nodeType === 1 && b.nodeType === 1 && + a.sourceIndex - b.sourceIndex; + + // Use IE sourceIndex if available on both nodes + if ( diff ) { + return diff; + } + + // Check if b follows a + if ( cur ) { + while ( (cur = cur.nextSibling) ) { + if ( cur === b ) { + return -1; + } + } + } + + return a ? 1 : -1; +} + +/** + * Returns a function to use in pseudos for input types + * @param {String} type + */ +function createInputPseudo( type ) { + return function( elem ) { + var name = elem.nodeName.toLowerCase(); + return name === "input" && elem.type === type; + }; +} + +/** + * Returns a function to use in pseudos for buttons + * @param {String} type + */ +function createButtonPseudo( type ) { + return function( elem ) { + var name = elem.nodeName.toLowerCase(); + return (name === "input" || name === "button") && elem.type === type; + }; +} + +/** + * Returns a function to use in pseudos for :enabled/:disabled + * @param {Boolean} disabled true for :disabled; false for :enabled + */ +function createDisabledPseudo( disabled ) { + + // Known :disabled false positives: fieldset[disabled] > legend:nth-of-type(n+2) :can-disable + return function( elem ) { + + // Only certain elements can match :enabled or :disabled + // https://html.spec.whatwg.org/multipage/scripting.html#selector-enabled + // https://html.spec.whatwg.org/multipage/scripting.html#selector-disabled + if ( "form" in elem ) { + + // Check for inherited disabledness on relevant non-disabled elements: + // * listed form-associated elements in a disabled fieldset + // https://html.spec.whatwg.org/multipage/forms.html#category-listed + // https://html.spec.whatwg.org/multipage/forms.html#concept-fe-disabled + // * option elements in a disabled optgroup + // https://html.spec.whatwg.org/multipage/forms.html#concept-option-disabled + // All such elements have a "form" property. + if ( elem.parentNode && elem.disabled === false ) { + + // Option elements defer to a parent optgroup if present + if ( "label" in elem ) { + if ( "label" in elem.parentNode ) { + return elem.parentNode.disabled === disabled; + } else { + return elem.disabled === disabled; + } + } + + // Support: IE 6 - 11 + // Use the isDisabled shortcut property to check for disabled fieldset ancestors + return elem.isDisabled === disabled || + + // Where there is no isDisabled, check manually + /* jshint -W018 */ + elem.isDisabled !== !disabled && + disabledAncestor( elem ) === disabled; + } + + return elem.disabled === disabled; + + // Try to winnow out elements that can't be disabled before trusting the disabled property. + // Some victims get caught in our net (label, legend, menu, track), but it shouldn't + // even exist on them, let alone have a boolean value. + } else if ( "label" in elem ) { + return elem.disabled === disabled; + } + + // Remaining elements are neither :enabled nor :disabled + return false; + }; +} + +/** + * Returns a function to use in pseudos for positionals + * @param {Function} fn + */ +function createPositionalPseudo( fn ) { + return markFunction(function( argument ) { + argument = +argument; + return markFunction(function( seed, matches ) { + var j, + matchIndexes = fn( [], seed.length, argument ), + i = matchIndexes.length; + + // Match elements found at the specified indexes + while ( i-- ) { + if ( seed[ (j = matchIndexes[i]) ] ) { + seed[j] = !(matches[j] = seed[j]); + } + } + }); + }); +} + +/** + * Checks a node for validity as a Sizzle context + * @param {Element|Object=} context + * @returns {Element|Object|Boolean} The input node if acceptable, otherwise a falsy value + */ +function testContext( context ) { + return context && typeof context.getElementsByTagName !== "undefined" && context; +} + +// Expose support vars for convenience +support = Sizzle.support = {}; + +/** + * Detects XML nodes + * @param {Element|Object} elem An element or a document + * @returns {Boolean} True iff elem is a non-HTML XML node + */ +isXML = Sizzle.isXML = function( elem ) { + // documentElement is verified for cases where it doesn't yet exist + // (such as loading iframes in IE - #4833) + var documentElement = elem && (elem.ownerDocument || elem).documentElement; + return documentElement ? documentElement.nodeName !== "HTML" : false; +}; + +/** + * Sets document-related variables once based on the current document + * @param {Element|Object} [doc] An element or document object to use to set the document + * @returns {Object} Returns the current document + */ +setDocument = Sizzle.setDocument = function( node ) { + var hasCompare, subWindow, + doc = node ? node.ownerDocument || node : preferredDoc; + + // Return early if doc is invalid or already selected + if ( doc === document || doc.nodeType !== 9 || !doc.documentElement ) { + return document; + } + + // Update global variables + document = doc; + docElem = document.documentElement; + documentIsHTML = !isXML( document ); + + // Support: IE 9-11, Edge + // Accessing iframe documents after unload throws "permission denied" errors (jQuery #13936) + if ( preferredDoc !== document && + (subWindow = document.defaultView) && subWindow.top !== subWindow ) { + + // Support: IE 11, Edge + if ( subWindow.addEventListener ) { + subWindow.addEventListener( "unload", unloadHandler, false ); + + // Support: IE 9 - 10 only + } else if ( subWindow.attachEvent ) { + subWindow.attachEvent( "onunload", unloadHandler ); + } + } + + /* Attributes + ---------------------------------------------------------------------- */ + + // Support: IE<8 + // Verify that getAttribute really returns attributes and not properties + // (excepting IE8 booleans) + support.attributes = assert(function( el ) { + el.className = "i"; + return !el.getAttribute("className"); + }); + + /* getElement(s)By* + ---------------------------------------------------------------------- */ + + // Check if getElementsByTagName("*") returns only elements + support.getElementsByTagName = assert(function( el ) { + el.appendChild( document.createComment("") ); + return !el.getElementsByTagName("*").length; + }); + + // Support: IE<9 + support.getElementsByClassName = rnative.test( document.getElementsByClassName ); + + // Support: IE<10 + // Check if getElementById returns elements by name + // The broken getElementById methods don't pick up programmatically-set names, + // so use a roundabout getElementsByName test + support.getById = assert(function( el ) { + docElem.appendChild( el ).id = expando; + return !document.getElementsByName || !document.getElementsByName( expando ).length; + }); + + // ID filter and find + if ( support.getById ) { + Expr.filter["ID"] = function( id ) { + var attrId = id.replace( runescape, funescape ); + return function( elem ) { + return elem.getAttribute("id") === attrId; + }; + }; + Expr.find["ID"] = function( id, context ) { + if ( typeof context.getElementById !== "undefined" && documentIsHTML ) { + var elem = context.getElementById( id ); + return elem ? [ elem ] : []; + } + }; + } else { + Expr.filter["ID"] = function( id ) { + var attrId = id.replace( runescape, funescape ); + return function( elem ) { + var node = typeof elem.getAttributeNode !== "undefined" && + elem.getAttributeNode("id"); + return node && node.value === attrId; + }; + }; + + // Support: IE 6 - 7 only + // getElementById is not reliable as a find shortcut + Expr.find["ID"] = function( id, context ) { + if ( typeof context.getElementById !== "undefined" && documentIsHTML ) { + var node, i, elems, + elem = context.getElementById( id ); + + if ( elem ) { + + // Verify the id attribute + node = elem.getAttributeNode("id"); + if ( node && node.value === id ) { + return [ elem ]; + } + + // Fall back on getElementsByName + elems = context.getElementsByName( id ); + i = 0; + while ( (elem = elems[i++]) ) { + node = elem.getAttributeNode("id"); + if ( node && node.value === id ) { + return [ elem ]; + } + } + } + + return []; + } + }; + } + + // Tag + Expr.find["TAG"] = support.getElementsByTagName ? + function( tag, context ) { + if ( typeof context.getElementsByTagName !== "undefined" ) { + return context.getElementsByTagName( tag ); + + // DocumentFragment nodes don't have gEBTN + } else if ( support.qsa ) { + return context.querySelectorAll( tag ); + } + } : + + function( tag, context ) { + var elem, + tmp = [], + i = 0, + // By happy coincidence, a (broken) gEBTN appears on DocumentFragment nodes too + results = context.getElementsByTagName( tag ); + + // Filter out possible comments + if ( tag === "*" ) { + while ( (elem = results[i++]) ) { + if ( elem.nodeType === 1 ) { + tmp.push( elem ); + } + } + + return tmp; + } + return results; + }; + + // Class + Expr.find["CLASS"] = support.getElementsByClassName && function( className, context ) { + if ( typeof context.getElementsByClassName !== "undefined" && documentIsHTML ) { + return context.getElementsByClassName( className ); + } + }; + + /* QSA/matchesSelector + ---------------------------------------------------------------------- */ + + // QSA and matchesSelector support + + // matchesSelector(:active) reports false when true (IE9/Opera 11.5) + rbuggyMatches = []; + + // qSa(:focus) reports false when true (Chrome 21) + // We allow this because of a bug in IE8/9 that throws an error + // whenever `document.activeElement` is accessed on an iframe + // So, we allow :focus to pass through QSA all the time to avoid the IE error + // See https://bugs.jquery.com/ticket/13378 + rbuggyQSA = []; + + if ( (support.qsa = rnative.test( document.querySelectorAll )) ) { + // Build QSA regex + // Regex strategy adopted from Diego Perini + assert(function( el ) { + // Select is set to empty string on purpose + // This is to test IE's treatment of not explicitly + // setting a boolean content attribute, + // since its presence should be enough + // https://bugs.jquery.com/ticket/12359 + docElem.appendChild( el ).innerHTML = "" + + ""; + + // Support: IE8, Opera 11-12.16 + // Nothing should be selected when empty strings follow ^= or $= or *= + // The test attribute must be unknown in Opera but "safe" for WinRT + // https://msdn.microsoft.com/en-us/library/ie/hh465388.aspx#attribute_section + if ( el.querySelectorAll("[msallowcapture^='']").length ) { + rbuggyQSA.push( "[*^$]=" + whitespace + "*(?:''|\"\")" ); + } + + // Support: IE8 + // Boolean attributes and "value" are not treated correctly + if ( !el.querySelectorAll("[selected]").length ) { + rbuggyQSA.push( "\\[" + whitespace + "*(?:value|" + booleans + ")" ); + } + + // Support: Chrome<29, Android<4.4, Safari<7.0+, iOS<7.0+, PhantomJS<1.9.8+ + if ( !el.querySelectorAll( "[id~=" + expando + "-]" ).length ) { + rbuggyQSA.push("~="); + } + + // Webkit/Opera - :checked should return selected option elements + // http://www.w3.org/TR/2011/REC-css3-selectors-20110929/#checked + // IE8 throws error here and will not see later tests + if ( !el.querySelectorAll(":checked").length ) { + rbuggyQSA.push(":checked"); + } + + // Support: Safari 8+, iOS 8+ + // https://bugs.webkit.org/show_bug.cgi?id=136851 + // In-page `selector#id sibling-combinator selector` fails + if ( !el.querySelectorAll( "a#" + expando + "+*" ).length ) { + rbuggyQSA.push(".#.+[+~]"); + } + }); + + assert(function( el ) { + el.innerHTML = "" + + ""; + + // Support: Windows 8 Native Apps + // The type and name attributes are restricted during .innerHTML assignment + var input = document.createElement("input"); + input.setAttribute( "type", "hidden" ); + el.appendChild( input ).setAttribute( "name", "D" ); + + // Support: IE8 + // Enforce case-sensitivity of name attribute + if ( el.querySelectorAll("[name=d]").length ) { + rbuggyQSA.push( "name" + whitespace + "*[*^$|!~]?=" ); + } + + // FF 3.5 - :enabled/:disabled and hidden elements (hidden elements are still enabled) + // IE8 throws error here and will not see later tests + if ( el.querySelectorAll(":enabled").length !== 2 ) { + rbuggyQSA.push( ":enabled", ":disabled" ); + } + + // Support: IE9-11+ + // IE's :disabled selector does not pick up the children of disabled fieldsets + docElem.appendChild( el ).disabled = true; + if ( el.querySelectorAll(":disabled").length !== 2 ) { + rbuggyQSA.push( ":enabled", ":disabled" ); + } + + // Opera 10-11 does not throw on post-comma invalid pseudos + el.querySelectorAll("*,:x"); + rbuggyQSA.push(",.*:"); + }); + } + + if ( (support.matchesSelector = rnative.test( (matches = docElem.matches || + docElem.webkitMatchesSelector || + docElem.mozMatchesSelector || + docElem.oMatchesSelector || + docElem.msMatchesSelector) )) ) { + + assert(function( el ) { + // Check to see if it's possible to do matchesSelector + // on a disconnected node (IE 9) + support.disconnectedMatch = matches.call( el, "*" ); + + // This should fail with an exception + // Gecko does not error, returns false instead + matches.call( el, "[s!='']:x" ); + rbuggyMatches.push( "!=", pseudos ); + }); + } + + rbuggyQSA = rbuggyQSA.length && new RegExp( rbuggyQSA.join("|") ); + rbuggyMatches = rbuggyMatches.length && new RegExp( rbuggyMatches.join("|") ); + + /* Contains + ---------------------------------------------------------------------- */ + hasCompare = rnative.test( docElem.compareDocumentPosition ); + + // Element contains another + // Purposefully self-exclusive + // As in, an element does not contain itself + contains = hasCompare || rnative.test( docElem.contains ) ? + function( a, b ) { + var adown = a.nodeType === 9 ? a.documentElement : a, + bup = b && b.parentNode; + return a === bup || !!( bup && bup.nodeType === 1 && ( + adown.contains ? + adown.contains( bup ) : + a.compareDocumentPosition && a.compareDocumentPosition( bup ) & 16 + )); + } : + function( a, b ) { + if ( b ) { + while ( (b = b.parentNode) ) { + if ( b === a ) { + return true; + } + } + } + return false; + }; + + /* Sorting + ---------------------------------------------------------------------- */ + + // Document order sorting + sortOrder = hasCompare ? + function( a, b ) { + + // Flag for duplicate removal + if ( a === b ) { + hasDuplicate = true; + return 0; + } + + // Sort on method existence if only one input has compareDocumentPosition + var compare = !a.compareDocumentPosition - !b.compareDocumentPosition; + if ( compare ) { + return compare; + } + + // Calculate position if both inputs belong to the same document + compare = ( a.ownerDocument || a ) === ( b.ownerDocument || b ) ? + a.compareDocumentPosition( b ) : + + // Otherwise we know they are disconnected + 1; + + // Disconnected nodes + if ( compare & 1 || + (!support.sortDetached && b.compareDocumentPosition( a ) === compare) ) { + + // Choose the first element that is related to our preferred document + if ( a === document || a.ownerDocument === preferredDoc && contains(preferredDoc, a) ) { + return -1; + } + if ( b === document || b.ownerDocument === preferredDoc && contains(preferredDoc, b) ) { + return 1; + } + + // Maintain original order + return sortInput ? + ( indexOf( sortInput, a ) - indexOf( sortInput, b ) ) : + 0; + } + + return compare & 4 ? -1 : 1; + } : + function( a, b ) { + // Exit early if the nodes are identical + if ( a === b ) { + hasDuplicate = true; + return 0; + } + + var cur, + i = 0, + aup = a.parentNode, + bup = b.parentNode, + ap = [ a ], + bp = [ b ]; + + // Parentless nodes are either documents or disconnected + if ( !aup || !bup ) { + return a === document ? -1 : + b === document ? 1 : + aup ? -1 : + bup ? 1 : + sortInput ? + ( indexOf( sortInput, a ) - indexOf( sortInput, b ) ) : + 0; + + // If the nodes are siblings, we can do a quick check + } else if ( aup === bup ) { + return siblingCheck( a, b ); + } + + // Otherwise we need full lists of their ancestors for comparison + cur = a; + while ( (cur = cur.parentNode) ) { + ap.unshift( cur ); + } + cur = b; + while ( (cur = cur.parentNode) ) { + bp.unshift( cur ); + } + + // Walk down the tree looking for a discrepancy + while ( ap[i] === bp[i] ) { + i++; + } + + return i ? + // Do a sibling check if the nodes have a common ancestor + siblingCheck( ap[i], bp[i] ) : + + // Otherwise nodes in our document sort first + ap[i] === preferredDoc ? -1 : + bp[i] === preferredDoc ? 1 : + 0; + }; + + return document; +}; + +Sizzle.matches = function( expr, elements ) { + return Sizzle( expr, null, null, elements ); +}; + +Sizzle.matchesSelector = function( elem, expr ) { + // Set document vars if needed + if ( ( elem.ownerDocument || elem ) !== document ) { + setDocument( elem ); + } + + // Make sure that attribute selectors are quoted + expr = expr.replace( rattributeQuotes, "='$1']" ); + + if ( support.matchesSelector && documentIsHTML && + !compilerCache[ expr + " " ] && + ( !rbuggyMatches || !rbuggyMatches.test( expr ) ) && + ( !rbuggyQSA || !rbuggyQSA.test( expr ) ) ) { + + try { + var ret = matches.call( elem, expr ); + + // IE 9's matchesSelector returns false on disconnected nodes + if ( ret || support.disconnectedMatch || + // As well, disconnected nodes are said to be in a document + // fragment in IE 9 + elem.document && elem.document.nodeType !== 11 ) { + return ret; + } + } catch (e) {} + } + + return Sizzle( expr, document, null, [ elem ] ).length > 0; +}; + +Sizzle.contains = function( context, elem ) { + // Set document vars if needed + if ( ( context.ownerDocument || context ) !== document ) { + setDocument( context ); + } + return contains( context, elem ); +}; + +Sizzle.attr = function( elem, name ) { + // Set document vars if needed + if ( ( elem.ownerDocument || elem ) !== document ) { + setDocument( elem ); + } + + var fn = Expr.attrHandle[ name.toLowerCase() ], + // Don't get fooled by Object.prototype properties (jQuery #13807) + val = fn && hasOwn.call( Expr.attrHandle, name.toLowerCase() ) ? + fn( elem, name, !documentIsHTML ) : + undefined; + + return val !== undefined ? + val : + support.attributes || !documentIsHTML ? + elem.getAttribute( name ) : + (val = elem.getAttributeNode(name)) && val.specified ? + val.value : + null; +}; + +Sizzle.escape = function( sel ) { + return (sel + "").replace( rcssescape, fcssescape ); +}; + +Sizzle.error = function( msg ) { + throw new Error( "Syntax error, unrecognized expression: " + msg ); +}; + +/** + * Document sorting and removing duplicates + * @param {ArrayLike} results + */ +Sizzle.uniqueSort = function( results ) { + var elem, + duplicates = [], + j = 0, + i = 0; + + // Unless we *know* we can detect duplicates, assume their presence + hasDuplicate = !support.detectDuplicates; + sortInput = !support.sortStable && results.slice( 0 ); + results.sort( sortOrder ); + + if ( hasDuplicate ) { + while ( (elem = results[i++]) ) { + if ( elem === results[ i ] ) { + j = duplicates.push( i ); + } + } + while ( j-- ) { + results.splice( duplicates[ j ], 1 ); + } + } + + // Clear input after sorting to release objects + // See https://github.com/jquery/sizzle/pull/225 + sortInput = null; + + return results; +}; + +/** + * Utility function for retrieving the text value of an array of DOM nodes + * @param {Array|Element} elem + */ +getText = Sizzle.getText = function( elem ) { + var node, + ret = "", + i = 0, + nodeType = elem.nodeType; + + if ( !nodeType ) { + // If no nodeType, this is expected to be an array + while ( (node = elem[i++]) ) { + // Do not traverse comment nodes + ret += getText( node ); + } + } else if ( nodeType === 1 || nodeType === 9 || nodeType === 11 ) { + // Use textContent for elements + // innerText usage removed for consistency of new lines (jQuery #11153) + if ( typeof elem.textContent === "string" ) { + return elem.textContent; + } else { + // Traverse its children + for ( elem = elem.firstChild; elem; elem = elem.nextSibling ) { + ret += getText( elem ); + } + } + } else if ( nodeType === 3 || nodeType === 4 ) { + return elem.nodeValue; + } + // Do not include comment or processing instruction nodes + + return ret; +}; + +Expr = Sizzle.selectors = { + + // Can be adjusted by the user + cacheLength: 50, + + createPseudo: markFunction, + + match: matchExpr, + + attrHandle: {}, + + find: {}, + + relative: { + ">": { dir: "parentNode", first: true }, + " ": { dir: "parentNode" }, + "+": { dir: "previousSibling", first: true }, + "~": { dir: "previousSibling" } + }, + + preFilter: { + "ATTR": function( match ) { + match[1] = match[1].replace( runescape, funescape ); + + // Move the given value to match[3] whether quoted or unquoted + match[3] = ( match[3] || match[4] || match[5] || "" ).replace( runescape, funescape ); + + if ( match[2] === "~=" ) { + match[3] = " " + match[3] + " "; + } + + return match.slice( 0, 4 ); + }, + + "CHILD": function( match ) { + /* matches from matchExpr["CHILD"] + 1 type (only|nth|...) + 2 what (child|of-type) + 3 argument (even|odd|\d*|\d*n([+-]\d+)?|...) + 4 xn-component of xn+y argument ([+-]?\d*n|) + 5 sign of xn-component + 6 x of xn-component + 7 sign of y-component + 8 y of y-component + */ + match[1] = match[1].toLowerCase(); + + if ( match[1].slice( 0, 3 ) === "nth" ) { + // nth-* requires argument + if ( !match[3] ) { + Sizzle.error( match[0] ); + } + + // numeric x and y parameters for Expr.filter.CHILD + // remember that false/true cast respectively to 0/1 + match[4] = +( match[4] ? match[5] + (match[6] || 1) : 2 * ( match[3] === "even" || match[3] === "odd" ) ); + match[5] = +( ( match[7] + match[8] ) || match[3] === "odd" ); + + // other types prohibit arguments + } else if ( match[3] ) { + Sizzle.error( match[0] ); + } + + return match; + }, + + "PSEUDO": function( match ) { + var excess, + unquoted = !match[6] && match[2]; + + if ( matchExpr["CHILD"].test( match[0] ) ) { + return null; + } + + // Accept quoted arguments as-is + if ( match[3] ) { + match[2] = match[4] || match[5] || ""; + + // Strip excess characters from unquoted arguments + } else if ( unquoted && rpseudo.test( unquoted ) && + // Get excess from tokenize (recursively) + (excess = tokenize( unquoted, true )) && + // advance to the next closing parenthesis + (excess = unquoted.indexOf( ")", unquoted.length - excess ) - unquoted.length) ) { + + // excess is a negative index + match[0] = match[0].slice( 0, excess ); + match[2] = unquoted.slice( 0, excess ); + } + + // Return only captures needed by the pseudo filter method (type and argument) + return match.slice( 0, 3 ); + } + }, + + filter: { + + "TAG": function( nodeNameSelector ) { + var nodeName = nodeNameSelector.replace( runescape, funescape ).toLowerCase(); + return nodeNameSelector === "*" ? + function() { return true; } : + function( elem ) { + return elem.nodeName && elem.nodeName.toLowerCase() === nodeName; + }; + }, + + "CLASS": function( className ) { + var pattern = classCache[ className + " " ]; + + return pattern || + (pattern = new RegExp( "(^|" + whitespace + ")" + className + "(" + whitespace + "|$)" )) && + classCache( className, function( elem ) { + return pattern.test( typeof elem.className === "string" && elem.className || typeof elem.getAttribute !== "undefined" && elem.getAttribute("class") || "" ); + }); + }, + + "ATTR": function( name, operator, check ) { + return function( elem ) { + var result = Sizzle.attr( elem, name ); + + if ( result == null ) { + return operator === "!="; + } + if ( !operator ) { + return true; + } + + result += ""; + + return operator === "=" ? result === check : + operator === "!=" ? result !== check : + operator === "^=" ? check && result.indexOf( check ) === 0 : + operator === "*=" ? check && result.indexOf( check ) > -1 : + operator === "$=" ? check && result.slice( -check.length ) === check : + operator === "~=" ? ( " " + result.replace( rwhitespace, " " ) + " " ).indexOf( check ) > -1 : + operator === "|=" ? result === check || result.slice( 0, check.length + 1 ) === check + "-" : + false; + }; + }, + + "CHILD": function( type, what, argument, first, last ) { + var simple = type.slice( 0, 3 ) !== "nth", + forward = type.slice( -4 ) !== "last", + ofType = what === "of-type"; + + return first === 1 && last === 0 ? + + // Shortcut for :nth-*(n) + function( elem ) { + return !!elem.parentNode; + } : + + function( elem, context, xml ) { + var cache, uniqueCache, outerCache, node, nodeIndex, start, + dir = simple !== forward ? "nextSibling" : "previousSibling", + parent = elem.parentNode, + name = ofType && elem.nodeName.toLowerCase(), + useCache = !xml && !ofType, + diff = false; + + if ( parent ) { + + // :(first|last|only)-(child|of-type) + if ( simple ) { + while ( dir ) { + node = elem; + while ( (node = node[ dir ]) ) { + if ( ofType ? + node.nodeName.toLowerCase() === name : + node.nodeType === 1 ) { + + return false; + } + } + // Reverse direction for :only-* (if we haven't yet done so) + start = dir = type === "only" && !start && "nextSibling"; + } + return true; + } + + start = [ forward ? parent.firstChild : parent.lastChild ]; + + // non-xml :nth-child(...) stores cache data on `parent` + if ( forward && useCache ) { + + // Seek `elem` from a previously-cached index + + // ...in a gzip-friendly way + node = parent; + outerCache = node[ expando ] || (node[ expando ] = {}); + + // Support: IE <9 only + // Defend against cloned attroperties (jQuery gh-1709) + uniqueCache = outerCache[ node.uniqueID ] || + (outerCache[ node.uniqueID ] = {}); + + cache = uniqueCache[ type ] || []; + nodeIndex = cache[ 0 ] === dirruns && cache[ 1 ]; + diff = nodeIndex && cache[ 2 ]; + node = nodeIndex && parent.childNodes[ nodeIndex ]; + + while ( (node = ++nodeIndex && node && node[ dir ] || + + // Fallback to seeking `elem` from the start + (diff = nodeIndex = 0) || start.pop()) ) { + + // When found, cache indexes on `parent` and break + if ( node.nodeType === 1 && ++diff && node === elem ) { + uniqueCache[ type ] = [ dirruns, nodeIndex, diff ]; + break; + } + } + + } else { + // Use previously-cached element index if available + if ( useCache ) { + // ...in a gzip-friendly way + node = elem; + outerCache = node[ expando ] || (node[ expando ] = {}); + + // Support: IE <9 only + // Defend against cloned attroperties (jQuery gh-1709) + uniqueCache = outerCache[ node.uniqueID ] || + (outerCache[ node.uniqueID ] = {}); + + cache = uniqueCache[ type ] || []; + nodeIndex = cache[ 0 ] === dirruns && cache[ 1 ]; + diff = nodeIndex; + } + + // xml :nth-child(...) + // or :nth-last-child(...) or :nth(-last)?-of-type(...) + if ( diff === false ) { + // Use the same loop as above to seek `elem` from the start + while ( (node = ++nodeIndex && node && node[ dir ] || + (diff = nodeIndex = 0) || start.pop()) ) { + + if ( ( ofType ? + node.nodeName.toLowerCase() === name : + node.nodeType === 1 ) && + ++diff ) { + + // Cache the index of each encountered element + if ( useCache ) { + outerCache = node[ expando ] || (node[ expando ] = {}); + + // Support: IE <9 only + // Defend against cloned attroperties (jQuery gh-1709) + uniqueCache = outerCache[ node.uniqueID ] || + (outerCache[ node.uniqueID ] = {}); + + uniqueCache[ type ] = [ dirruns, diff ]; + } + + if ( node === elem ) { + break; + } + } + } + } + } + + // Incorporate the offset, then check against cycle size + diff -= last; + return diff === first || ( diff % first === 0 && diff / first >= 0 ); + } + }; + }, + + "PSEUDO": function( pseudo, argument ) { + // pseudo-class names are case-insensitive + // http://www.w3.org/TR/selectors/#pseudo-classes + // Prioritize by case sensitivity in case custom pseudos are added with uppercase letters + // Remember that setFilters inherits from pseudos + var args, + fn = Expr.pseudos[ pseudo ] || Expr.setFilters[ pseudo.toLowerCase() ] || + Sizzle.error( "unsupported pseudo: " + pseudo ); + + // The user may use createPseudo to indicate that + // arguments are needed to create the filter function + // just as Sizzle does + if ( fn[ expando ] ) { + return fn( argument ); + } + + // But maintain support for old signatures + if ( fn.length > 1 ) { + args = [ pseudo, pseudo, "", argument ]; + return Expr.setFilters.hasOwnProperty( pseudo.toLowerCase() ) ? + markFunction(function( seed, matches ) { + var idx, + matched = fn( seed, argument ), + i = matched.length; + while ( i-- ) { + idx = indexOf( seed, matched[i] ); + seed[ idx ] = !( matches[ idx ] = matched[i] ); + } + }) : + function( elem ) { + return fn( elem, 0, args ); + }; + } + + return fn; + } + }, + + pseudos: { + // Potentially complex pseudos + "not": markFunction(function( selector ) { + // Trim the selector passed to compile + // to avoid treating leading and trailing + // spaces as combinators + var input = [], + results = [], + matcher = compile( selector.replace( rtrim, "$1" ) ); + + return matcher[ expando ] ? + markFunction(function( seed, matches, context, xml ) { + var elem, + unmatched = matcher( seed, null, xml, [] ), + i = seed.length; + + // Match elements unmatched by `matcher` + while ( i-- ) { + if ( (elem = unmatched[i]) ) { + seed[i] = !(matches[i] = elem); + } + } + }) : + function( elem, context, xml ) { + input[0] = elem; + matcher( input, null, xml, results ); + // Don't keep the element (issue #299) + input[0] = null; + return !results.pop(); + }; + }), + + "has": markFunction(function( selector ) { + return function( elem ) { + return Sizzle( selector, elem ).length > 0; + }; + }), + + "contains": markFunction(function( text ) { + text = text.replace( runescape, funescape ); + return function( elem ) { + return ( elem.textContent || elem.innerText || getText( elem ) ).indexOf( text ) > -1; + }; + }), + + // "Whether an element is represented by a :lang() selector + // is based solely on the element's language value + // being equal to the identifier C, + // or beginning with the identifier C immediately followed by "-". + // The matching of C against the element's language value is performed case-insensitively. + // The identifier C does not have to be a valid language name." + // http://www.w3.org/TR/selectors/#lang-pseudo + "lang": markFunction( function( lang ) { + // lang value must be a valid identifier + if ( !ridentifier.test(lang || "") ) { + Sizzle.error( "unsupported lang: " + lang ); + } + lang = lang.replace( runescape, funescape ).toLowerCase(); + return function( elem ) { + var elemLang; + do { + if ( (elemLang = documentIsHTML ? + elem.lang : + elem.getAttribute("xml:lang") || elem.getAttribute("lang")) ) { + + elemLang = elemLang.toLowerCase(); + return elemLang === lang || elemLang.indexOf( lang + "-" ) === 0; + } + } while ( (elem = elem.parentNode) && elem.nodeType === 1 ); + return false; + }; + }), + + // Miscellaneous + "target": function( elem ) { + var hash = window.location && window.location.hash; + return hash && hash.slice( 1 ) === elem.id; + }, + + "root": function( elem ) { + return elem === docElem; + }, + + "focus": function( elem ) { + return elem === document.activeElement && (!document.hasFocus || document.hasFocus()) && !!(elem.type || elem.href || ~elem.tabIndex); + }, + + // Boolean properties + "enabled": createDisabledPseudo( false ), + "disabled": createDisabledPseudo( true ), + + "checked": function( elem ) { + // In CSS3, :checked should return both checked and selected elements + // http://www.w3.org/TR/2011/REC-css3-selectors-20110929/#checked + var nodeName = elem.nodeName.toLowerCase(); + return (nodeName === "input" && !!elem.checked) || (nodeName === "option" && !!elem.selected); + }, + + "selected": function( elem ) { + // Accessing this property makes selected-by-default + // options in Safari work properly + if ( elem.parentNode ) { + elem.parentNode.selectedIndex; + } + + return elem.selected === true; + }, + + // Contents + "empty": function( elem ) { + // http://www.w3.org/TR/selectors/#empty-pseudo + // :empty is negated by element (1) or content nodes (text: 3; cdata: 4; entity ref: 5), + // but not by others (comment: 8; processing instruction: 7; etc.) + // nodeType < 6 works because attributes (2) do not appear as children + for ( elem = elem.firstChild; elem; elem = elem.nextSibling ) { + if ( elem.nodeType < 6 ) { + return false; + } + } + return true; + }, + + "parent": function( elem ) { + return !Expr.pseudos["empty"]( elem ); + }, + + // Element/input types + "header": function( elem ) { + return rheader.test( elem.nodeName ); + }, + + "input": function( elem ) { + return rinputs.test( elem.nodeName ); + }, + + "button": function( elem ) { + var name = elem.nodeName.toLowerCase(); + return name === "input" && elem.type === "button" || name === "button"; + }, + + "text": function( elem ) { + var attr; + return elem.nodeName.toLowerCase() === "input" && + elem.type === "text" && + + // Support: IE<8 + // New HTML5 attribute values (e.g., "search") appear with elem.type === "text" + ( (attr = elem.getAttribute("type")) == null || attr.toLowerCase() === "text" ); + }, + + // Position-in-collection + "first": createPositionalPseudo(function() { + return [ 0 ]; + }), + + "last": createPositionalPseudo(function( matchIndexes, length ) { + return [ length - 1 ]; + }), + + "eq": createPositionalPseudo(function( matchIndexes, length, argument ) { + return [ argument < 0 ? argument + length : argument ]; + }), + + "even": createPositionalPseudo(function( matchIndexes, length ) { + var i = 0; + for ( ; i < length; i += 2 ) { + matchIndexes.push( i ); + } + return matchIndexes; + }), + + "odd": createPositionalPseudo(function( matchIndexes, length ) { + var i = 1; + for ( ; i < length; i += 2 ) { + matchIndexes.push( i ); + } + return matchIndexes; + }), + + "lt": createPositionalPseudo(function( matchIndexes, length, argument ) { + var i = argument < 0 ? argument + length : argument; + for ( ; --i >= 0; ) { + matchIndexes.push( i ); + } + return matchIndexes; + }), + + "gt": createPositionalPseudo(function( matchIndexes, length, argument ) { + var i = argument < 0 ? argument + length : argument; + for ( ; ++i < length; ) { + matchIndexes.push( i ); + } + return matchIndexes; + }) + } +}; + +Expr.pseudos["nth"] = Expr.pseudos["eq"]; + +// Add button/input type pseudos +for ( i in { radio: true, checkbox: true, file: true, password: true, image: true } ) { + Expr.pseudos[ i ] = createInputPseudo( i ); +} +for ( i in { submit: true, reset: true } ) { + Expr.pseudos[ i ] = createButtonPseudo( i ); +} + +// Easy API for creating new setFilters +function setFilters() {} +setFilters.prototype = Expr.filters = Expr.pseudos; +Expr.setFilters = new setFilters(); + +tokenize = Sizzle.tokenize = function( selector, parseOnly ) { + var matched, match, tokens, type, + soFar, groups, preFilters, + cached = tokenCache[ selector + " " ]; + + if ( cached ) { + return parseOnly ? 0 : cached.slice( 0 ); + } + + soFar = selector; + groups = []; + preFilters = Expr.preFilter; + + while ( soFar ) { + + // Comma and first run + if ( !matched || (match = rcomma.exec( soFar )) ) { + if ( match ) { + // Don't consume trailing commas as valid + soFar = soFar.slice( match[0].length ) || soFar; + } + groups.push( (tokens = []) ); + } + + matched = false; + + // Combinators + if ( (match = rcombinators.exec( soFar )) ) { + matched = match.shift(); + tokens.push({ + value: matched, + // Cast descendant combinators to space + type: match[0].replace( rtrim, " " ) + }); + soFar = soFar.slice( matched.length ); + } + + // Filters + for ( type in Expr.filter ) { + if ( (match = matchExpr[ type ].exec( soFar )) && (!preFilters[ type ] || + (match = preFilters[ type ]( match ))) ) { + matched = match.shift(); + tokens.push({ + value: matched, + type: type, + matches: match + }); + soFar = soFar.slice( matched.length ); + } + } + + if ( !matched ) { + break; + } + } + + // Return the length of the invalid excess + // if we're just parsing + // Otherwise, throw an error or return tokens + return parseOnly ? + soFar.length : + soFar ? + Sizzle.error( selector ) : + // Cache the tokens + tokenCache( selector, groups ).slice( 0 ); +}; + +function toSelector( tokens ) { + var i = 0, + len = tokens.length, + selector = ""; + for ( ; i < len; i++ ) { + selector += tokens[i].value; + } + return selector; +} + +function addCombinator( matcher, combinator, base ) { + var dir = combinator.dir, + skip = combinator.next, + key = skip || dir, + checkNonElements = base && key === "parentNode", + doneName = done++; + + return combinator.first ? + // Check against closest ancestor/preceding element + function( elem, context, xml ) { + while ( (elem = elem[ dir ]) ) { + if ( elem.nodeType === 1 || checkNonElements ) { + return matcher( elem, context, xml ); + } + } + return false; + } : + + // Check against all ancestor/preceding elements + function( elem, context, xml ) { + var oldCache, uniqueCache, outerCache, + newCache = [ dirruns, doneName ]; + + // We can't set arbitrary data on XML nodes, so they don't benefit from combinator caching + if ( xml ) { + while ( (elem = elem[ dir ]) ) { + if ( elem.nodeType === 1 || checkNonElements ) { + if ( matcher( elem, context, xml ) ) { + return true; + } + } + } + } else { + while ( (elem = elem[ dir ]) ) { + if ( elem.nodeType === 1 || checkNonElements ) { + outerCache = elem[ expando ] || (elem[ expando ] = {}); + + // Support: IE <9 only + // Defend against cloned attroperties (jQuery gh-1709) + uniqueCache = outerCache[ elem.uniqueID ] || (outerCache[ elem.uniqueID ] = {}); + + if ( skip && skip === elem.nodeName.toLowerCase() ) { + elem = elem[ dir ] || elem; + } else if ( (oldCache = uniqueCache[ key ]) && + oldCache[ 0 ] === dirruns && oldCache[ 1 ] === doneName ) { + + // Assign to newCache so results back-propagate to previous elements + return (newCache[ 2 ] = oldCache[ 2 ]); + } else { + // Reuse newcache so results back-propagate to previous elements + uniqueCache[ key ] = newCache; + + // A match means we're done; a fail means we have to keep checking + if ( (newCache[ 2 ] = matcher( elem, context, xml )) ) { + return true; + } + } + } + } + } + return false; + }; +} + +function elementMatcher( matchers ) { + return matchers.length > 1 ? + function( elem, context, xml ) { + var i = matchers.length; + while ( i-- ) { + if ( !matchers[i]( elem, context, xml ) ) { + return false; + } + } + return true; + } : + matchers[0]; +} + +function multipleContexts( selector, contexts, results ) { + var i = 0, + len = contexts.length; + for ( ; i < len; i++ ) { + Sizzle( selector, contexts[i], results ); + } + return results; +} + +function condense( unmatched, map, filter, context, xml ) { + var elem, + newUnmatched = [], + i = 0, + len = unmatched.length, + mapped = map != null; + + for ( ; i < len; i++ ) { + if ( (elem = unmatched[i]) ) { + if ( !filter || filter( elem, context, xml ) ) { + newUnmatched.push( elem ); + if ( mapped ) { + map.push( i ); + } + } + } + } + + return newUnmatched; +} + +function setMatcher( preFilter, selector, matcher, postFilter, postFinder, postSelector ) { + if ( postFilter && !postFilter[ expando ] ) { + postFilter = setMatcher( postFilter ); + } + if ( postFinder && !postFinder[ expando ] ) { + postFinder = setMatcher( postFinder, postSelector ); + } + return markFunction(function( seed, results, context, xml ) { + var temp, i, elem, + preMap = [], + postMap = [], + preexisting = results.length, + + // Get initial elements from seed or context + elems = seed || multipleContexts( selector || "*", context.nodeType ? [ context ] : context, [] ), + + // Prefilter to get matcher input, preserving a map for seed-results synchronization + matcherIn = preFilter && ( seed || !selector ) ? + condense( elems, preMap, preFilter, context, xml ) : + elems, + + matcherOut = matcher ? + // If we have a postFinder, or filtered seed, or non-seed postFilter or preexisting results, + postFinder || ( seed ? preFilter : preexisting || postFilter ) ? + + // ...intermediate processing is necessary + [] : + + // ...otherwise use results directly + results : + matcherIn; + + // Find primary matches + if ( matcher ) { + matcher( matcherIn, matcherOut, context, xml ); + } + + // Apply postFilter + if ( postFilter ) { + temp = condense( matcherOut, postMap ); + postFilter( temp, [], context, xml ); + + // Un-match failing elements by moving them back to matcherIn + i = temp.length; + while ( i-- ) { + if ( (elem = temp[i]) ) { + matcherOut[ postMap[i] ] = !(matcherIn[ postMap[i] ] = elem); + } + } + } + + if ( seed ) { + if ( postFinder || preFilter ) { + if ( postFinder ) { + // Get the final matcherOut by condensing this intermediate into postFinder contexts + temp = []; + i = matcherOut.length; + while ( i-- ) { + if ( (elem = matcherOut[i]) ) { + // Restore matcherIn since elem is not yet a final match + temp.push( (matcherIn[i] = elem) ); + } + } + postFinder( null, (matcherOut = []), temp, xml ); + } + + // Move matched elements from seed to results to keep them synchronized + i = matcherOut.length; + while ( i-- ) { + if ( (elem = matcherOut[i]) && + (temp = postFinder ? indexOf( seed, elem ) : preMap[i]) > -1 ) { + + seed[temp] = !(results[temp] = elem); + } + } + } + + // Add elements to results, through postFinder if defined + } else { + matcherOut = condense( + matcherOut === results ? + matcherOut.splice( preexisting, matcherOut.length ) : + matcherOut + ); + if ( postFinder ) { + postFinder( null, results, matcherOut, xml ); + } else { + push.apply( results, matcherOut ); + } + } + }); +} + +function matcherFromTokens( tokens ) { + var checkContext, matcher, j, + len = tokens.length, + leadingRelative = Expr.relative[ tokens[0].type ], + implicitRelative = leadingRelative || Expr.relative[" "], + i = leadingRelative ? 1 : 0, + + // The foundational matcher ensures that elements are reachable from top-level context(s) + matchContext = addCombinator( function( elem ) { + return elem === checkContext; + }, implicitRelative, true ), + matchAnyContext = addCombinator( function( elem ) { + return indexOf( checkContext, elem ) > -1; + }, implicitRelative, true ), + matchers = [ function( elem, context, xml ) { + var ret = ( !leadingRelative && ( xml || context !== outermostContext ) ) || ( + (checkContext = context).nodeType ? + matchContext( elem, context, xml ) : + matchAnyContext( elem, context, xml ) ); + // Avoid hanging onto element (issue #299) + checkContext = null; + return ret; + } ]; + + for ( ; i < len; i++ ) { + if ( (matcher = Expr.relative[ tokens[i].type ]) ) { + matchers = [ addCombinator(elementMatcher( matchers ), matcher) ]; + } else { + matcher = Expr.filter[ tokens[i].type ].apply( null, tokens[i].matches ); + + // Return special upon seeing a positional matcher + if ( matcher[ expando ] ) { + // Find the next relative operator (if any) for proper handling + j = ++i; + for ( ; j < len; j++ ) { + if ( Expr.relative[ tokens[j].type ] ) { + break; + } + } + return setMatcher( + i > 1 && elementMatcher( matchers ), + i > 1 && toSelector( + // If the preceding token was a descendant combinator, insert an implicit any-element `*` + tokens.slice( 0, i - 1 ).concat({ value: tokens[ i - 2 ].type === " " ? "*" : "" }) + ).replace( rtrim, "$1" ), + matcher, + i < j && matcherFromTokens( tokens.slice( i, j ) ), + j < len && matcherFromTokens( (tokens = tokens.slice( j )) ), + j < len && toSelector( tokens ) + ); + } + matchers.push( matcher ); + } + } + + return elementMatcher( matchers ); +} + +function matcherFromGroupMatchers( elementMatchers, setMatchers ) { + var bySet = setMatchers.length > 0, + byElement = elementMatchers.length > 0, + superMatcher = function( seed, context, xml, results, outermost ) { + var elem, j, matcher, + matchedCount = 0, + i = "0", + unmatched = seed && [], + setMatched = [], + contextBackup = outermostContext, + // We must always have either seed elements or outermost context + elems = seed || byElement && Expr.find["TAG"]( "*", outermost ), + // Use integer dirruns iff this is the outermost matcher + dirrunsUnique = (dirruns += contextBackup == null ? 1 : Math.random() || 0.1), + len = elems.length; + + if ( outermost ) { + outermostContext = context === document || context || outermost; + } + + // Add elements passing elementMatchers directly to results + // Support: IE<9, Safari + // Tolerate NodeList properties (IE: "length"; Safari: ) matching elements by id + for ( ; i !== len && (elem = elems[i]) != null; i++ ) { + if ( byElement && elem ) { + j = 0; + if ( !context && elem.ownerDocument !== document ) { + setDocument( elem ); + xml = !documentIsHTML; + } + while ( (matcher = elementMatchers[j++]) ) { + if ( matcher( elem, context || document, xml) ) { + results.push( elem ); + break; + } + } + if ( outermost ) { + dirruns = dirrunsUnique; + } + } + + // Track unmatched elements for set filters + if ( bySet ) { + // They will have gone through all possible matchers + if ( (elem = !matcher && elem) ) { + matchedCount--; + } + + // Lengthen the array for every element, matched or not + if ( seed ) { + unmatched.push( elem ); + } + } + } + + // `i` is now the count of elements visited above, and adding it to `matchedCount` + // makes the latter nonnegative. + matchedCount += i; + + // Apply set filters to unmatched elements + // NOTE: This can be skipped if there are no unmatched elements (i.e., `matchedCount` + // equals `i`), unless we didn't visit _any_ elements in the above loop because we have + // no element matchers and no seed. + // Incrementing an initially-string "0" `i` allows `i` to remain a string only in that + // case, which will result in a "00" `matchedCount` that differs from `i` but is also + // numerically zero. + if ( bySet && i !== matchedCount ) { + j = 0; + while ( (matcher = setMatchers[j++]) ) { + matcher( unmatched, setMatched, context, xml ); + } + + if ( seed ) { + // Reintegrate element matches to eliminate the need for sorting + if ( matchedCount > 0 ) { + while ( i-- ) { + if ( !(unmatched[i] || setMatched[i]) ) { + setMatched[i] = pop.call( results ); + } + } + } + + // Discard index placeholder values to get only actual matches + setMatched = condense( setMatched ); + } + + // Add matches to results + push.apply( results, setMatched ); + + // Seedless set matches succeeding multiple successful matchers stipulate sorting + if ( outermost && !seed && setMatched.length > 0 && + ( matchedCount + setMatchers.length ) > 1 ) { + + Sizzle.uniqueSort( results ); + } + } + + // Override manipulation of globals by nested matchers + if ( outermost ) { + dirruns = dirrunsUnique; + outermostContext = contextBackup; + } + + return unmatched; + }; + + return bySet ? + markFunction( superMatcher ) : + superMatcher; +} + +compile = Sizzle.compile = function( selector, match /* Internal Use Only */ ) { + var i, + setMatchers = [], + elementMatchers = [], + cached = compilerCache[ selector + " " ]; + + if ( !cached ) { + // Generate a function of recursive functions that can be used to check each element + if ( !match ) { + match = tokenize( selector ); + } + i = match.length; + while ( i-- ) { + cached = matcherFromTokens( match[i] ); + if ( cached[ expando ] ) { + setMatchers.push( cached ); + } else { + elementMatchers.push( cached ); + } + } + + // Cache the compiled function + cached = compilerCache( selector, matcherFromGroupMatchers( elementMatchers, setMatchers ) ); + + // Save selector and tokenization + cached.selector = selector; + } + return cached; +}; + +/** + * A low-level selection function that works with Sizzle's compiled + * selector functions + * @param {String|Function} selector A selector or a pre-compiled + * selector function built with Sizzle.compile + * @param {Element} context + * @param {Array} [results] + * @param {Array} [seed] A set of elements to match against + */ +select = Sizzle.select = function( selector, context, results, seed ) { + var i, tokens, token, type, find, + compiled = typeof selector === "function" && selector, + match = !seed && tokenize( (selector = compiled.selector || selector) ); + + results = results || []; + + // Try to minimize operations if there is only one selector in the list and no seed + // (the latter of which guarantees us context) + if ( match.length === 1 ) { + + // Reduce context if the leading compound selector is an ID + tokens = match[0] = match[0].slice( 0 ); + if ( tokens.length > 2 && (token = tokens[0]).type === "ID" && + context.nodeType === 9 && documentIsHTML && Expr.relative[ tokens[1].type ] ) { + + context = ( Expr.find["ID"]( token.matches[0].replace(runescape, funescape), context ) || [] )[0]; + if ( !context ) { + return results; + + // Precompiled matchers will still verify ancestry, so step up a level + } else if ( compiled ) { + context = context.parentNode; + } + + selector = selector.slice( tokens.shift().value.length ); + } + + // Fetch a seed set for right-to-left matching + i = matchExpr["needsContext"].test( selector ) ? 0 : tokens.length; + while ( i-- ) { + token = tokens[i]; + + // Abort if we hit a combinator + if ( Expr.relative[ (type = token.type) ] ) { + break; + } + if ( (find = Expr.find[ type ]) ) { + // Search, expanding context for leading sibling combinators + if ( (seed = find( + token.matches[0].replace( runescape, funescape ), + rsibling.test( tokens[0].type ) && testContext( context.parentNode ) || context + )) ) { + + // If seed is empty or no tokens remain, we can return early + tokens.splice( i, 1 ); + selector = seed.length && toSelector( tokens ); + if ( !selector ) { + push.apply( results, seed ); + return results; + } + + break; + } + } + } + } + + // Compile and execute a filtering function if one is not provided + // Provide `match` to avoid retokenization if we modified the selector above + ( compiled || compile( selector, match ) )( + seed, + context, + !documentIsHTML, + results, + !context || rsibling.test( selector ) && testContext( context.parentNode ) || context + ); + return results; +}; + +// One-time assignments + +// Sort stability +support.sortStable = expando.split("").sort( sortOrder ).join("") === expando; + +// Support: Chrome 14-35+ +// Always assume duplicates if they aren't passed to the comparison function +support.detectDuplicates = !!hasDuplicate; + +// Initialize against the default document +setDocument(); + +// Support: Webkit<537.32 - Safari 6.0.3/Chrome 25 (fixed in Chrome 27) +// Detached nodes confoundingly follow *each other* +support.sortDetached = assert(function( el ) { + // Should return 1, but returns 4 (following) + return el.compareDocumentPosition( document.createElement("fieldset") ) & 1; +}); + +// Support: IE<8 +// Prevent attribute/property "interpolation" +// https://msdn.microsoft.com/en-us/library/ms536429%28VS.85%29.aspx +if ( !assert(function( el ) { + el.innerHTML = ""; + return el.firstChild.getAttribute("href") === "#" ; +}) ) { + addHandle( "type|href|height|width", function( elem, name, isXML ) { + if ( !isXML ) { + return elem.getAttribute( name, name.toLowerCase() === "type" ? 1 : 2 ); + } + }); +} + +// Support: IE<9 +// Use defaultValue in place of getAttribute("value") +if ( !support.attributes || !assert(function( el ) { + el.innerHTML = ""; + el.firstChild.setAttribute( "value", "" ); + return el.firstChild.getAttribute( "value" ) === ""; +}) ) { + addHandle( "value", function( elem, name, isXML ) { + if ( !isXML && elem.nodeName.toLowerCase() === "input" ) { + return elem.defaultValue; + } + }); +} + +// Support: IE<9 +// Use getAttributeNode to fetch booleans when getAttribute lies +if ( !assert(function( el ) { + return el.getAttribute("disabled") == null; +}) ) { + addHandle( booleans, function( elem, name, isXML ) { + var val; + if ( !isXML ) { + return elem[ name ] === true ? name.toLowerCase() : + (val = elem.getAttributeNode( name )) && val.specified ? + val.value : + null; + } + }); +} + +return Sizzle; + +})( window ); + + + +jQuery.find = Sizzle; +jQuery.expr = Sizzle.selectors; + +// Deprecated +jQuery.expr[ ":" ] = jQuery.expr.pseudos; +jQuery.uniqueSort = jQuery.unique = Sizzle.uniqueSort; +jQuery.text = Sizzle.getText; +jQuery.isXMLDoc = Sizzle.isXML; +jQuery.contains = Sizzle.contains; +jQuery.escapeSelector = Sizzle.escape; + + + + +var dir = function( elem, dir, until ) { + var matched = [], + truncate = until !== undefined; + + while ( ( elem = elem[ dir ] ) && elem.nodeType !== 9 ) { + if ( elem.nodeType === 1 ) { + if ( truncate && jQuery( elem ).is( until ) ) { + break; + } + matched.push( elem ); + } + } + return matched; +}; + + +var siblings = function( n, elem ) { + var matched = []; + + for ( ; n; n = n.nextSibling ) { + if ( n.nodeType === 1 && n !== elem ) { + matched.push( n ); + } + } + + return matched; +}; + + +var rneedsContext = jQuery.expr.match.needsContext; + +var rsingleTag = ( /^<([a-z][^\/\0>:\x20\t\r\n\f]*)[\x20\t\r\n\f]*\/?>(?:<\/\1>|)$/i ); + + + +var risSimple = /^.[^:#\[\.,]*$/; + +// Implement the identical functionality for filter and not +function winnow( elements, qualifier, not ) { + if ( jQuery.isFunction( qualifier ) ) { + return jQuery.grep( elements, function( elem, i ) { + return !!qualifier.call( elem, i, elem ) !== not; + } ); + } + + // Single element + if ( qualifier.nodeType ) { + return jQuery.grep( elements, function( elem ) { + return ( elem === qualifier ) !== not; + } ); + } + + // Arraylike of elements (jQuery, arguments, Array) + if ( typeof qualifier !== "string" ) { + return jQuery.grep( elements, function( elem ) { + return ( indexOf.call( qualifier, elem ) > -1 ) !== not; + } ); + } + + // Simple selector that can be filtered directly, removing non-Elements + if ( risSimple.test( qualifier ) ) { + return jQuery.filter( qualifier, elements, not ); + } + + // Complex selector, compare the two sets, removing non-Elements + qualifier = jQuery.filter( qualifier, elements ); + return jQuery.grep( elements, function( elem ) { + return ( indexOf.call( qualifier, elem ) > -1 ) !== not && elem.nodeType === 1; + } ); +} + +jQuery.filter = function( expr, elems, not ) { + var elem = elems[ 0 ]; + + if ( not ) { + expr = ":not(" + expr + ")"; + } + + if ( elems.length === 1 && elem.nodeType === 1 ) { + return jQuery.find.matchesSelector( elem, expr ) ? [ elem ] : []; + } + + return jQuery.find.matches( expr, jQuery.grep( elems, function( elem ) { + return elem.nodeType === 1; + } ) ); +}; + +jQuery.fn.extend( { + find: function( selector ) { + var i, ret, + len = this.length, + self = this; + + if ( typeof selector !== "string" ) { + return this.pushStack( jQuery( selector ).filter( function() { + for ( i = 0; i < len; i++ ) { + if ( jQuery.contains( self[ i ], this ) ) { + return true; + } + } + } ) ); + } + + ret = this.pushStack( [] ); + + for ( i = 0; i < len; i++ ) { + jQuery.find( selector, self[ i ], ret ); + } + + return len > 1 ? jQuery.uniqueSort( ret ) : ret; + }, + filter: function( selector ) { + return this.pushStack( winnow( this, selector || [], false ) ); + }, + not: function( selector ) { + return this.pushStack( winnow( this, selector || [], true ) ); + }, + is: function( selector ) { + return !!winnow( + this, + + // If this is a positional/relative selector, check membership in the returned set + // so $("p:first").is("p:last") won't return true for a doc with two "p". + typeof selector === "string" && rneedsContext.test( selector ) ? + jQuery( selector ) : + selector || [], + false + ).length; + } +} ); + + +// Initialize a jQuery object + + +// A central reference to the root jQuery(document) +var rootjQuery, + + // A simple way to check for HTML strings + // Prioritize #id over to avoid XSS via location.hash (#9521) + // Strict HTML recognition (#11290: must start with <) + // Shortcut simple #id case for speed + rquickExpr = /^(?:\s*(<[\w\W]+>)[^>]*|#([\w-]+))$/, + + init = jQuery.fn.init = function( selector, context, root ) { + var match, elem; + + // HANDLE: $(""), $(null), $(undefined), $(false) + if ( !selector ) { + return this; + } + + // Method init() accepts an alternate rootjQuery + // so migrate can support jQuery.sub (gh-2101) + root = root || rootjQuery; + + // Handle HTML strings + if ( typeof selector === "string" ) { + if ( selector[ 0 ] === "<" && + selector[ selector.length - 1 ] === ">" && + selector.length >= 3 ) { + + // Assume that strings that start and end with <> are HTML and skip the regex check + match = [ null, selector, null ]; + + } else { + match = rquickExpr.exec( selector ); + } + + // Match html or make sure no context is specified for #id + if ( match && ( match[ 1 ] || !context ) ) { + + // HANDLE: $(html) -> $(array) + if ( match[ 1 ] ) { + context = context instanceof jQuery ? context[ 0 ] : context; + + // Option to run scripts is true for back-compat + // Intentionally let the error be thrown if parseHTML is not present + jQuery.merge( this, jQuery.parseHTML( + match[ 1 ], + context && context.nodeType ? context.ownerDocument || context : document, + true + ) ); + + // HANDLE: $(html, props) + if ( rsingleTag.test( match[ 1 ] ) && jQuery.isPlainObject( context ) ) { + for ( match in context ) { + + // Properties of context are called as methods if possible + if ( jQuery.isFunction( this[ match ] ) ) { + this[ match ]( context[ match ] ); + + // ...and otherwise set as attributes + } else { + this.attr( match, context[ match ] ); + } + } + } + + return this; + + // HANDLE: $(#id) + } else { + elem = document.getElementById( match[ 2 ] ); + + if ( elem ) { + + // Inject the element directly into the jQuery object + this[ 0 ] = elem; + this.length = 1; + } + return this; + } + + // HANDLE: $(expr, $(...)) + } else if ( !context || context.jquery ) { + return ( context || root ).find( selector ); + + // HANDLE: $(expr, context) + // (which is just equivalent to: $(context).find(expr) + } else { + return this.constructor( context ).find( selector ); + } + + // HANDLE: $(DOMElement) + } else if ( selector.nodeType ) { + this[ 0 ] = selector; + this.length = 1; + return this; + + // HANDLE: $(function) + // Shortcut for document ready + } else if ( jQuery.isFunction( selector ) ) { + return root.ready !== undefined ? + root.ready( selector ) : + + // Execute immediately if ready is not present + selector( jQuery ); + } + + return jQuery.makeArray( selector, this ); + }; + +// Give the init function the jQuery prototype for later instantiation +init.prototype = jQuery.fn; + +// Initialize central reference +rootjQuery = jQuery( document ); + + +var rparentsprev = /^(?:parents|prev(?:Until|All))/, + + // Methods guaranteed to produce a unique set when starting from a unique set + guaranteedUnique = { + children: true, + contents: true, + next: true, + prev: true + }; + +jQuery.fn.extend( { + has: function( target ) { + var targets = jQuery( target, this ), + l = targets.length; + + return this.filter( function() { + var i = 0; + for ( ; i < l; i++ ) { + if ( jQuery.contains( this, targets[ i ] ) ) { + return true; + } + } + } ); + }, + + closest: function( selectors, context ) { + var cur, + i = 0, + l = this.length, + matched = [], + targets = typeof selectors !== "string" && jQuery( selectors ); + + // Positional selectors never match, since there's no _selection_ context + if ( !rneedsContext.test( selectors ) ) { + for ( ; i < l; i++ ) { + for ( cur = this[ i ]; cur && cur !== context; cur = cur.parentNode ) { + + // Always skip document fragments + if ( cur.nodeType < 11 && ( targets ? + targets.index( cur ) > -1 : + + // Don't pass non-elements to Sizzle + cur.nodeType === 1 && + jQuery.find.matchesSelector( cur, selectors ) ) ) { + + matched.push( cur ); + break; + } + } + } + } + + return this.pushStack( matched.length > 1 ? jQuery.uniqueSort( matched ) : matched ); + }, + + // Determine the position of an element within the set + index: function( elem ) { + + // No argument, return index in parent + if ( !elem ) { + return ( this[ 0 ] && this[ 0 ].parentNode ) ? this.first().prevAll().length : -1; + } + + // Index in selector + if ( typeof elem === "string" ) { + return indexOf.call( jQuery( elem ), this[ 0 ] ); + } + + // Locate the position of the desired element + return indexOf.call( this, + + // If it receives a jQuery object, the first element is used + elem.jquery ? elem[ 0 ] : elem + ); + }, + + add: function( selector, context ) { + return this.pushStack( + jQuery.uniqueSort( + jQuery.merge( this.get(), jQuery( selector, context ) ) + ) + ); + }, + + addBack: function( selector ) { + return this.add( selector == null ? + this.prevObject : this.prevObject.filter( selector ) + ); + } +} ); + +function sibling( cur, dir ) { + while ( ( cur = cur[ dir ] ) && cur.nodeType !== 1 ) {} + return cur; +} + +jQuery.each( { + parent: function( elem ) { + var parent = elem.parentNode; + return parent && parent.nodeType !== 11 ? parent : null; + }, + parents: function( elem ) { + return dir( elem, "parentNode" ); + }, + parentsUntil: function( elem, i, until ) { + return dir( elem, "parentNode", until ); + }, + next: function( elem ) { + return sibling( elem, "nextSibling" ); + }, + prev: function( elem ) { + return sibling( elem, "previousSibling" ); + }, + nextAll: function( elem ) { + return dir( elem, "nextSibling" ); + }, + prevAll: function( elem ) { + return dir( elem, "previousSibling" ); + }, + nextUntil: function( elem, i, until ) { + return dir( elem, "nextSibling", until ); + }, + prevUntil: function( elem, i, until ) { + return dir( elem, "previousSibling", until ); + }, + siblings: function( elem ) { + return siblings( ( elem.parentNode || {} ).firstChild, elem ); + }, + children: function( elem ) { + return siblings( elem.firstChild ); + }, + contents: function( elem ) { + return elem.contentDocument || jQuery.merge( [], elem.childNodes ); + } +}, function( name, fn ) { + jQuery.fn[ name ] = function( until, selector ) { + var matched = jQuery.map( this, fn, until ); + + if ( name.slice( -5 ) !== "Until" ) { + selector = until; + } + + if ( selector && typeof selector === "string" ) { + matched = jQuery.filter( selector, matched ); + } + + if ( this.length > 1 ) { + + // Remove duplicates + if ( !guaranteedUnique[ name ] ) { + jQuery.uniqueSort( matched ); + } + + // Reverse order for parents* and prev-derivatives + if ( rparentsprev.test( name ) ) { + matched.reverse(); + } + } + + return this.pushStack( matched ); + }; +} ); +var rnothtmlwhite = ( /[^\x20\t\r\n\f]+/g ); + + + +// Convert String-formatted options into Object-formatted ones +function createOptions( options ) { + var object = {}; + jQuery.each( options.match( rnothtmlwhite ) || [], function( _, flag ) { + object[ flag ] = true; + } ); + return object; +} + +/* + * Create a callback list using the following parameters: + * + * options: an optional list of space-separated options that will change how + * the callback list behaves or a more traditional option object + * + * By default a callback list will act like an event callback list and can be + * "fired" multiple times. + * + * Possible options: + * + * once: will ensure the callback list can only be fired once (like a Deferred) + * + * memory: will keep track of previous values and will call any callback added + * after the list has been fired right away with the latest "memorized" + * values (like a Deferred) + * + * unique: will ensure a callback can only be added once (no duplicate in the list) + * + * stopOnFalse: interrupt callings when a callback returns false + * + */ +jQuery.Callbacks = function( options ) { + + // Convert options from String-formatted to Object-formatted if needed + // (we check in cache first) + options = typeof options === "string" ? + createOptions( options ) : + jQuery.extend( {}, options ); + + var // Flag to know if list is currently firing + firing, + + // Last fire value for non-forgettable lists + memory, + + // Flag to know if list was already fired + fired, + + // Flag to prevent firing + locked, + + // Actual callback list + list = [], + + // Queue of execution data for repeatable lists + queue = [], + + // Index of currently firing callback (modified by add/remove as needed) + firingIndex = -1, + + // Fire callbacks + fire = function() { + + // Enforce single-firing + locked = options.once; + + // Execute callbacks for all pending executions, + // respecting firingIndex overrides and runtime changes + fired = firing = true; + for ( ; queue.length; firingIndex = -1 ) { + memory = queue.shift(); + while ( ++firingIndex < list.length ) { + + // Run callback and check for early termination + if ( list[ firingIndex ].apply( memory[ 0 ], memory[ 1 ] ) === false && + options.stopOnFalse ) { + + // Jump to end and forget the data so .add doesn't re-fire + firingIndex = list.length; + memory = false; + } + } + } + + // Forget the data if we're done with it + if ( !options.memory ) { + memory = false; + } + + firing = false; + + // Clean up if we're done firing for good + if ( locked ) { + + // Keep an empty list if we have data for future add calls + if ( memory ) { + list = []; + + // Otherwise, this object is spent + } else { + list = ""; + } + } + }, + + // Actual Callbacks object + self = { + + // Add a callback or a collection of callbacks to the list + add: function() { + if ( list ) { + + // If we have memory from a past run, we should fire after adding + if ( memory && !firing ) { + firingIndex = list.length - 1; + queue.push( memory ); + } + + ( function add( args ) { + jQuery.each( args, function( _, arg ) { + if ( jQuery.isFunction( arg ) ) { + if ( !options.unique || !self.has( arg ) ) { + list.push( arg ); + } + } else if ( arg && arg.length && jQuery.type( arg ) !== "string" ) { + + // Inspect recursively + add( arg ); + } + } ); + } )( arguments ); + + if ( memory && !firing ) { + fire(); + } + } + return this; + }, + + // Remove a callback from the list + remove: function() { + jQuery.each( arguments, function( _, arg ) { + var index; + while ( ( index = jQuery.inArray( arg, list, index ) ) > -1 ) { + list.splice( index, 1 ); + + // Handle firing indexes + if ( index <= firingIndex ) { + firingIndex--; + } + } + } ); + return this; + }, + + // Check if a given callback is in the list. + // If no argument is given, return whether or not list has callbacks attached. + has: function( fn ) { + return fn ? + jQuery.inArray( fn, list ) > -1 : + list.length > 0; + }, + + // Remove all callbacks from the list + empty: function() { + if ( list ) { + list = []; + } + return this; + }, + + // Disable .fire and .add + // Abort any current/pending executions + // Clear all callbacks and values + disable: function() { + locked = queue = []; + list = memory = ""; + return this; + }, + disabled: function() { + return !list; + }, + + // Disable .fire + // Also disable .add unless we have memory (since it would have no effect) + // Abort any pending executions + lock: function() { + locked = queue = []; + if ( !memory && !firing ) { + list = memory = ""; + } + return this; + }, + locked: function() { + return !!locked; + }, + + // Call all callbacks with the given context and arguments + fireWith: function( context, args ) { + if ( !locked ) { + args = args || []; + args = [ context, args.slice ? args.slice() : args ]; + queue.push( args ); + if ( !firing ) { + fire(); + } + } + return this; + }, + + // Call all the callbacks with the given arguments + fire: function() { + self.fireWith( this, arguments ); + return this; + }, + + // To know if the callbacks have already been called at least once + fired: function() { + return !!fired; + } + }; + + return self; +}; + + +function Identity( v ) { + return v; +} +function Thrower( ex ) { + throw ex; +} + +function adoptValue( value, resolve, reject ) { + var method; + + try { + + // Check for promise aspect first to privilege synchronous behavior + if ( value && jQuery.isFunction( ( method = value.promise ) ) ) { + method.call( value ).done( resolve ).fail( reject ); + + // Other thenables + } else if ( value && jQuery.isFunction( ( method = value.then ) ) ) { + method.call( value, resolve, reject ); + + // Other non-thenables + } else { + + // Support: Android 4.0 only + // Strict mode functions invoked without .call/.apply get global-object context + resolve.call( undefined, value ); + } + + // For Promises/A+, convert exceptions into rejections + // Since jQuery.when doesn't unwrap thenables, we can skip the extra checks appearing in + // Deferred#then to conditionally suppress rejection. + } catch ( value ) { + + // Support: Android 4.0 only + // Strict mode functions invoked without .call/.apply get global-object context + reject.call( undefined, value ); + } +} + +jQuery.extend( { + + Deferred: function( func ) { + var tuples = [ + + // action, add listener, callbacks, + // ... .then handlers, argument index, [final state] + [ "notify", "progress", jQuery.Callbacks( "memory" ), + jQuery.Callbacks( "memory" ), 2 ], + [ "resolve", "done", jQuery.Callbacks( "once memory" ), + jQuery.Callbacks( "once memory" ), 0, "resolved" ], + [ "reject", "fail", jQuery.Callbacks( "once memory" ), + jQuery.Callbacks( "once memory" ), 1, "rejected" ] + ], + state = "pending", + promise = { + state: function() { + return state; + }, + always: function() { + deferred.done( arguments ).fail( arguments ); + return this; + }, + "catch": function( fn ) { + return promise.then( null, fn ); + }, + + // Keep pipe for back-compat + pipe: function( /* fnDone, fnFail, fnProgress */ ) { + var fns = arguments; + + return jQuery.Deferred( function( newDefer ) { + jQuery.each( tuples, function( i, tuple ) { + + // Map tuples (progress, done, fail) to arguments (done, fail, progress) + var fn = jQuery.isFunction( fns[ tuple[ 4 ] ] ) && fns[ tuple[ 4 ] ]; + + // deferred.progress(function() { bind to newDefer or newDefer.notify }) + // deferred.done(function() { bind to newDefer or newDefer.resolve }) + // deferred.fail(function() { bind to newDefer or newDefer.reject }) + deferred[ tuple[ 1 ] ]( function() { + var returned = fn && fn.apply( this, arguments ); + if ( returned && jQuery.isFunction( returned.promise ) ) { + returned.promise() + .progress( newDefer.notify ) + .done( newDefer.resolve ) + .fail( newDefer.reject ); + } else { + newDefer[ tuple[ 0 ] + "With" ]( + this, + fn ? [ returned ] : arguments + ); + } + } ); + } ); + fns = null; + } ).promise(); + }, + then: function( onFulfilled, onRejected, onProgress ) { + var maxDepth = 0; + function resolve( depth, deferred, handler, special ) { + return function() { + var that = this, + args = arguments, + mightThrow = function() { + var returned, then; + + // Support: Promises/A+ section 2.3.3.3.3 + // https://promisesaplus.com/#point-59 + // Ignore double-resolution attempts + if ( depth < maxDepth ) { + return; + } + + returned = handler.apply( that, args ); + + // Support: Promises/A+ section 2.3.1 + // https://promisesaplus.com/#point-48 + if ( returned === deferred.promise() ) { + throw new TypeError( "Thenable self-resolution" ); + } + + // Support: Promises/A+ sections 2.3.3.1, 3.5 + // https://promisesaplus.com/#point-54 + // https://promisesaplus.com/#point-75 + // Retrieve `then` only once + then = returned && + + // Support: Promises/A+ section 2.3.4 + // https://promisesaplus.com/#point-64 + // Only check objects and functions for thenability + ( typeof returned === "object" || + typeof returned === "function" ) && + returned.then; + + // Handle a returned thenable + if ( jQuery.isFunction( then ) ) { + + // Special processors (notify) just wait for resolution + if ( special ) { + then.call( + returned, + resolve( maxDepth, deferred, Identity, special ), + resolve( maxDepth, deferred, Thrower, special ) + ); + + // Normal processors (resolve) also hook into progress + } else { + + // ...and disregard older resolution values + maxDepth++; + + then.call( + returned, + resolve( maxDepth, deferred, Identity, special ), + resolve( maxDepth, deferred, Thrower, special ), + resolve( maxDepth, deferred, Identity, + deferred.notifyWith ) + ); + } + + // Handle all other returned values + } else { + + // Only substitute handlers pass on context + // and multiple values (non-spec behavior) + if ( handler !== Identity ) { + that = undefined; + args = [ returned ]; + } + + // Process the value(s) + // Default process is resolve + ( special || deferred.resolveWith )( that, args ); + } + }, + + // Only normal processors (resolve) catch and reject exceptions + process = special ? + mightThrow : + function() { + try { + mightThrow(); + } catch ( e ) { + + if ( jQuery.Deferred.exceptionHook ) { + jQuery.Deferred.exceptionHook( e, + process.stackTrace ); + } + + // Support: Promises/A+ section 2.3.3.3.4.1 + // https://promisesaplus.com/#point-61 + // Ignore post-resolution exceptions + if ( depth + 1 >= maxDepth ) { + + // Only substitute handlers pass on context + // and multiple values (non-spec behavior) + if ( handler !== Thrower ) { + that = undefined; + args = [ e ]; + } + + deferred.rejectWith( that, args ); + } + } + }; + + // Support: Promises/A+ section 2.3.3.3.1 + // https://promisesaplus.com/#point-57 + // Re-resolve promises immediately to dodge false rejection from + // subsequent errors + if ( depth ) { + process(); + } else { + + // Call an optional hook to record the stack, in case of exception + // since it's otherwise lost when execution goes async + if ( jQuery.Deferred.getStackHook ) { + process.stackTrace = jQuery.Deferred.getStackHook(); + } + window.setTimeout( process ); + } + }; + } + + return jQuery.Deferred( function( newDefer ) { + + // progress_handlers.add( ... ) + tuples[ 0 ][ 3 ].add( + resolve( + 0, + newDefer, + jQuery.isFunction( onProgress ) ? + onProgress : + Identity, + newDefer.notifyWith + ) + ); + + // fulfilled_handlers.add( ... ) + tuples[ 1 ][ 3 ].add( + resolve( + 0, + newDefer, + jQuery.isFunction( onFulfilled ) ? + onFulfilled : + Identity + ) + ); + + // rejected_handlers.add( ... ) + tuples[ 2 ][ 3 ].add( + resolve( + 0, + newDefer, + jQuery.isFunction( onRejected ) ? + onRejected : + Thrower + ) + ); + } ).promise(); + }, + + // Get a promise for this deferred + // If obj is provided, the promise aspect is added to the object + promise: function( obj ) { + return obj != null ? jQuery.extend( obj, promise ) : promise; + } + }, + deferred = {}; + + // Add list-specific methods + jQuery.each( tuples, function( i, tuple ) { + var list = tuple[ 2 ], + stateString = tuple[ 5 ]; + + // promise.progress = list.add + // promise.done = list.add + // promise.fail = list.add + promise[ tuple[ 1 ] ] = list.add; + + // Handle state + if ( stateString ) { + list.add( + function() { + + // state = "resolved" (i.e., fulfilled) + // state = "rejected" + state = stateString; + }, + + // rejected_callbacks.disable + // fulfilled_callbacks.disable + tuples[ 3 - i ][ 2 ].disable, + + // progress_callbacks.lock + tuples[ 0 ][ 2 ].lock + ); + } + + // progress_handlers.fire + // fulfilled_handlers.fire + // rejected_handlers.fire + list.add( tuple[ 3 ].fire ); + + // deferred.notify = function() { deferred.notifyWith(...) } + // deferred.resolve = function() { deferred.resolveWith(...) } + // deferred.reject = function() { deferred.rejectWith(...) } + deferred[ tuple[ 0 ] ] = function() { + deferred[ tuple[ 0 ] + "With" ]( this === deferred ? undefined : this, arguments ); + return this; + }; + + // deferred.notifyWith = list.fireWith + // deferred.resolveWith = list.fireWith + // deferred.rejectWith = list.fireWith + deferred[ tuple[ 0 ] + "With" ] = list.fireWith; + } ); + + // Make the deferred a promise + promise.promise( deferred ); + + // Call given func if any + if ( func ) { + func.call( deferred, deferred ); + } + + // All done! + return deferred; + }, + + // Deferred helper + when: function( singleValue ) { + var + + // count of uncompleted subordinates + remaining = arguments.length, + + // count of unprocessed arguments + i = remaining, + + // subordinate fulfillment data + resolveContexts = Array( i ), + resolveValues = slice.call( arguments ), + + // the master Deferred + master = jQuery.Deferred(), + + // subordinate callback factory + updateFunc = function( i ) { + return function( value ) { + resolveContexts[ i ] = this; + resolveValues[ i ] = arguments.length > 1 ? slice.call( arguments ) : value; + if ( !( --remaining ) ) { + master.resolveWith( resolveContexts, resolveValues ); + } + }; + }; + + // Single- and empty arguments are adopted like Promise.resolve + if ( remaining <= 1 ) { + adoptValue( singleValue, master.done( updateFunc( i ) ).resolve, master.reject ); + + // Use .then() to unwrap secondary thenables (cf. gh-3000) + if ( master.state() === "pending" || + jQuery.isFunction( resolveValues[ i ] && resolveValues[ i ].then ) ) { + + return master.then(); + } + } + + // Multiple arguments are aggregated like Promise.all array elements + while ( i-- ) { + adoptValue( resolveValues[ i ], updateFunc( i ), master.reject ); + } + + return master.promise(); + } +} ); + + +// These usually indicate a programmer mistake during development, +// warn about them ASAP rather than swallowing them by default. +var rerrorNames = /^(Eval|Internal|Range|Reference|Syntax|Type|URI)Error$/; + +jQuery.Deferred.exceptionHook = function( error, stack ) { + + // Support: IE 8 - 9 only + // Console exists when dev tools are open, which can happen at any time + if ( window.console && window.console.warn && error && rerrorNames.test( error.name ) ) { + window.console.warn( "jQuery.Deferred exception: " + error.message, error.stack, stack ); + } +}; + + + + +jQuery.readyException = function( error ) { + window.setTimeout( function() { + throw error; + } ); +}; + + + + +// The deferred used on DOM ready +var readyList = jQuery.Deferred(); + +jQuery.fn.ready = function( fn ) { + + readyList + .then( fn ) + + // Wrap jQuery.readyException in a function so that the lookup + // happens at the time of error handling instead of callback + // registration. + .catch( function( error ) { + jQuery.readyException( error ); + } ); + + return this; +}; + +jQuery.extend( { + + // Is the DOM ready to be used? Set to true once it occurs. + isReady: false, + + // A counter to track how many items to wait for before + // the ready event fires. See #6781 + readyWait: 1, + + // Hold (or release) the ready event + holdReady: function( hold ) { + if ( hold ) { + jQuery.readyWait++; + } else { + jQuery.ready( true ); + } + }, + + // Handle when the DOM is ready + ready: function( wait ) { + + // Abort if there are pending holds or we're already ready + if ( wait === true ? --jQuery.readyWait : jQuery.isReady ) { + return; + } + + // Remember that the DOM is ready + jQuery.isReady = true; + + // If a normal DOM Ready event fired, decrement, and wait if need be + if ( wait !== true && --jQuery.readyWait > 0 ) { + return; + } + + // If there are functions bound, to execute + readyList.resolveWith( document, [ jQuery ] ); + } +} ); + +jQuery.ready.then = readyList.then; + +// The ready event handler and self cleanup method +function completed() { + document.removeEventListener( "DOMContentLoaded", completed ); + window.removeEventListener( "load", completed ); + jQuery.ready(); +} + +// Catch cases where $(document).ready() is called +// after the browser event has already occurred. +// Support: IE <=9 - 10 only +// Older IE sometimes signals "interactive" too soon +if ( document.readyState === "complete" || + ( document.readyState !== "loading" && !document.documentElement.doScroll ) ) { + + // Handle it asynchronously to allow scripts the opportunity to delay ready + window.setTimeout( jQuery.ready ); + +} else { + + // Use the handy event callback + document.addEventListener( "DOMContentLoaded", completed ); + + // A fallback to window.onload, that will always work + window.addEventListener( "load", completed ); +} + + + + +// Multifunctional method to get and set values of a collection +// The value/s can optionally be executed if it's a function +var access = function( elems, fn, key, value, chainable, emptyGet, raw ) { + var i = 0, + len = elems.length, + bulk = key == null; + + // Sets many values + if ( jQuery.type( key ) === "object" ) { + chainable = true; + for ( i in key ) { + access( elems, fn, i, key[ i ], true, emptyGet, raw ); + } + + // Sets one value + } else if ( value !== undefined ) { + chainable = true; + + if ( !jQuery.isFunction( value ) ) { + raw = true; + } + + if ( bulk ) { + + // Bulk operations run against the entire set + if ( raw ) { + fn.call( elems, value ); + fn = null; + + // ...except when executing function values + } else { + bulk = fn; + fn = function( elem, key, value ) { + return bulk.call( jQuery( elem ), value ); + }; + } + } + + if ( fn ) { + for ( ; i < len; i++ ) { + fn( + elems[ i ], key, raw ? + value : + value.call( elems[ i ], i, fn( elems[ i ], key ) ) + ); + } + } + } + + if ( chainable ) { + return elems; + } + + // Gets + if ( bulk ) { + return fn.call( elems ); + } + + return len ? fn( elems[ 0 ], key ) : emptyGet; +}; +var acceptData = function( owner ) { + + // Accepts only: + // - Node + // - Node.ELEMENT_NODE + // - Node.DOCUMENT_NODE + // - Object + // - Any + return owner.nodeType === 1 || owner.nodeType === 9 || !( +owner.nodeType ); +}; + + + + +function Data() { + this.expando = jQuery.expando + Data.uid++; +} + +Data.uid = 1; + +Data.prototype = { + + cache: function( owner ) { + + // Check if the owner object already has a cache + var value = owner[ this.expando ]; + + // If not, create one + if ( !value ) { + value = {}; + + // We can accept data for non-element nodes in modern browsers, + // but we should not, see #8335. + // Always return an empty object. + if ( acceptData( owner ) ) { + + // If it is a node unlikely to be stringify-ed or looped over + // use plain assignment + if ( owner.nodeType ) { + owner[ this.expando ] = value; + + // Otherwise secure it in a non-enumerable property + // configurable must be true to allow the property to be + // deleted when data is removed + } else { + Object.defineProperty( owner, this.expando, { + value: value, + configurable: true + } ); + } + } + } + + return value; + }, + set: function( owner, data, value ) { + var prop, + cache = this.cache( owner ); + + // Handle: [ owner, key, value ] args + // Always use camelCase key (gh-2257) + if ( typeof data === "string" ) { + cache[ jQuery.camelCase( data ) ] = value; + + // Handle: [ owner, { properties } ] args + } else { + + // Copy the properties one-by-one to the cache object + for ( prop in data ) { + cache[ jQuery.camelCase( prop ) ] = data[ prop ]; + } + } + return cache; + }, + get: function( owner, key ) { + return key === undefined ? + this.cache( owner ) : + + // Always use camelCase key (gh-2257) + owner[ this.expando ] && owner[ this.expando ][ jQuery.camelCase( key ) ]; + }, + access: function( owner, key, value ) { + + // In cases where either: + // + // 1. No key was specified + // 2. A string key was specified, but no value provided + // + // Take the "read" path and allow the get method to determine + // which value to return, respectively either: + // + // 1. The entire cache object + // 2. The data stored at the key + // + if ( key === undefined || + ( ( key && typeof key === "string" ) && value === undefined ) ) { + + return this.get( owner, key ); + } + + // When the key is not a string, or both a key and value + // are specified, set or extend (existing objects) with either: + // + // 1. An object of properties + // 2. A key and value + // + this.set( owner, key, value ); + + // Since the "set" path can have two possible entry points + // return the expected data based on which path was taken[*] + return value !== undefined ? value : key; + }, + remove: function( owner, key ) { + var i, + cache = owner[ this.expando ]; + + if ( cache === undefined ) { + return; + } + + if ( key !== undefined ) { + + // Support array or space separated string of keys + if ( jQuery.isArray( key ) ) { + + // If key is an array of keys... + // We always set camelCase keys, so remove that. + key = key.map( jQuery.camelCase ); + } else { + key = jQuery.camelCase( key ); + + // If a key with the spaces exists, use it. + // Otherwise, create an array by matching non-whitespace + key = key in cache ? + [ key ] : + ( key.match( rnothtmlwhite ) || [] ); + } + + i = key.length; + + while ( i-- ) { + delete cache[ key[ i ] ]; + } + } + + // Remove the expando if there's no more data + if ( key === undefined || jQuery.isEmptyObject( cache ) ) { + + // Support: Chrome <=35 - 45 + // Webkit & Blink performance suffers when deleting properties + // from DOM nodes, so set to undefined instead + // https://bugs.chromium.org/p/chromium/issues/detail?id=378607 (bug restricted) + if ( owner.nodeType ) { + owner[ this.expando ] = undefined; + } else { + delete owner[ this.expando ]; + } + } + }, + hasData: function( owner ) { + var cache = owner[ this.expando ]; + return cache !== undefined && !jQuery.isEmptyObject( cache ); + } +}; +var dataPriv = new Data(); + +var dataUser = new Data(); + + + +// Implementation Summary +// +// 1. Enforce API surface and semantic compatibility with 1.9.x branch +// 2. Improve the module's maintainability by reducing the storage +// paths to a single mechanism. +// 3. Use the same single mechanism to support "private" and "user" data. +// 4. _Never_ expose "private" data to user code (TODO: Drop _data, _removeData) +// 5. Avoid exposing implementation details on user objects (eg. expando properties) +// 6. Provide a clear path for implementation upgrade to WeakMap in 2014 + +var rbrace = /^(?:\{[\w\W]*\}|\[[\w\W]*\])$/, + rmultiDash = /[A-Z]/g; + +function getData( data ) { + if ( data === "true" ) { + return true; + } + + if ( data === "false" ) { + return false; + } + + if ( data === "null" ) { + return null; + } + + // Only convert to a number if it doesn't change the string + if ( data === +data + "" ) { + return +data; + } + + if ( rbrace.test( data ) ) { + return JSON.parse( data ); + } + + return data; +} + +function dataAttr( elem, key, data ) { + var name; + + // If nothing was found internally, try to fetch any + // data from the HTML5 data-* attribute + if ( data === undefined && elem.nodeType === 1 ) { + name = "data-" + key.replace( rmultiDash, "-$&" ).toLowerCase(); + data = elem.getAttribute( name ); + + if ( typeof data === "string" ) { + try { + data = getData( data ); + } catch ( e ) {} + + // Make sure we set the data so it isn't changed later + dataUser.set( elem, key, data ); + } else { + data = undefined; + } + } + return data; +} + +jQuery.extend( { + hasData: function( elem ) { + return dataUser.hasData( elem ) || dataPriv.hasData( elem ); + }, + + data: function( elem, name, data ) { + return dataUser.access( elem, name, data ); + }, + + removeData: function( elem, name ) { + dataUser.remove( elem, name ); + }, + + // TODO: Now that all calls to _data and _removeData have been replaced + // with direct calls to dataPriv methods, these can be deprecated. + _data: function( elem, name, data ) { + return dataPriv.access( elem, name, data ); + }, + + _removeData: function( elem, name ) { + dataPriv.remove( elem, name ); + } +} ); + +jQuery.fn.extend( { + data: function( key, value ) { + var i, name, data, + elem = this[ 0 ], + attrs = elem && elem.attributes; + + // Gets all values + if ( key === undefined ) { + if ( this.length ) { + data = dataUser.get( elem ); + + if ( elem.nodeType === 1 && !dataPriv.get( elem, "hasDataAttrs" ) ) { + i = attrs.length; + while ( i-- ) { + + // Support: IE 11 only + // The attrs elements can be null (#14894) + if ( attrs[ i ] ) { + name = attrs[ i ].name; + if ( name.indexOf( "data-" ) === 0 ) { + name = jQuery.camelCase( name.slice( 5 ) ); + dataAttr( elem, name, data[ name ] ); + } + } + } + dataPriv.set( elem, "hasDataAttrs", true ); + } + } + + return data; + } + + // Sets multiple values + if ( typeof key === "object" ) { + return this.each( function() { + dataUser.set( this, key ); + } ); + } + + return access( this, function( value ) { + var data; + + // The calling jQuery object (element matches) is not empty + // (and therefore has an element appears at this[ 0 ]) and the + // `value` parameter was not undefined. An empty jQuery object + // will result in `undefined` for elem = this[ 0 ] which will + // throw an exception if an attempt to read a data cache is made. + if ( elem && value === undefined ) { + + // Attempt to get data from the cache + // The key will always be camelCased in Data + data = dataUser.get( elem, key ); + if ( data !== undefined ) { + return data; + } + + // Attempt to "discover" the data in + // HTML5 custom data-* attrs + data = dataAttr( elem, key ); + if ( data !== undefined ) { + return data; + } + + // We tried really hard, but the data doesn't exist. + return; + } + + // Set the data... + this.each( function() { + + // We always store the camelCased key + dataUser.set( this, key, value ); + } ); + }, null, value, arguments.length > 1, null, true ); + }, + + removeData: function( key ) { + return this.each( function() { + dataUser.remove( this, key ); + } ); + } +} ); + + +jQuery.extend( { + queue: function( elem, type, data ) { + var queue; + + if ( elem ) { + type = ( type || "fx" ) + "queue"; + queue = dataPriv.get( elem, type ); + + // Speed up dequeue by getting out quickly if this is just a lookup + if ( data ) { + if ( !queue || jQuery.isArray( data ) ) { + queue = dataPriv.access( elem, type, jQuery.makeArray( data ) ); + } else { + queue.push( data ); + } + } + return queue || []; + } + }, + + dequeue: function( elem, type ) { + type = type || "fx"; + + var queue = jQuery.queue( elem, type ), + startLength = queue.length, + fn = queue.shift(), + hooks = jQuery._queueHooks( elem, type ), + next = function() { + jQuery.dequeue( elem, type ); + }; + + // If the fx queue is dequeued, always remove the progress sentinel + if ( fn === "inprogress" ) { + fn = queue.shift(); + startLength--; + } + + if ( fn ) { + + // Add a progress sentinel to prevent the fx queue from being + // automatically dequeued + if ( type === "fx" ) { + queue.unshift( "inprogress" ); + } + + // Clear up the last queue stop function + delete hooks.stop; + fn.call( elem, next, hooks ); + } + + if ( !startLength && hooks ) { + hooks.empty.fire(); + } + }, + + // Not public - generate a queueHooks object, or return the current one + _queueHooks: function( elem, type ) { + var key = type + "queueHooks"; + return dataPriv.get( elem, key ) || dataPriv.access( elem, key, { + empty: jQuery.Callbacks( "once memory" ).add( function() { + dataPriv.remove( elem, [ type + "queue", key ] ); + } ) + } ); + } +} ); + +jQuery.fn.extend( { + queue: function( type, data ) { + var setter = 2; + + if ( typeof type !== "string" ) { + data = type; + type = "fx"; + setter--; + } + + if ( arguments.length < setter ) { + return jQuery.queue( this[ 0 ], type ); + } + + return data === undefined ? + this : + this.each( function() { + var queue = jQuery.queue( this, type, data ); + + // Ensure a hooks for this queue + jQuery._queueHooks( this, type ); + + if ( type === "fx" && queue[ 0 ] !== "inprogress" ) { + jQuery.dequeue( this, type ); + } + } ); + }, + dequeue: function( type ) { + return this.each( function() { + jQuery.dequeue( this, type ); + } ); + }, + clearQueue: function( type ) { + return this.queue( type || "fx", [] ); + }, + + // Get a promise resolved when queues of a certain type + // are emptied (fx is the type by default) + promise: function( type, obj ) { + var tmp, + count = 1, + defer = jQuery.Deferred(), + elements = this, + i = this.length, + resolve = function() { + if ( !( --count ) ) { + defer.resolveWith( elements, [ elements ] ); + } + }; + + if ( typeof type !== "string" ) { + obj = type; + type = undefined; + } + type = type || "fx"; + + while ( i-- ) { + tmp = dataPriv.get( elements[ i ], type + "queueHooks" ); + if ( tmp && tmp.empty ) { + count++; + tmp.empty.add( resolve ); + } + } + resolve(); + return defer.promise( obj ); + } +} ); +var pnum = ( /[+-]?(?:\d*\.|)\d+(?:[eE][+-]?\d+|)/ ).source; + +var rcssNum = new RegExp( "^(?:([+-])=|)(" + pnum + ")([a-z%]*)$", "i" ); + + +var cssExpand = [ "Top", "Right", "Bottom", "Left" ]; + +var isHiddenWithinTree = function( elem, el ) { + + // isHiddenWithinTree might be called from jQuery#filter function; + // in that case, element will be second argument + elem = el || elem; + + // Inline style trumps all + return elem.style.display === "none" || + elem.style.display === "" && + + // Otherwise, check computed style + // Support: Firefox <=43 - 45 + // Disconnected elements can have computed display: none, so first confirm that elem is + // in the document. + jQuery.contains( elem.ownerDocument, elem ) && + + jQuery.css( elem, "display" ) === "none"; + }; + +var swap = function( elem, options, callback, args ) { + var ret, name, + old = {}; + + // Remember the old values, and insert the new ones + for ( name in options ) { + old[ name ] = elem.style[ name ]; + elem.style[ name ] = options[ name ]; + } + + ret = callback.apply( elem, args || [] ); + + // Revert the old values + for ( name in options ) { + elem.style[ name ] = old[ name ]; + } + + return ret; +}; + + + + +function adjustCSS( elem, prop, valueParts, tween ) { + var adjusted, + scale = 1, + maxIterations = 20, + currentValue = tween ? + function() { + return tween.cur(); + } : + function() { + return jQuery.css( elem, prop, "" ); + }, + initial = currentValue(), + unit = valueParts && valueParts[ 3 ] || ( jQuery.cssNumber[ prop ] ? "" : "px" ), + + // Starting value computation is required for potential unit mismatches + initialInUnit = ( jQuery.cssNumber[ prop ] || unit !== "px" && +initial ) && + rcssNum.exec( jQuery.css( elem, prop ) ); + + if ( initialInUnit && initialInUnit[ 3 ] !== unit ) { + + // Trust units reported by jQuery.css + unit = unit || initialInUnit[ 3 ]; + + // Make sure we update the tween properties later on + valueParts = valueParts || []; + + // Iteratively approximate from a nonzero starting point + initialInUnit = +initial || 1; + + do { + + // If previous iteration zeroed out, double until we get *something*. + // Use string for doubling so we don't accidentally see scale as unchanged below + scale = scale || ".5"; + + // Adjust and apply + initialInUnit = initialInUnit / scale; + jQuery.style( elem, prop, initialInUnit + unit ); + + // Update scale, tolerating zero or NaN from tween.cur() + // Break the loop if scale is unchanged or perfect, or if we've just had enough. + } while ( + scale !== ( scale = currentValue() / initial ) && scale !== 1 && --maxIterations + ); + } + + if ( valueParts ) { + initialInUnit = +initialInUnit || +initial || 0; + + // Apply relative offset (+=/-=) if specified + adjusted = valueParts[ 1 ] ? + initialInUnit + ( valueParts[ 1 ] + 1 ) * valueParts[ 2 ] : + +valueParts[ 2 ]; + if ( tween ) { + tween.unit = unit; + tween.start = initialInUnit; + tween.end = adjusted; + } + } + return adjusted; +} + + +var defaultDisplayMap = {}; + +function getDefaultDisplay( elem ) { + var temp, + doc = elem.ownerDocument, + nodeName = elem.nodeName, + display = defaultDisplayMap[ nodeName ]; + + if ( display ) { + return display; + } + + temp = doc.body.appendChild( doc.createElement( nodeName ) ); + display = jQuery.css( temp, "display" ); + + temp.parentNode.removeChild( temp ); + + if ( display === "none" ) { + display = "block"; + } + defaultDisplayMap[ nodeName ] = display; + + return display; +} + +function showHide( elements, show ) { + var display, elem, + values = [], + index = 0, + length = elements.length; + + // Determine new display value for elements that need to change + for ( ; index < length; index++ ) { + elem = elements[ index ]; + if ( !elem.style ) { + continue; + } + + display = elem.style.display; + if ( show ) { + + // Since we force visibility upon cascade-hidden elements, an immediate (and slow) + // check is required in this first loop unless we have a nonempty display value (either + // inline or about-to-be-restored) + if ( display === "none" ) { + values[ index ] = dataPriv.get( elem, "display" ) || null; + if ( !values[ index ] ) { + elem.style.display = ""; + } + } + if ( elem.style.display === "" && isHiddenWithinTree( elem ) ) { + values[ index ] = getDefaultDisplay( elem ); + } + } else { + if ( display !== "none" ) { + values[ index ] = "none"; + + // Remember what we're overwriting + dataPriv.set( elem, "display", display ); + } + } + } + + // Set the display of the elements in a second loop to avoid constant reflow + for ( index = 0; index < length; index++ ) { + if ( values[ index ] != null ) { + elements[ index ].style.display = values[ index ]; + } + } + + return elements; +} + +jQuery.fn.extend( { + show: function() { + return showHide( this, true ); + }, + hide: function() { + return showHide( this ); + }, + toggle: function( state ) { + if ( typeof state === "boolean" ) { + return state ? this.show() : this.hide(); + } + + return this.each( function() { + if ( isHiddenWithinTree( this ) ) { + jQuery( this ).show(); + } else { + jQuery( this ).hide(); + } + } ); + } +} ); +var rcheckableType = ( /^(?:checkbox|radio)$/i ); + +var rtagName = ( /<([a-z][^\/\0>\x20\t\r\n\f]+)/i ); + +var rscriptType = ( /^$|\/(?:java|ecma)script/i ); + + + +// We have to close these tags to support XHTML (#13200) +var wrapMap = { + + // Support: IE <=9 only + option: [ 1, "" ], + + // XHTML parsers do not magically insert elements in the + // same way that tag soup parsers do. So we cannot shorten + // this by omitting or other required elements. + thead: [ 1, "", "
" ], + col: [ 2, "", "
" ], + tr: [ 2, "", "
" ], + td: [ 3, "", "
" ], + + _default: [ 0, "", "" ] +}; + +// Support: IE <=9 only +wrapMap.optgroup = wrapMap.option; + +wrapMap.tbody = wrapMap.tfoot = wrapMap.colgroup = wrapMap.caption = wrapMap.thead; +wrapMap.th = wrapMap.td; + + +function getAll( context, tag ) { + + // Support: IE <=9 - 11 only + // Use typeof to avoid zero-argument method invocation on host objects (#15151) + var ret; + + if ( typeof context.getElementsByTagName !== "undefined" ) { + ret = context.getElementsByTagName( tag || "*" ); + + } else if ( typeof context.querySelectorAll !== "undefined" ) { + ret = context.querySelectorAll( tag || "*" ); + + } else { + ret = []; + } + + if ( tag === undefined || tag && jQuery.nodeName( context, tag ) ) { + return jQuery.merge( [ context ], ret ); + } + + return ret; +} + + +// Mark scripts as having already been evaluated +function setGlobalEval( elems, refElements ) { + var i = 0, + l = elems.length; + + for ( ; i < l; i++ ) { + dataPriv.set( + elems[ i ], + "globalEval", + !refElements || dataPriv.get( refElements[ i ], "globalEval" ) + ); + } +} + + +var rhtml = /<|&#?\w+;/; + +function buildFragment( elems, context, scripts, selection, ignored ) { + var elem, tmp, tag, wrap, contains, j, + fragment = context.createDocumentFragment(), + nodes = [], + i = 0, + l = elems.length; + + for ( ; i < l; i++ ) { + elem = elems[ i ]; + + if ( elem || elem === 0 ) { + + // Add nodes directly + if ( jQuery.type( elem ) === "object" ) { + + // Support: Android <=4.0 only, PhantomJS 1 only + // push.apply(_, arraylike) throws on ancient WebKit + jQuery.merge( nodes, elem.nodeType ? [ elem ] : elem ); + + // Convert non-html into a text node + } else if ( !rhtml.test( elem ) ) { + nodes.push( context.createTextNode( elem ) ); + + // Convert html into DOM nodes + } else { + tmp = tmp || fragment.appendChild( context.createElement( "div" ) ); + + // Deserialize a standard representation + tag = ( rtagName.exec( elem ) || [ "", "" ] )[ 1 ].toLowerCase(); + wrap = wrapMap[ tag ] || wrapMap._default; + tmp.innerHTML = wrap[ 1 ] + jQuery.htmlPrefilter( elem ) + wrap[ 2 ]; + + // Descend through wrappers to the right content + j = wrap[ 0 ]; + while ( j-- ) { + tmp = tmp.lastChild; + } + + // Support: Android <=4.0 only, PhantomJS 1 only + // push.apply(_, arraylike) throws on ancient WebKit + jQuery.merge( nodes, tmp.childNodes ); + + // Remember the top-level container + tmp = fragment.firstChild; + + // Ensure the created nodes are orphaned (#12392) + tmp.textContent = ""; + } + } + } + + // Remove wrapper from fragment + fragment.textContent = ""; + + i = 0; + while ( ( elem = nodes[ i++ ] ) ) { + + // Skip elements already in the context collection (trac-4087) + if ( selection && jQuery.inArray( elem, selection ) > -1 ) { + if ( ignored ) { + ignored.push( elem ); + } + continue; + } + + contains = jQuery.contains( elem.ownerDocument, elem ); + + // Append to fragment + tmp = getAll( fragment.appendChild( elem ), "script" ); + + // Preserve script evaluation history + if ( contains ) { + setGlobalEval( tmp ); + } + + // Capture executables + if ( scripts ) { + j = 0; + while ( ( elem = tmp[ j++ ] ) ) { + if ( rscriptType.test( elem.type || "" ) ) { + scripts.push( elem ); + } + } + } + } + + return fragment; +} + + +( function() { + var fragment = document.createDocumentFragment(), + div = fragment.appendChild( document.createElement( "div" ) ), + input = document.createElement( "input" ); + + // Support: Android 4.0 - 4.3 only + // Check state lost if the name is set (#11217) + // Support: Windows Web Apps (WWA) + // `name` and `type` must use .setAttribute for WWA (#14901) + input.setAttribute( "type", "radio" ); + input.setAttribute( "checked", "checked" ); + input.setAttribute( "name", "t" ); + + div.appendChild( input ); + + // Support: Android <=4.1 only + // Older WebKit doesn't clone checked state correctly in fragments + support.checkClone = div.cloneNode( true ).cloneNode( true ).lastChild.checked; + + // Support: IE <=11 only + // Make sure textarea (and checkbox) defaultValue is properly cloned + div.innerHTML = ""; + support.noCloneChecked = !!div.cloneNode( true ).lastChild.defaultValue; +} )(); +var documentElement = document.documentElement; + + + +var + rkeyEvent = /^key/, + rmouseEvent = /^(?:mouse|pointer|contextmenu|drag|drop)|click/, + rtypenamespace = /^([^.]*)(?:\.(.+)|)/; + +function returnTrue() { + return true; +} + +function returnFalse() { + return false; +} + +// Support: IE <=9 only +// See #13393 for more info +function safeActiveElement() { + try { + return document.activeElement; + } catch ( err ) { } +} + +function on( elem, types, selector, data, fn, one ) { + var origFn, type; + + // Types can be a map of types/handlers + if ( typeof types === "object" ) { + + // ( types-Object, selector, data ) + if ( typeof selector !== "string" ) { + + // ( types-Object, data ) + data = data || selector; + selector = undefined; + } + for ( type in types ) { + on( elem, type, selector, data, types[ type ], one ); + } + return elem; + } + + if ( data == null && fn == null ) { + + // ( types, fn ) + fn = selector; + data = selector = undefined; + } else if ( fn == null ) { + if ( typeof selector === "string" ) { + + // ( types, selector, fn ) + fn = data; + data = undefined; + } else { + + // ( types, data, fn ) + fn = data; + data = selector; + selector = undefined; + } + } + if ( fn === false ) { + fn = returnFalse; + } else if ( !fn ) { + return elem; + } + + if ( one === 1 ) { + origFn = fn; + fn = function( event ) { + + // Can use an empty set, since event contains the info + jQuery().off( event ); + return origFn.apply( this, arguments ); + }; + + // Use same guid so caller can remove using origFn + fn.guid = origFn.guid || ( origFn.guid = jQuery.guid++ ); + } + return elem.each( function() { + jQuery.event.add( this, types, fn, data, selector ); + } ); +} + +/* + * Helper functions for managing events -- not part of the public interface. + * Props to Dean Edwards' addEvent library for many of the ideas. + */ +jQuery.event = { + + global: {}, + + add: function( elem, types, handler, data, selector ) { + + var handleObjIn, eventHandle, tmp, + events, t, handleObj, + special, handlers, type, namespaces, origType, + elemData = dataPriv.get( elem ); + + // Don't attach events to noData or text/comment nodes (but allow plain objects) + if ( !elemData ) { + return; + } + + // Caller can pass in an object of custom data in lieu of the handler + if ( handler.handler ) { + handleObjIn = handler; + handler = handleObjIn.handler; + selector = handleObjIn.selector; + } + + // Ensure that invalid selectors throw exceptions at attach time + // Evaluate against documentElement in case elem is a non-element node (e.g., document) + if ( selector ) { + jQuery.find.matchesSelector( documentElement, selector ); + } + + // Make sure that the handler has a unique ID, used to find/remove it later + if ( !handler.guid ) { + handler.guid = jQuery.guid++; + } + + // Init the element's event structure and main handler, if this is the first + if ( !( events = elemData.events ) ) { + events = elemData.events = {}; + } + if ( !( eventHandle = elemData.handle ) ) { + eventHandle = elemData.handle = function( e ) { + + // Discard the second event of a jQuery.event.trigger() and + // when an event is called after a page has unloaded + return typeof jQuery !== "undefined" && jQuery.event.triggered !== e.type ? + jQuery.event.dispatch.apply( elem, arguments ) : undefined; + }; + } + + // Handle multiple events separated by a space + types = ( types || "" ).match( rnothtmlwhite ) || [ "" ]; + t = types.length; + while ( t-- ) { + tmp = rtypenamespace.exec( types[ t ] ) || []; + type = origType = tmp[ 1 ]; + namespaces = ( tmp[ 2 ] || "" ).split( "." ).sort(); + + // There *must* be a type, no attaching namespace-only handlers + if ( !type ) { + continue; + } + + // If event changes its type, use the special event handlers for the changed type + special = jQuery.event.special[ type ] || {}; + + // If selector defined, determine special event api type, otherwise given type + type = ( selector ? special.delegateType : special.bindType ) || type; + + // Update special based on newly reset type + special = jQuery.event.special[ type ] || {}; + + // handleObj is passed to all event handlers + handleObj = jQuery.extend( { + type: type, + origType: origType, + data: data, + handler: handler, + guid: handler.guid, + selector: selector, + needsContext: selector && jQuery.expr.match.needsContext.test( selector ), + namespace: namespaces.join( "." ) + }, handleObjIn ); + + // Init the event handler queue if we're the first + if ( !( handlers = events[ type ] ) ) { + handlers = events[ type ] = []; + handlers.delegateCount = 0; + + // Only use addEventListener if the special events handler returns false + if ( !special.setup || + special.setup.call( elem, data, namespaces, eventHandle ) === false ) { + + if ( elem.addEventListener ) { + elem.addEventListener( type, eventHandle ); + } + } + } + + if ( special.add ) { + special.add.call( elem, handleObj ); + + if ( !handleObj.handler.guid ) { + handleObj.handler.guid = handler.guid; + } + } + + // Add to the element's handler list, delegates in front + if ( selector ) { + handlers.splice( handlers.delegateCount++, 0, handleObj ); + } else { + handlers.push( handleObj ); + } + + // Keep track of which events have ever been used, for event optimization + jQuery.event.global[ type ] = true; + } + + }, + + // Detach an event or set of events from an element + remove: function( elem, types, handler, selector, mappedTypes ) { + + var j, origCount, tmp, + events, t, handleObj, + special, handlers, type, namespaces, origType, + elemData = dataPriv.hasData( elem ) && dataPriv.get( elem ); + + if ( !elemData || !( events = elemData.events ) ) { + return; + } + + // Once for each type.namespace in types; type may be omitted + types = ( types || "" ).match( rnothtmlwhite ) || [ "" ]; + t = types.length; + while ( t-- ) { + tmp = rtypenamespace.exec( types[ t ] ) || []; + type = origType = tmp[ 1 ]; + namespaces = ( tmp[ 2 ] || "" ).split( "." ).sort(); + + // Unbind all events (on this namespace, if provided) for the element + if ( !type ) { + for ( type in events ) { + jQuery.event.remove( elem, type + types[ t ], handler, selector, true ); + } + continue; + } + + special = jQuery.event.special[ type ] || {}; + type = ( selector ? special.delegateType : special.bindType ) || type; + handlers = events[ type ] || []; + tmp = tmp[ 2 ] && + new RegExp( "(^|\\.)" + namespaces.join( "\\.(?:.*\\.|)" ) + "(\\.|$)" ); + + // Remove matching events + origCount = j = handlers.length; + while ( j-- ) { + handleObj = handlers[ j ]; + + if ( ( mappedTypes || origType === handleObj.origType ) && + ( !handler || handler.guid === handleObj.guid ) && + ( !tmp || tmp.test( handleObj.namespace ) ) && + ( !selector || selector === handleObj.selector || + selector === "**" && handleObj.selector ) ) { + handlers.splice( j, 1 ); + + if ( handleObj.selector ) { + handlers.delegateCount--; + } + if ( special.remove ) { + special.remove.call( elem, handleObj ); + } + } + } + + // Remove generic event handler if we removed something and no more handlers exist + // (avoids potential for endless recursion during removal of special event handlers) + if ( origCount && !handlers.length ) { + if ( !special.teardown || + special.teardown.call( elem, namespaces, elemData.handle ) === false ) { + + jQuery.removeEvent( elem, type, elemData.handle ); + } + + delete events[ type ]; + } + } + + // Remove data and the expando if it's no longer used + if ( jQuery.isEmptyObject( events ) ) { + dataPriv.remove( elem, "handle events" ); + } + }, + + dispatch: function( nativeEvent ) { + + // Make a writable jQuery.Event from the native event object + var event = jQuery.event.fix( nativeEvent ); + + var i, j, ret, matched, handleObj, handlerQueue, + args = new Array( arguments.length ), + handlers = ( dataPriv.get( this, "events" ) || {} )[ event.type ] || [], + special = jQuery.event.special[ event.type ] || {}; + + // Use the fix-ed jQuery.Event rather than the (read-only) native event + args[ 0 ] = event; + + for ( i = 1; i < arguments.length; i++ ) { + args[ i ] = arguments[ i ]; + } + + event.delegateTarget = this; + + // Call the preDispatch hook for the mapped type, and let it bail if desired + if ( special.preDispatch && special.preDispatch.call( this, event ) === false ) { + return; + } + + // Determine handlers + handlerQueue = jQuery.event.handlers.call( this, event, handlers ); + + // Run delegates first; they may want to stop propagation beneath us + i = 0; + while ( ( matched = handlerQueue[ i++ ] ) && !event.isPropagationStopped() ) { + event.currentTarget = matched.elem; + + j = 0; + while ( ( handleObj = matched.handlers[ j++ ] ) && + !event.isImmediatePropagationStopped() ) { + + // Triggered event must either 1) have no namespace, or 2) have namespace(s) + // a subset or equal to those in the bound event (both can have no namespace). + if ( !event.rnamespace || event.rnamespace.test( handleObj.namespace ) ) { + + event.handleObj = handleObj; + event.data = handleObj.data; + + ret = ( ( jQuery.event.special[ handleObj.origType ] || {} ).handle || + handleObj.handler ).apply( matched.elem, args ); + + if ( ret !== undefined ) { + if ( ( event.result = ret ) === false ) { + event.preventDefault(); + event.stopPropagation(); + } + } + } + } + } + + // Call the postDispatch hook for the mapped type + if ( special.postDispatch ) { + special.postDispatch.call( this, event ); + } + + return event.result; + }, + + handlers: function( event, handlers ) { + var i, handleObj, sel, matchedHandlers, matchedSelectors, + handlerQueue = [], + delegateCount = handlers.delegateCount, + cur = event.target; + + // Find delegate handlers + if ( delegateCount && + + // Support: IE <=9 + // Black-hole SVG instance trees (trac-13180) + cur.nodeType && + + // Support: Firefox <=42 + // Suppress spec-violating clicks indicating a non-primary pointer button (trac-3861) + // https://www.w3.org/TR/DOM-Level-3-Events/#event-type-click + // Support: IE 11 only + // ...but not arrow key "clicks" of radio inputs, which can have `button` -1 (gh-2343) + !( event.type === "click" && event.button >= 1 ) ) { + + for ( ; cur !== this; cur = cur.parentNode || this ) { + + // Don't check non-elements (#13208) + // Don't process clicks on disabled elements (#6911, #8165, #11382, #11764) + if ( cur.nodeType === 1 && !( event.type === "click" && cur.disabled === true ) ) { + matchedHandlers = []; + matchedSelectors = {}; + for ( i = 0; i < delegateCount; i++ ) { + handleObj = handlers[ i ]; + + // Don't conflict with Object.prototype properties (#13203) + sel = handleObj.selector + " "; + + if ( matchedSelectors[ sel ] === undefined ) { + matchedSelectors[ sel ] = handleObj.needsContext ? + jQuery( sel, this ).index( cur ) > -1 : + jQuery.find( sel, this, null, [ cur ] ).length; + } + if ( matchedSelectors[ sel ] ) { + matchedHandlers.push( handleObj ); + } + } + if ( matchedHandlers.length ) { + handlerQueue.push( { elem: cur, handlers: matchedHandlers } ); + } + } + } + } + + // Add the remaining (directly-bound) handlers + cur = this; + if ( delegateCount < handlers.length ) { + handlerQueue.push( { elem: cur, handlers: handlers.slice( delegateCount ) } ); + } + + return handlerQueue; + }, + + addProp: function( name, hook ) { + Object.defineProperty( jQuery.Event.prototype, name, { + enumerable: true, + configurable: true, + + get: jQuery.isFunction( hook ) ? + function() { + if ( this.originalEvent ) { + return hook( this.originalEvent ); + } + } : + function() { + if ( this.originalEvent ) { + return this.originalEvent[ name ]; + } + }, + + set: function( value ) { + Object.defineProperty( this, name, { + enumerable: true, + configurable: true, + writable: true, + value: value + } ); + } + } ); + }, + + fix: function( originalEvent ) { + return originalEvent[ jQuery.expando ] ? + originalEvent : + new jQuery.Event( originalEvent ); + }, + + special: { + load: { + + // Prevent triggered image.load events from bubbling to window.load + noBubble: true + }, + focus: { + + // Fire native event if possible so blur/focus sequence is correct + trigger: function() { + if ( this !== safeActiveElement() && this.focus ) { + this.focus(); + return false; + } + }, + delegateType: "focusin" + }, + blur: { + trigger: function() { + if ( this === safeActiveElement() && this.blur ) { + this.blur(); + return false; + } + }, + delegateType: "focusout" + }, + click: { + + // For checkbox, fire native event so checked state will be right + trigger: function() { + if ( this.type === "checkbox" && this.click && jQuery.nodeName( this, "input" ) ) { + this.click(); + return false; + } + }, + + // For cross-browser consistency, don't fire native .click() on links + _default: function( event ) { + return jQuery.nodeName( event.target, "a" ); + } + }, + + beforeunload: { + postDispatch: function( event ) { + + // Support: Firefox 20+ + // Firefox doesn't alert if the returnValue field is not set. + if ( event.result !== undefined && event.originalEvent ) { + event.originalEvent.returnValue = event.result; + } + } + } + } +}; + +jQuery.removeEvent = function( elem, type, handle ) { + + // This "if" is needed for plain objects + if ( elem.removeEventListener ) { + elem.removeEventListener( type, handle ); + } +}; + +jQuery.Event = function( src, props ) { + + // Allow instantiation without the 'new' keyword + if ( !( this instanceof jQuery.Event ) ) { + return new jQuery.Event( src, props ); + } + + // Event object + if ( src && src.type ) { + this.originalEvent = src; + this.type = src.type; + + // Events bubbling up the document may have been marked as prevented + // by a handler lower down the tree; reflect the correct value. + this.isDefaultPrevented = src.defaultPrevented || + src.defaultPrevented === undefined && + + // Support: Android <=2.3 only + src.returnValue === false ? + returnTrue : + returnFalse; + + // Create target properties + // Support: Safari <=6 - 7 only + // Target should not be a text node (#504, #13143) + this.target = ( src.target && src.target.nodeType === 3 ) ? + src.target.parentNode : + src.target; + + this.currentTarget = src.currentTarget; + this.relatedTarget = src.relatedTarget; + + // Event type + } else { + this.type = src; + } + + // Put explicitly provided properties onto the event object + if ( props ) { + jQuery.extend( this, props ); + } + + // Create a timestamp if incoming event doesn't have one + this.timeStamp = src && src.timeStamp || jQuery.now(); + + // Mark it as fixed + this[ jQuery.expando ] = true; +}; + +// jQuery.Event is based on DOM3 Events as specified by the ECMAScript Language Binding +// https://www.w3.org/TR/2003/WD-DOM-Level-3-Events-20030331/ecma-script-binding.html +jQuery.Event.prototype = { + constructor: jQuery.Event, + isDefaultPrevented: returnFalse, + isPropagationStopped: returnFalse, + isImmediatePropagationStopped: returnFalse, + isSimulated: false, + + preventDefault: function() { + var e = this.originalEvent; + + this.isDefaultPrevented = returnTrue; + + if ( e && !this.isSimulated ) { + e.preventDefault(); + } + }, + stopPropagation: function() { + var e = this.originalEvent; + + this.isPropagationStopped = returnTrue; + + if ( e && !this.isSimulated ) { + e.stopPropagation(); + } + }, + stopImmediatePropagation: function() { + var e = this.originalEvent; + + this.isImmediatePropagationStopped = returnTrue; + + if ( e && !this.isSimulated ) { + e.stopImmediatePropagation(); + } + + this.stopPropagation(); + } +}; + +// Includes all common event props including KeyEvent and MouseEvent specific props +jQuery.each( { + altKey: true, + bubbles: true, + cancelable: true, + changedTouches: true, + ctrlKey: true, + detail: true, + eventPhase: true, + metaKey: true, + pageX: true, + pageY: true, + shiftKey: true, + view: true, + "char": true, + charCode: true, + key: true, + keyCode: true, + button: true, + buttons: true, + clientX: true, + clientY: true, + offsetX: true, + offsetY: true, + pointerId: true, + pointerType: true, + screenX: true, + screenY: true, + targetTouches: true, + toElement: true, + touches: true, + + which: function( event ) { + var button = event.button; + + // Add which for key events + if ( event.which == null && rkeyEvent.test( event.type ) ) { + return event.charCode != null ? event.charCode : event.keyCode; + } + + // Add which for click: 1 === left; 2 === middle; 3 === right + if ( !event.which && button !== undefined && rmouseEvent.test( event.type ) ) { + if ( button & 1 ) { + return 1; + } + + if ( button & 2 ) { + return 3; + } + + if ( button & 4 ) { + return 2; + } + + return 0; + } + + return event.which; + } +}, jQuery.event.addProp ); + +// Create mouseenter/leave events using mouseover/out and event-time checks +// so that event delegation works in jQuery. +// Do the same for pointerenter/pointerleave and pointerover/pointerout +// +// Support: Safari 7 only +// Safari sends mouseenter too often; see: +// https://bugs.chromium.org/p/chromium/issues/detail?id=470258 +// for the description of the bug (it existed in older Chrome versions as well). +jQuery.each( { + mouseenter: "mouseover", + mouseleave: "mouseout", + pointerenter: "pointerover", + pointerleave: "pointerout" +}, function( orig, fix ) { + jQuery.event.special[ orig ] = { + delegateType: fix, + bindType: fix, + + handle: function( event ) { + var ret, + target = this, + related = event.relatedTarget, + handleObj = event.handleObj; + + // For mouseenter/leave call the handler if related is outside the target. + // NB: No relatedTarget if the mouse left/entered the browser window + if ( !related || ( related !== target && !jQuery.contains( target, related ) ) ) { + event.type = handleObj.origType; + ret = handleObj.handler.apply( this, arguments ); + event.type = fix; + } + return ret; + } + }; +} ); + +jQuery.fn.extend( { + + on: function( types, selector, data, fn ) { + return on( this, types, selector, data, fn ); + }, + one: function( types, selector, data, fn ) { + return on( this, types, selector, data, fn, 1 ); + }, + off: function( types, selector, fn ) { + var handleObj, type; + if ( types && types.preventDefault && types.handleObj ) { + + // ( event ) dispatched jQuery.Event + handleObj = types.handleObj; + jQuery( types.delegateTarget ).off( + handleObj.namespace ? + handleObj.origType + "." + handleObj.namespace : + handleObj.origType, + handleObj.selector, + handleObj.handler + ); + return this; + } + if ( typeof types === "object" ) { + + // ( types-object [, selector] ) + for ( type in types ) { + this.off( type, selector, types[ type ] ); + } + return this; + } + if ( selector === false || typeof selector === "function" ) { + + // ( types [, fn] ) + fn = selector; + selector = undefined; + } + if ( fn === false ) { + fn = returnFalse; + } + return this.each( function() { + jQuery.event.remove( this, types, fn, selector ); + } ); + } +} ); + + +var + + /* eslint-disable max-len */ + + // See https://github.com/eslint/eslint/issues/3229 + rxhtmlTag = /<(?!area|br|col|embed|hr|img|input|link|meta|param)(([a-z][^\/\0>\x20\t\r\n\f]*)[^>]*)\/>/gi, + + /* eslint-enable */ + + // Support: IE <=10 - 11, Edge 12 - 13 + // In IE/Edge using regex groups here causes severe slowdowns. + // See https://connect.microsoft.com/IE/feedback/details/1736512/ + rnoInnerhtml = /\s*$/g; + +function manipulationTarget( elem, content ) { + if ( jQuery.nodeName( elem, "table" ) && + jQuery.nodeName( content.nodeType !== 11 ? content : content.firstChild, "tr" ) ) { + + return elem.getElementsByTagName( "tbody" )[ 0 ] || elem; + } + + return elem; +} + +// Replace/restore the type attribute of script elements for safe DOM manipulation +function disableScript( elem ) { + elem.type = ( elem.getAttribute( "type" ) !== null ) + "/" + elem.type; + return elem; +} +function restoreScript( elem ) { + var match = rscriptTypeMasked.exec( elem.type ); + + if ( match ) { + elem.type = match[ 1 ]; + } else { + elem.removeAttribute( "type" ); + } + + return elem; +} + +function cloneCopyEvent( src, dest ) { + var i, l, type, pdataOld, pdataCur, udataOld, udataCur, events; + + if ( dest.nodeType !== 1 ) { + return; + } + + // 1. Copy private data: events, handlers, etc. + if ( dataPriv.hasData( src ) ) { + pdataOld = dataPriv.access( src ); + pdataCur = dataPriv.set( dest, pdataOld ); + events = pdataOld.events; + + if ( events ) { + delete pdataCur.handle; + pdataCur.events = {}; + + for ( type in events ) { + for ( i = 0, l = events[ type ].length; i < l; i++ ) { + jQuery.event.add( dest, type, events[ type ][ i ] ); + } + } + } + } + + // 2. Copy user data + if ( dataUser.hasData( src ) ) { + udataOld = dataUser.access( src ); + udataCur = jQuery.extend( {}, udataOld ); + + dataUser.set( dest, udataCur ); + } +} + +// Fix IE bugs, see support tests +function fixInput( src, dest ) { + var nodeName = dest.nodeName.toLowerCase(); + + // Fails to persist the checked state of a cloned checkbox or radio button. + if ( nodeName === "input" && rcheckableType.test( src.type ) ) { + dest.checked = src.checked; + + // Fails to return the selected option to the default selected state when cloning options + } else if ( nodeName === "input" || nodeName === "textarea" ) { + dest.defaultValue = src.defaultValue; + } +} + +function domManip( collection, args, callback, ignored ) { + + // Flatten any nested arrays + args = concat.apply( [], args ); + + var fragment, first, scripts, hasScripts, node, doc, + i = 0, + l = collection.length, + iNoClone = l - 1, + value = args[ 0 ], + isFunction = jQuery.isFunction( value ); + + // We can't cloneNode fragments that contain checked, in WebKit + if ( isFunction || + ( l > 1 && typeof value === "string" && + !support.checkClone && rchecked.test( value ) ) ) { + return collection.each( function( index ) { + var self = collection.eq( index ); + if ( isFunction ) { + args[ 0 ] = value.call( this, index, self.html() ); + } + domManip( self, args, callback, ignored ); + } ); + } + + if ( l ) { + fragment = buildFragment( args, collection[ 0 ].ownerDocument, false, collection, ignored ); + first = fragment.firstChild; + + if ( fragment.childNodes.length === 1 ) { + fragment = first; + } + + // Require either new content or an interest in ignored elements to invoke the callback + if ( first || ignored ) { + scripts = jQuery.map( getAll( fragment, "script" ), disableScript ); + hasScripts = scripts.length; + + // Use the original fragment for the last item + // instead of the first because it can end up + // being emptied incorrectly in certain situations (#8070). + for ( ; i < l; i++ ) { + node = fragment; + + if ( i !== iNoClone ) { + node = jQuery.clone( node, true, true ); + + // Keep references to cloned scripts for later restoration + if ( hasScripts ) { + + // Support: Android <=4.0 only, PhantomJS 1 only + // push.apply(_, arraylike) throws on ancient WebKit + jQuery.merge( scripts, getAll( node, "script" ) ); + } + } + + callback.call( collection[ i ], node, i ); + } + + if ( hasScripts ) { + doc = scripts[ scripts.length - 1 ].ownerDocument; + + // Reenable scripts + jQuery.map( scripts, restoreScript ); + + // Evaluate executable scripts on first document insertion + for ( i = 0; i < hasScripts; i++ ) { + node = scripts[ i ]; + if ( rscriptType.test( node.type || "" ) && + !dataPriv.access( node, "globalEval" ) && + jQuery.contains( doc, node ) ) { + + if ( node.src ) { + + // Optional AJAX dependency, but won't run scripts if not present + if ( jQuery._evalUrl ) { + jQuery._evalUrl( node.src ); + } + } else { + DOMEval( node.textContent.replace( rcleanScript, "" ), doc ); + } + } + } + } + } + } + + return collection; +} + +function remove( elem, selector, keepData ) { + var node, + nodes = selector ? jQuery.filter( selector, elem ) : elem, + i = 0; + + for ( ; ( node = nodes[ i ] ) != null; i++ ) { + if ( !keepData && node.nodeType === 1 ) { + jQuery.cleanData( getAll( node ) ); + } + + if ( node.parentNode ) { + if ( keepData && jQuery.contains( node.ownerDocument, node ) ) { + setGlobalEval( getAll( node, "script" ) ); + } + node.parentNode.removeChild( node ); + } + } + + return elem; +} + +jQuery.extend( { + htmlPrefilter: function( html ) { + return html.replace( rxhtmlTag, "<$1>" ); + }, + + clone: function( elem, dataAndEvents, deepDataAndEvents ) { + var i, l, srcElements, destElements, + clone = elem.cloneNode( true ), + inPage = jQuery.contains( elem.ownerDocument, elem ); + + // Fix IE cloning issues + if ( !support.noCloneChecked && ( elem.nodeType === 1 || elem.nodeType === 11 ) && + !jQuery.isXMLDoc( elem ) ) { + + // We eschew Sizzle here for performance reasons: https://jsperf.com/getall-vs-sizzle/2 + destElements = getAll( clone ); + srcElements = getAll( elem ); + + for ( i = 0, l = srcElements.length; i < l; i++ ) { + fixInput( srcElements[ i ], destElements[ i ] ); + } + } + + // Copy the events from the original to the clone + if ( dataAndEvents ) { + if ( deepDataAndEvents ) { + srcElements = srcElements || getAll( elem ); + destElements = destElements || getAll( clone ); + + for ( i = 0, l = srcElements.length; i < l; i++ ) { + cloneCopyEvent( srcElements[ i ], destElements[ i ] ); + } + } else { + cloneCopyEvent( elem, clone ); + } + } + + // Preserve script evaluation history + destElements = getAll( clone, "script" ); + if ( destElements.length > 0 ) { + setGlobalEval( destElements, !inPage && getAll( elem, "script" ) ); + } + + // Return the cloned set + return clone; + }, + + cleanData: function( elems ) { + var data, elem, type, + special = jQuery.event.special, + i = 0; + + for ( ; ( elem = elems[ i ] ) !== undefined; i++ ) { + if ( acceptData( elem ) ) { + if ( ( data = elem[ dataPriv.expando ] ) ) { + if ( data.events ) { + for ( type in data.events ) { + if ( special[ type ] ) { + jQuery.event.remove( elem, type ); + + // This is a shortcut to avoid jQuery.event.remove's overhead + } else { + jQuery.removeEvent( elem, type, data.handle ); + } + } + } + + // Support: Chrome <=35 - 45+ + // Assign undefined instead of using delete, see Data#remove + elem[ dataPriv.expando ] = undefined; + } + if ( elem[ dataUser.expando ] ) { + + // Support: Chrome <=35 - 45+ + // Assign undefined instead of using delete, see Data#remove + elem[ dataUser.expando ] = undefined; + } + } + } + } +} ); + +jQuery.fn.extend( { + detach: function( selector ) { + return remove( this, selector, true ); + }, + + remove: function( selector ) { + return remove( this, selector ); + }, + + text: function( value ) { + return access( this, function( value ) { + return value === undefined ? + jQuery.text( this ) : + this.empty().each( function() { + if ( this.nodeType === 1 || this.nodeType === 11 || this.nodeType === 9 ) { + this.textContent = value; + } + } ); + }, null, value, arguments.length ); + }, + + append: function() { + return domManip( this, arguments, function( elem ) { + if ( this.nodeType === 1 || this.nodeType === 11 || this.nodeType === 9 ) { + var target = manipulationTarget( this, elem ); + target.appendChild( elem ); + } + } ); + }, + + prepend: function() { + return domManip( this, arguments, function( elem ) { + if ( this.nodeType === 1 || this.nodeType === 11 || this.nodeType === 9 ) { + var target = manipulationTarget( this, elem ); + target.insertBefore( elem, target.firstChild ); + } + } ); + }, + + before: function() { + return domManip( this, arguments, function( elem ) { + if ( this.parentNode ) { + this.parentNode.insertBefore( elem, this ); + } + } ); + }, + + after: function() { + return domManip( this, arguments, function( elem ) { + if ( this.parentNode ) { + this.parentNode.insertBefore( elem, this.nextSibling ); + } + } ); + }, + + empty: function() { + var elem, + i = 0; + + for ( ; ( elem = this[ i ] ) != null; i++ ) { + if ( elem.nodeType === 1 ) { + + // Prevent memory leaks + jQuery.cleanData( getAll( elem, false ) ); + + // Remove any remaining nodes + elem.textContent = ""; + } + } + + return this; + }, + + clone: function( dataAndEvents, deepDataAndEvents ) { + dataAndEvents = dataAndEvents == null ? false : dataAndEvents; + deepDataAndEvents = deepDataAndEvents == null ? dataAndEvents : deepDataAndEvents; + + return this.map( function() { + return jQuery.clone( this, dataAndEvents, deepDataAndEvents ); + } ); + }, + + html: function( value ) { + return access( this, function( value ) { + var elem = this[ 0 ] || {}, + i = 0, + l = this.length; + + if ( value === undefined && elem.nodeType === 1 ) { + return elem.innerHTML; + } + + // See if we can take a shortcut and just use innerHTML + if ( typeof value === "string" && !rnoInnerhtml.test( value ) && + !wrapMap[ ( rtagName.exec( value ) || [ "", "" ] )[ 1 ].toLowerCase() ] ) { + + value = jQuery.htmlPrefilter( value ); + + try { + for ( ; i < l; i++ ) { + elem = this[ i ] || {}; + + // Remove element nodes and prevent memory leaks + if ( elem.nodeType === 1 ) { + jQuery.cleanData( getAll( elem, false ) ); + elem.innerHTML = value; + } + } + + elem = 0; + + // If using innerHTML throws an exception, use the fallback method + } catch ( e ) {} + } + + if ( elem ) { + this.empty().append( value ); + } + }, null, value, arguments.length ); + }, + + replaceWith: function() { + var ignored = []; + + // Make the changes, replacing each non-ignored context element with the new content + return domManip( this, arguments, function( elem ) { + var parent = this.parentNode; + + if ( jQuery.inArray( this, ignored ) < 0 ) { + jQuery.cleanData( getAll( this ) ); + if ( parent ) { + parent.replaceChild( elem, this ); + } + } + + // Force callback invocation + }, ignored ); + } +} ); + +jQuery.each( { + appendTo: "append", + prependTo: "prepend", + insertBefore: "before", + insertAfter: "after", + replaceAll: "replaceWith" +}, function( name, original ) { + jQuery.fn[ name ] = function( selector ) { + var elems, + ret = [], + insert = jQuery( selector ), + last = insert.length - 1, + i = 0; + + for ( ; i <= last; i++ ) { + elems = i === last ? this : this.clone( true ); + jQuery( insert[ i ] )[ original ]( elems ); + + // Support: Android <=4.0 only, PhantomJS 1 only + // .get() because push.apply(_, arraylike) throws on ancient WebKit + push.apply( ret, elems.get() ); + } + + return this.pushStack( ret ); + }; +} ); +var rmargin = ( /^margin/ ); + +var rnumnonpx = new RegExp( "^(" + pnum + ")(?!px)[a-z%]+$", "i" ); + +var getStyles = function( elem ) { + + // Support: IE <=11 only, Firefox <=30 (#15098, #14150) + // IE throws on elements created in popups + // FF meanwhile throws on frame elements through "defaultView.getComputedStyle" + var view = elem.ownerDocument.defaultView; + + if ( !view || !view.opener ) { + view = window; + } + + return view.getComputedStyle( elem ); + }; + + + +( function() { + + // Executing both pixelPosition & boxSizingReliable tests require only one layout + // so they're executed at the same time to save the second computation. + function computeStyleTests() { + + // This is a singleton, we need to execute it only once + if ( !div ) { + return; + } + + div.style.cssText = + "box-sizing:border-box;" + + "position:relative;display:block;" + + "margin:auto;border:1px;padding:1px;" + + "top:1%;width:50%"; + div.innerHTML = ""; + documentElement.appendChild( container ); + + var divStyle = window.getComputedStyle( div ); + pixelPositionVal = divStyle.top !== "1%"; + + // Support: Android 4.0 - 4.3 only, Firefox <=3 - 44 + reliableMarginLeftVal = divStyle.marginLeft === "2px"; + boxSizingReliableVal = divStyle.width === "4px"; + + // Support: Android 4.0 - 4.3 only + // Some styles come back with percentage values, even though they shouldn't + div.style.marginRight = "50%"; + pixelMarginRightVal = divStyle.marginRight === "4px"; + + documentElement.removeChild( container ); + + // Nullify the div so it wouldn't be stored in the memory and + // it will also be a sign that checks already performed + div = null; + } + + var pixelPositionVal, boxSizingReliableVal, pixelMarginRightVal, reliableMarginLeftVal, + container = document.createElement( "div" ), + div = document.createElement( "div" ); + + // Finish early in limited (non-browser) environments + if ( !div.style ) { + return; + } + + // Support: IE <=9 - 11 only + // Style of cloned element affects source element cloned (#8908) + div.style.backgroundClip = "content-box"; + div.cloneNode( true ).style.backgroundClip = ""; + support.clearCloneStyle = div.style.backgroundClip === "content-box"; + + container.style.cssText = "border:0;width:8px;height:0;top:0;left:-9999px;" + + "padding:0;margin-top:1px;position:absolute"; + container.appendChild( div ); + + jQuery.extend( support, { + pixelPosition: function() { + computeStyleTests(); + return pixelPositionVal; + }, + boxSizingReliable: function() { + computeStyleTests(); + return boxSizingReliableVal; + }, + pixelMarginRight: function() { + computeStyleTests(); + return pixelMarginRightVal; + }, + reliableMarginLeft: function() { + computeStyleTests(); + return reliableMarginLeftVal; + } + } ); +} )(); + + +function curCSS( elem, name, computed ) { + var width, minWidth, maxWidth, ret, + style = elem.style; + + computed = computed || getStyles( elem ); + + // Support: IE <=9 only + // getPropertyValue is only needed for .css('filter') (#12537) + if ( computed ) { + ret = computed.getPropertyValue( name ) || computed[ name ]; + + if ( ret === "" && !jQuery.contains( elem.ownerDocument, elem ) ) { + ret = jQuery.style( elem, name ); + } + + // A tribute to the "awesome hack by Dean Edwards" + // Android Browser returns percentage for some values, + // but width seems to be reliably pixels. + // This is against the CSSOM draft spec: + // https://drafts.csswg.org/cssom/#resolved-values + if ( !support.pixelMarginRight() && rnumnonpx.test( ret ) && rmargin.test( name ) ) { + + // Remember the original values + width = style.width; + minWidth = style.minWidth; + maxWidth = style.maxWidth; + + // Put in the new values to get a computed value out + style.minWidth = style.maxWidth = style.width = ret; + ret = computed.width; + + // Revert the changed values + style.width = width; + style.minWidth = minWidth; + style.maxWidth = maxWidth; + } + } + + return ret !== undefined ? + + // Support: IE <=9 - 11 only + // IE returns zIndex value as an integer. + ret + "" : + ret; +} + + +function addGetHookIf( conditionFn, hookFn ) { + + // Define the hook, we'll check on the first run if it's really needed. + return { + get: function() { + if ( conditionFn() ) { + + // Hook not needed (or it's not possible to use it due + // to missing dependency), remove it. + delete this.get; + return; + } + + // Hook needed; redefine it so that the support test is not executed again. + return ( this.get = hookFn ).apply( this, arguments ); + } + }; +} + + +var + + // Swappable if display is none or starts with table + // except "table", "table-cell", or "table-caption" + // See here for display values: https://developer.mozilla.org/en-US/docs/CSS/display + rdisplayswap = /^(none|table(?!-c[ea]).+)/, + cssShow = { position: "absolute", visibility: "hidden", display: "block" }, + cssNormalTransform = { + letterSpacing: "0", + fontWeight: "400" + }, + + cssPrefixes = [ "Webkit", "Moz", "ms" ], + emptyStyle = document.createElement( "div" ).style; + +// Return a css property mapped to a potentially vendor prefixed property +function vendorPropName( name ) { + + // Shortcut for names that are not vendor prefixed + if ( name in emptyStyle ) { + return name; + } + + // Check for vendor prefixed names + var capName = name[ 0 ].toUpperCase() + name.slice( 1 ), + i = cssPrefixes.length; + + while ( i-- ) { + name = cssPrefixes[ i ] + capName; + if ( name in emptyStyle ) { + return name; + } + } +} + +function setPositiveNumber( elem, value, subtract ) { + + // Any relative (+/-) values have already been + // normalized at this point + var matches = rcssNum.exec( value ); + return matches ? + + // Guard against undefined "subtract", e.g., when used as in cssHooks + Math.max( 0, matches[ 2 ] - ( subtract || 0 ) ) + ( matches[ 3 ] || "px" ) : + value; +} + +function augmentWidthOrHeight( elem, name, extra, isBorderBox, styles ) { + var i, + val = 0; + + // If we already have the right measurement, avoid augmentation + if ( extra === ( isBorderBox ? "border" : "content" ) ) { + i = 4; + + // Otherwise initialize for horizontal or vertical properties + } else { + i = name === "width" ? 1 : 0; + } + + for ( ; i < 4; i += 2 ) { + + // Both box models exclude margin, so add it if we want it + if ( extra === "margin" ) { + val += jQuery.css( elem, extra + cssExpand[ i ], true, styles ); + } + + if ( isBorderBox ) { + + // border-box includes padding, so remove it if we want content + if ( extra === "content" ) { + val -= jQuery.css( elem, "padding" + cssExpand[ i ], true, styles ); + } + + // At this point, extra isn't border nor margin, so remove border + if ( extra !== "margin" ) { + val -= jQuery.css( elem, "border" + cssExpand[ i ] + "Width", true, styles ); + } + } else { + + // At this point, extra isn't content, so add padding + val += jQuery.css( elem, "padding" + cssExpand[ i ], true, styles ); + + // At this point, extra isn't content nor padding, so add border + if ( extra !== "padding" ) { + val += jQuery.css( elem, "border" + cssExpand[ i ] + "Width", true, styles ); + } + } + } + + return val; +} + +function getWidthOrHeight( elem, name, extra ) { + + // Start with offset property, which is equivalent to the border-box value + var val, + valueIsBorderBox = true, + styles = getStyles( elem ), + isBorderBox = jQuery.css( elem, "boxSizing", false, styles ) === "border-box"; + + // Support: IE <=11 only + // Running getBoundingClientRect on a disconnected node + // in IE throws an error. + if ( elem.getClientRects().length ) { + val = elem.getBoundingClientRect()[ name ]; + } + + // Some non-html elements return undefined for offsetWidth, so check for null/undefined + // svg - https://bugzilla.mozilla.org/show_bug.cgi?id=649285 + // MathML - https://bugzilla.mozilla.org/show_bug.cgi?id=491668 + if ( val <= 0 || val == null ) { + + // Fall back to computed then uncomputed css if necessary + val = curCSS( elem, name, styles ); + if ( val < 0 || val == null ) { + val = elem.style[ name ]; + } + + // Computed unit is not pixels. Stop here and return. + if ( rnumnonpx.test( val ) ) { + return val; + } + + // Check for style in case a browser which returns unreliable values + // for getComputedStyle silently falls back to the reliable elem.style + valueIsBorderBox = isBorderBox && + ( support.boxSizingReliable() || val === elem.style[ name ] ); + + // Normalize "", auto, and prepare for extra + val = parseFloat( val ) || 0; + } + + // Use the active box-sizing model to add/subtract irrelevant styles + return ( val + + augmentWidthOrHeight( + elem, + name, + extra || ( isBorderBox ? "border" : "content" ), + valueIsBorderBox, + styles + ) + ) + "px"; +} + +jQuery.extend( { + + // Add in style property hooks for overriding the default + // behavior of getting and setting a style property + cssHooks: { + opacity: { + get: function( elem, computed ) { + if ( computed ) { + + // We should always get a number back from opacity + var ret = curCSS( elem, "opacity" ); + return ret === "" ? "1" : ret; + } + } + } + }, + + // Don't automatically add "px" to these possibly-unitless properties + cssNumber: { + "animationIterationCount": true, + "columnCount": true, + "fillOpacity": true, + "flexGrow": true, + "flexShrink": true, + "fontWeight": true, + "lineHeight": true, + "opacity": true, + "order": true, + "orphans": true, + "widows": true, + "zIndex": true, + "zoom": true + }, + + // Add in properties whose names you wish to fix before + // setting or getting the value + cssProps: { + "float": "cssFloat" + }, + + // Get and set the style property on a DOM Node + style: function( elem, name, value, extra ) { + + // Don't set styles on text and comment nodes + if ( !elem || elem.nodeType === 3 || elem.nodeType === 8 || !elem.style ) { + return; + } + + // Make sure that we're working with the right name + var ret, type, hooks, + origName = jQuery.camelCase( name ), + style = elem.style; + + name = jQuery.cssProps[ origName ] || + ( jQuery.cssProps[ origName ] = vendorPropName( origName ) || origName ); + + // Gets hook for the prefixed version, then unprefixed version + hooks = jQuery.cssHooks[ name ] || jQuery.cssHooks[ origName ]; + + // Check if we're setting a value + if ( value !== undefined ) { + type = typeof value; + + // Convert "+=" or "-=" to relative numbers (#7345) + if ( type === "string" && ( ret = rcssNum.exec( value ) ) && ret[ 1 ] ) { + value = adjustCSS( elem, name, ret ); + + // Fixes bug #9237 + type = "number"; + } + + // Make sure that null and NaN values aren't set (#7116) + if ( value == null || value !== value ) { + return; + } + + // If a number was passed in, add the unit (except for certain CSS properties) + if ( type === "number" ) { + value += ret && ret[ 3 ] || ( jQuery.cssNumber[ origName ] ? "" : "px" ); + } + + // background-* props affect original clone's values + if ( !support.clearCloneStyle && value === "" && name.indexOf( "background" ) === 0 ) { + style[ name ] = "inherit"; + } + + // If a hook was provided, use that value, otherwise just set the specified value + if ( !hooks || !( "set" in hooks ) || + ( value = hooks.set( elem, value, extra ) ) !== undefined ) { + + style[ name ] = value; + } + + } else { + + // If a hook was provided get the non-computed value from there + if ( hooks && "get" in hooks && + ( ret = hooks.get( elem, false, extra ) ) !== undefined ) { + + return ret; + } + + // Otherwise just get the value from the style object + return style[ name ]; + } + }, + + css: function( elem, name, extra, styles ) { + var val, num, hooks, + origName = jQuery.camelCase( name ); + + // Make sure that we're working with the right name + name = jQuery.cssProps[ origName ] || + ( jQuery.cssProps[ origName ] = vendorPropName( origName ) || origName ); + + // Try prefixed name followed by the unprefixed name + hooks = jQuery.cssHooks[ name ] || jQuery.cssHooks[ origName ]; + + // If a hook was provided get the computed value from there + if ( hooks && "get" in hooks ) { + val = hooks.get( elem, true, extra ); + } + + // Otherwise, if a way to get the computed value exists, use that + if ( val === undefined ) { + val = curCSS( elem, name, styles ); + } + + // Convert "normal" to computed value + if ( val === "normal" && name in cssNormalTransform ) { + val = cssNormalTransform[ name ]; + } + + // Make numeric if forced or a qualifier was provided and val looks numeric + if ( extra === "" || extra ) { + num = parseFloat( val ); + return extra === true || isFinite( num ) ? num || 0 : val; + } + return val; + } +} ); + +jQuery.each( [ "height", "width" ], function( i, name ) { + jQuery.cssHooks[ name ] = { + get: function( elem, computed, extra ) { + if ( computed ) { + + // Certain elements can have dimension info if we invisibly show them + // but it must have a current display style that would benefit + return rdisplayswap.test( jQuery.css( elem, "display" ) ) && + + // Support: Safari 8+ + // Table columns in Safari have non-zero offsetWidth & zero + // getBoundingClientRect().width unless display is changed. + // Support: IE <=11 only + // Running getBoundingClientRect on a disconnected node + // in IE throws an error. + ( !elem.getClientRects().length || !elem.getBoundingClientRect().width ) ? + swap( elem, cssShow, function() { + return getWidthOrHeight( elem, name, extra ); + } ) : + getWidthOrHeight( elem, name, extra ); + } + }, + + set: function( elem, value, extra ) { + var matches, + styles = extra && getStyles( elem ), + subtract = extra && augmentWidthOrHeight( + elem, + name, + extra, + jQuery.css( elem, "boxSizing", false, styles ) === "border-box", + styles + ); + + // Convert to pixels if value adjustment is needed + if ( subtract && ( matches = rcssNum.exec( value ) ) && + ( matches[ 3 ] || "px" ) !== "px" ) { + + elem.style[ name ] = value; + value = jQuery.css( elem, name ); + } + + return setPositiveNumber( elem, value, subtract ); + } + }; +} ); + +jQuery.cssHooks.marginLeft = addGetHookIf( support.reliableMarginLeft, + function( elem, computed ) { + if ( computed ) { + return ( parseFloat( curCSS( elem, "marginLeft" ) ) || + elem.getBoundingClientRect().left - + swap( elem, { marginLeft: 0 }, function() { + return elem.getBoundingClientRect().left; + } ) + ) + "px"; + } + } +); + +// These hooks are used by animate to expand properties +jQuery.each( { + margin: "", + padding: "", + border: "Width" +}, function( prefix, suffix ) { + jQuery.cssHooks[ prefix + suffix ] = { + expand: function( value ) { + var i = 0, + expanded = {}, + + // Assumes a single number if not a string + parts = typeof value === "string" ? value.split( " " ) : [ value ]; + + for ( ; i < 4; i++ ) { + expanded[ prefix + cssExpand[ i ] + suffix ] = + parts[ i ] || parts[ i - 2 ] || parts[ 0 ]; + } + + return expanded; + } + }; + + if ( !rmargin.test( prefix ) ) { + jQuery.cssHooks[ prefix + suffix ].set = setPositiveNumber; + } +} ); + +jQuery.fn.extend( { + css: function( name, value ) { + return access( this, function( elem, name, value ) { + var styles, len, + map = {}, + i = 0; + + if ( jQuery.isArray( name ) ) { + styles = getStyles( elem ); + len = name.length; + + for ( ; i < len; i++ ) { + map[ name[ i ] ] = jQuery.css( elem, name[ i ], false, styles ); + } + + return map; + } + + return value !== undefined ? + jQuery.style( elem, name, value ) : + jQuery.css( elem, name ); + }, name, value, arguments.length > 1 ); + } +} ); + + +function Tween( elem, options, prop, end, easing ) { + return new Tween.prototype.init( elem, options, prop, end, easing ); +} +jQuery.Tween = Tween; + +Tween.prototype = { + constructor: Tween, + init: function( elem, options, prop, end, easing, unit ) { + this.elem = elem; + this.prop = prop; + this.easing = easing || jQuery.easing._default; + this.options = options; + this.start = this.now = this.cur(); + this.end = end; + this.unit = unit || ( jQuery.cssNumber[ prop ] ? "" : "px" ); + }, + cur: function() { + var hooks = Tween.propHooks[ this.prop ]; + + return hooks && hooks.get ? + hooks.get( this ) : + Tween.propHooks._default.get( this ); + }, + run: function( percent ) { + var eased, + hooks = Tween.propHooks[ this.prop ]; + + if ( this.options.duration ) { + this.pos = eased = jQuery.easing[ this.easing ]( + percent, this.options.duration * percent, 0, 1, this.options.duration + ); + } else { + this.pos = eased = percent; + } + this.now = ( this.end - this.start ) * eased + this.start; + + if ( this.options.step ) { + this.options.step.call( this.elem, this.now, this ); + } + + if ( hooks && hooks.set ) { + hooks.set( this ); + } else { + Tween.propHooks._default.set( this ); + } + return this; + } +}; + +Tween.prototype.init.prototype = Tween.prototype; + +Tween.propHooks = { + _default: { + get: function( tween ) { + var result; + + // Use a property on the element directly when it is not a DOM element, + // or when there is no matching style property that exists. + if ( tween.elem.nodeType !== 1 || + tween.elem[ tween.prop ] != null && tween.elem.style[ tween.prop ] == null ) { + return tween.elem[ tween.prop ]; + } + + // Passing an empty string as a 3rd parameter to .css will automatically + // attempt a parseFloat and fallback to a string if the parse fails. + // Simple values such as "10px" are parsed to Float; + // complex values such as "rotate(1rad)" are returned as-is. + result = jQuery.css( tween.elem, tween.prop, "" ); + + // Empty strings, null, undefined and "auto" are converted to 0. + return !result || result === "auto" ? 0 : result; + }, + set: function( tween ) { + + // Use step hook for back compat. + // Use cssHook if its there. + // Use .style if available and use plain properties where available. + if ( jQuery.fx.step[ tween.prop ] ) { + jQuery.fx.step[ tween.prop ]( tween ); + } else if ( tween.elem.nodeType === 1 && + ( tween.elem.style[ jQuery.cssProps[ tween.prop ] ] != null || + jQuery.cssHooks[ tween.prop ] ) ) { + jQuery.style( tween.elem, tween.prop, tween.now + tween.unit ); + } else { + tween.elem[ tween.prop ] = tween.now; + } + } + } +}; + +// Support: IE <=9 only +// Panic based approach to setting things on disconnected nodes +Tween.propHooks.scrollTop = Tween.propHooks.scrollLeft = { + set: function( tween ) { + if ( tween.elem.nodeType && tween.elem.parentNode ) { + tween.elem[ tween.prop ] = tween.now; + } + } +}; + +jQuery.easing = { + linear: function( p ) { + return p; + }, + swing: function( p ) { + return 0.5 - Math.cos( p * Math.PI ) / 2; + }, + _default: "swing" +}; + +jQuery.fx = Tween.prototype.init; + +// Back compat <1.8 extension point +jQuery.fx.step = {}; + + + + +var + fxNow, timerId, + rfxtypes = /^(?:toggle|show|hide)$/, + rrun = /queueHooks$/; + +function raf() { + if ( timerId ) { + window.requestAnimationFrame( raf ); + jQuery.fx.tick(); + } +} + +// Animations created synchronously will run synchronously +function createFxNow() { + window.setTimeout( function() { + fxNow = undefined; + } ); + return ( fxNow = jQuery.now() ); +} + +// Generate parameters to create a standard animation +function genFx( type, includeWidth ) { + var which, + i = 0, + attrs = { height: type }; + + // If we include width, step value is 1 to do all cssExpand values, + // otherwise step value is 2 to skip over Left and Right + includeWidth = includeWidth ? 1 : 0; + for ( ; i < 4; i += 2 - includeWidth ) { + which = cssExpand[ i ]; + attrs[ "margin" + which ] = attrs[ "padding" + which ] = type; + } + + if ( includeWidth ) { + attrs.opacity = attrs.width = type; + } + + return attrs; +} + +function createTween( value, prop, animation ) { + var tween, + collection = ( Animation.tweeners[ prop ] || [] ).concat( Animation.tweeners[ "*" ] ), + index = 0, + length = collection.length; + for ( ; index < length; index++ ) { + if ( ( tween = collection[ index ].call( animation, prop, value ) ) ) { + + // We're done with this property + return tween; + } + } +} + +function defaultPrefilter( elem, props, opts ) { + var prop, value, toggle, hooks, oldfire, propTween, restoreDisplay, display, + isBox = "width" in props || "height" in props, + anim = this, + orig = {}, + style = elem.style, + hidden = elem.nodeType && isHiddenWithinTree( elem ), + dataShow = dataPriv.get( elem, "fxshow" ); + + // Queue-skipping animations hijack the fx hooks + if ( !opts.queue ) { + hooks = jQuery._queueHooks( elem, "fx" ); + if ( hooks.unqueued == null ) { + hooks.unqueued = 0; + oldfire = hooks.empty.fire; + hooks.empty.fire = function() { + if ( !hooks.unqueued ) { + oldfire(); + } + }; + } + hooks.unqueued++; + + anim.always( function() { + + // Ensure the complete handler is called before this completes + anim.always( function() { + hooks.unqueued--; + if ( !jQuery.queue( elem, "fx" ).length ) { + hooks.empty.fire(); + } + } ); + } ); + } + + // Detect show/hide animations + for ( prop in props ) { + value = props[ prop ]; + if ( rfxtypes.test( value ) ) { + delete props[ prop ]; + toggle = toggle || value === "toggle"; + if ( value === ( hidden ? "hide" : "show" ) ) { + + // Pretend to be hidden if this is a "show" and + // there is still data from a stopped show/hide + if ( value === "show" && dataShow && dataShow[ prop ] !== undefined ) { + hidden = true; + + // Ignore all other no-op show/hide data + } else { + continue; + } + } + orig[ prop ] = dataShow && dataShow[ prop ] || jQuery.style( elem, prop ); + } + } + + // Bail out if this is a no-op like .hide().hide() + propTween = !jQuery.isEmptyObject( props ); + if ( !propTween && jQuery.isEmptyObject( orig ) ) { + return; + } + + // Restrict "overflow" and "display" styles during box animations + if ( isBox && elem.nodeType === 1 ) { + + // Support: IE <=9 - 11, Edge 12 - 13 + // Record all 3 overflow attributes because IE does not infer the shorthand + // from identically-valued overflowX and overflowY + opts.overflow = [ style.overflow, style.overflowX, style.overflowY ]; + + // Identify a display type, preferring old show/hide data over the CSS cascade + restoreDisplay = dataShow && dataShow.display; + if ( restoreDisplay == null ) { + restoreDisplay = dataPriv.get( elem, "display" ); + } + display = jQuery.css( elem, "display" ); + if ( display === "none" ) { + if ( restoreDisplay ) { + display = restoreDisplay; + } else { + + // Get nonempty value(s) by temporarily forcing visibility + showHide( [ elem ], true ); + restoreDisplay = elem.style.display || restoreDisplay; + display = jQuery.css( elem, "display" ); + showHide( [ elem ] ); + } + } + + // Animate inline elements as inline-block + if ( display === "inline" || display === "inline-block" && restoreDisplay != null ) { + if ( jQuery.css( elem, "float" ) === "none" ) { + + // Restore the original display value at the end of pure show/hide animations + if ( !propTween ) { + anim.done( function() { + style.display = restoreDisplay; + } ); + if ( restoreDisplay == null ) { + display = style.display; + restoreDisplay = display === "none" ? "" : display; + } + } + style.display = "inline-block"; + } + } + } + + if ( opts.overflow ) { + style.overflow = "hidden"; + anim.always( function() { + style.overflow = opts.overflow[ 0 ]; + style.overflowX = opts.overflow[ 1 ]; + style.overflowY = opts.overflow[ 2 ]; + } ); + } + + // Implement show/hide animations + propTween = false; + for ( prop in orig ) { + + // General show/hide setup for this element animation + if ( !propTween ) { + if ( dataShow ) { + if ( "hidden" in dataShow ) { + hidden = dataShow.hidden; + } + } else { + dataShow = dataPriv.access( elem, "fxshow", { display: restoreDisplay } ); + } + + // Store hidden/visible for toggle so `.stop().toggle()` "reverses" + if ( toggle ) { + dataShow.hidden = !hidden; + } + + // Show elements before animating them + if ( hidden ) { + showHide( [ elem ], true ); + } + + /* eslint-disable no-loop-func */ + + anim.done( function() { + + /* eslint-enable no-loop-func */ + + // The final step of a "hide" animation is actually hiding the element + if ( !hidden ) { + showHide( [ elem ] ); + } + dataPriv.remove( elem, "fxshow" ); + for ( prop in orig ) { + jQuery.style( elem, prop, orig[ prop ] ); + } + } ); + } + + // Per-property setup + propTween = createTween( hidden ? dataShow[ prop ] : 0, prop, anim ); + if ( !( prop in dataShow ) ) { + dataShow[ prop ] = propTween.start; + if ( hidden ) { + propTween.end = propTween.start; + propTween.start = 0; + } + } + } +} + +function propFilter( props, specialEasing ) { + var index, name, easing, value, hooks; + + // camelCase, specialEasing and expand cssHook pass + for ( index in props ) { + name = jQuery.camelCase( index ); + easing = specialEasing[ name ]; + value = props[ index ]; + if ( jQuery.isArray( value ) ) { + easing = value[ 1 ]; + value = props[ index ] = value[ 0 ]; + } + + if ( index !== name ) { + props[ name ] = value; + delete props[ index ]; + } + + hooks = jQuery.cssHooks[ name ]; + if ( hooks && "expand" in hooks ) { + value = hooks.expand( value ); + delete props[ name ]; + + // Not quite $.extend, this won't overwrite existing keys. + // Reusing 'index' because we have the correct "name" + for ( index in value ) { + if ( !( index in props ) ) { + props[ index ] = value[ index ]; + specialEasing[ index ] = easing; + } + } + } else { + specialEasing[ name ] = easing; + } + } +} + +function Animation( elem, properties, options ) { + var result, + stopped, + index = 0, + length = Animation.prefilters.length, + deferred = jQuery.Deferred().always( function() { + + // Don't match elem in the :animated selector + delete tick.elem; + } ), + tick = function() { + if ( stopped ) { + return false; + } + var currentTime = fxNow || createFxNow(), + remaining = Math.max( 0, animation.startTime + animation.duration - currentTime ), + + // Support: Android 2.3 only + // Archaic crash bug won't allow us to use `1 - ( 0.5 || 0 )` (#12497) + temp = remaining / animation.duration || 0, + percent = 1 - temp, + index = 0, + length = animation.tweens.length; + + for ( ; index < length; index++ ) { + animation.tweens[ index ].run( percent ); + } + + deferred.notifyWith( elem, [ animation, percent, remaining ] ); + + if ( percent < 1 && length ) { + return remaining; + } else { + deferred.resolveWith( elem, [ animation ] ); + return false; + } + }, + animation = deferred.promise( { + elem: elem, + props: jQuery.extend( {}, properties ), + opts: jQuery.extend( true, { + specialEasing: {}, + easing: jQuery.easing._default + }, options ), + originalProperties: properties, + originalOptions: options, + startTime: fxNow || createFxNow(), + duration: options.duration, + tweens: [], + createTween: function( prop, end ) { + var tween = jQuery.Tween( elem, animation.opts, prop, end, + animation.opts.specialEasing[ prop ] || animation.opts.easing ); + animation.tweens.push( tween ); + return tween; + }, + stop: function( gotoEnd ) { + var index = 0, + + // If we are going to the end, we want to run all the tweens + // otherwise we skip this part + length = gotoEnd ? animation.tweens.length : 0; + if ( stopped ) { + return this; + } + stopped = true; + for ( ; index < length; index++ ) { + animation.tweens[ index ].run( 1 ); + } + + // Resolve when we played the last frame; otherwise, reject + if ( gotoEnd ) { + deferred.notifyWith( elem, [ animation, 1, 0 ] ); + deferred.resolveWith( elem, [ animation, gotoEnd ] ); + } else { + deferred.rejectWith( elem, [ animation, gotoEnd ] ); + } + return this; + } + } ), + props = animation.props; + + propFilter( props, animation.opts.specialEasing ); + + for ( ; index < length; index++ ) { + result = Animation.prefilters[ index ].call( animation, elem, props, animation.opts ); + if ( result ) { + if ( jQuery.isFunction( result.stop ) ) { + jQuery._queueHooks( animation.elem, animation.opts.queue ).stop = + jQuery.proxy( result.stop, result ); + } + return result; + } + } + + jQuery.map( props, createTween, animation ); + + if ( jQuery.isFunction( animation.opts.start ) ) { + animation.opts.start.call( elem, animation ); + } + + jQuery.fx.timer( + jQuery.extend( tick, { + elem: elem, + anim: animation, + queue: animation.opts.queue + } ) + ); + + // attach callbacks from options + return animation.progress( animation.opts.progress ) + .done( animation.opts.done, animation.opts.complete ) + .fail( animation.opts.fail ) + .always( animation.opts.always ); +} + +jQuery.Animation = jQuery.extend( Animation, { + + tweeners: { + "*": [ function( prop, value ) { + var tween = this.createTween( prop, value ); + adjustCSS( tween.elem, prop, rcssNum.exec( value ), tween ); + return tween; + } ] + }, + + tweener: function( props, callback ) { + if ( jQuery.isFunction( props ) ) { + callback = props; + props = [ "*" ]; + } else { + props = props.match( rnothtmlwhite ); + } + + var prop, + index = 0, + length = props.length; + + for ( ; index < length; index++ ) { + prop = props[ index ]; + Animation.tweeners[ prop ] = Animation.tweeners[ prop ] || []; + Animation.tweeners[ prop ].unshift( callback ); + } + }, + + prefilters: [ defaultPrefilter ], + + prefilter: function( callback, prepend ) { + if ( prepend ) { + Animation.prefilters.unshift( callback ); + } else { + Animation.prefilters.push( callback ); + } + } +} ); + +jQuery.speed = function( speed, easing, fn ) { + var opt = speed && typeof speed === "object" ? jQuery.extend( {}, speed ) : { + complete: fn || !fn && easing || + jQuery.isFunction( speed ) && speed, + duration: speed, + easing: fn && easing || easing && !jQuery.isFunction( easing ) && easing + }; + + // Go to the end state if fx are off or if document is hidden + if ( jQuery.fx.off || document.hidden ) { + opt.duration = 0; + + } else { + if ( typeof opt.duration !== "number" ) { + if ( opt.duration in jQuery.fx.speeds ) { + opt.duration = jQuery.fx.speeds[ opt.duration ]; + + } else { + opt.duration = jQuery.fx.speeds._default; + } + } + } + + // Normalize opt.queue - true/undefined/null -> "fx" + if ( opt.queue == null || opt.queue === true ) { + opt.queue = "fx"; + } + + // Queueing + opt.old = opt.complete; + + opt.complete = function() { + if ( jQuery.isFunction( opt.old ) ) { + opt.old.call( this ); + } + + if ( opt.queue ) { + jQuery.dequeue( this, opt.queue ); + } + }; + + return opt; +}; + +jQuery.fn.extend( { + fadeTo: function( speed, to, easing, callback ) { + + // Show any hidden elements after setting opacity to 0 + return this.filter( isHiddenWithinTree ).css( "opacity", 0 ).show() + + // Animate to the value specified + .end().animate( { opacity: to }, speed, easing, callback ); + }, + animate: function( prop, speed, easing, callback ) { + var empty = jQuery.isEmptyObject( prop ), + optall = jQuery.speed( speed, easing, callback ), + doAnimation = function() { + + // Operate on a copy of prop so per-property easing won't be lost + var anim = Animation( this, jQuery.extend( {}, prop ), optall ); + + // Empty animations, or finishing resolves immediately + if ( empty || dataPriv.get( this, "finish" ) ) { + anim.stop( true ); + } + }; + doAnimation.finish = doAnimation; + + return empty || optall.queue === false ? + this.each( doAnimation ) : + this.queue( optall.queue, doAnimation ); + }, + stop: function( type, clearQueue, gotoEnd ) { + var stopQueue = function( hooks ) { + var stop = hooks.stop; + delete hooks.stop; + stop( gotoEnd ); + }; + + if ( typeof type !== "string" ) { + gotoEnd = clearQueue; + clearQueue = type; + type = undefined; + } + if ( clearQueue && type !== false ) { + this.queue( type || "fx", [] ); + } + + return this.each( function() { + var dequeue = true, + index = type != null && type + "queueHooks", + timers = jQuery.timers, + data = dataPriv.get( this ); + + if ( index ) { + if ( data[ index ] && data[ index ].stop ) { + stopQueue( data[ index ] ); + } + } else { + for ( index in data ) { + if ( data[ index ] && data[ index ].stop && rrun.test( index ) ) { + stopQueue( data[ index ] ); + } + } + } + + for ( index = timers.length; index--; ) { + if ( timers[ index ].elem === this && + ( type == null || timers[ index ].queue === type ) ) { + + timers[ index ].anim.stop( gotoEnd ); + dequeue = false; + timers.splice( index, 1 ); + } + } + + // Start the next in the queue if the last step wasn't forced. + // Timers currently will call their complete callbacks, which + // will dequeue but only if they were gotoEnd. + if ( dequeue || !gotoEnd ) { + jQuery.dequeue( this, type ); + } + } ); + }, + finish: function( type ) { + if ( type !== false ) { + type = type || "fx"; + } + return this.each( function() { + var index, + data = dataPriv.get( this ), + queue = data[ type + "queue" ], + hooks = data[ type + "queueHooks" ], + timers = jQuery.timers, + length = queue ? queue.length : 0; + + // Enable finishing flag on private data + data.finish = true; + + // Empty the queue first + jQuery.queue( this, type, [] ); + + if ( hooks && hooks.stop ) { + hooks.stop.call( this, true ); + } + + // Look for any active animations, and finish them + for ( index = timers.length; index--; ) { + if ( timers[ index ].elem === this && timers[ index ].queue === type ) { + timers[ index ].anim.stop( true ); + timers.splice( index, 1 ); + } + } + + // Look for any animations in the old queue and finish them + for ( index = 0; index < length; index++ ) { + if ( queue[ index ] && queue[ index ].finish ) { + queue[ index ].finish.call( this ); + } + } + + // Turn off finishing flag + delete data.finish; + } ); + } +} ); + +jQuery.each( [ "toggle", "show", "hide" ], function( i, name ) { + var cssFn = jQuery.fn[ name ]; + jQuery.fn[ name ] = function( speed, easing, callback ) { + return speed == null || typeof speed === "boolean" ? + cssFn.apply( this, arguments ) : + this.animate( genFx( name, true ), speed, easing, callback ); + }; +} ); + +// Generate shortcuts for custom animations +jQuery.each( { + slideDown: genFx( "show" ), + slideUp: genFx( "hide" ), + slideToggle: genFx( "toggle" ), + fadeIn: { opacity: "show" }, + fadeOut: { opacity: "hide" }, + fadeToggle: { opacity: "toggle" } +}, function( name, props ) { + jQuery.fn[ name ] = function( speed, easing, callback ) { + return this.animate( props, speed, easing, callback ); + }; +} ); + +jQuery.timers = []; +jQuery.fx.tick = function() { + var timer, + i = 0, + timers = jQuery.timers; + + fxNow = jQuery.now(); + + for ( ; i < timers.length; i++ ) { + timer = timers[ i ]; + + // Checks the timer has not already been removed + if ( !timer() && timers[ i ] === timer ) { + timers.splice( i--, 1 ); + } + } + + if ( !timers.length ) { + jQuery.fx.stop(); + } + fxNow = undefined; +}; + +jQuery.fx.timer = function( timer ) { + jQuery.timers.push( timer ); + if ( timer() ) { + jQuery.fx.start(); + } else { + jQuery.timers.pop(); + } +}; + +jQuery.fx.interval = 13; +jQuery.fx.start = function() { + if ( !timerId ) { + timerId = window.requestAnimationFrame ? + window.requestAnimationFrame( raf ) : + window.setInterval( jQuery.fx.tick, jQuery.fx.interval ); + } +}; + +jQuery.fx.stop = function() { + if ( window.cancelAnimationFrame ) { + window.cancelAnimationFrame( timerId ); + } else { + window.clearInterval( timerId ); + } + + timerId = null; +}; + +jQuery.fx.speeds = { + slow: 600, + fast: 200, + + // Default speed + _default: 400 +}; + + +// Based off of the plugin by Clint Helfers, with permission. +// https://web.archive.org/web/20100324014747/http://blindsignals.com/index.php/2009/07/jquery-delay/ +jQuery.fn.delay = function( time, type ) { + time = jQuery.fx ? jQuery.fx.speeds[ time ] || time : time; + type = type || "fx"; + + return this.queue( type, function( next, hooks ) { + var timeout = window.setTimeout( next, time ); + hooks.stop = function() { + window.clearTimeout( timeout ); + }; + } ); +}; + + +( function() { + var input = document.createElement( "input" ), + select = document.createElement( "select" ), + opt = select.appendChild( document.createElement( "option" ) ); + + input.type = "checkbox"; + + // Support: Android <=4.3 only + // Default value for a checkbox should be "on" + support.checkOn = input.value !== ""; + + // Support: IE <=11 only + // Must access selectedIndex to make default options select + support.optSelected = opt.selected; + + // Support: IE <=11 only + // An input loses its value after becoming a radio + input = document.createElement( "input" ); + input.value = "t"; + input.type = "radio"; + support.radioValue = input.value === "t"; +} )(); + + +var boolHook, + attrHandle = jQuery.expr.attrHandle; + +jQuery.fn.extend( { + attr: function( name, value ) { + return access( this, jQuery.attr, name, value, arguments.length > 1 ); + }, + + removeAttr: function( name ) { + return this.each( function() { + jQuery.removeAttr( this, name ); + } ); + } +} ); + +jQuery.extend( { + attr: function( elem, name, value ) { + var ret, hooks, + nType = elem.nodeType; + + // Don't get/set attributes on text, comment and attribute nodes + if ( nType === 3 || nType === 8 || nType === 2 ) { + return; + } + + // Fallback to prop when attributes are not supported + if ( typeof elem.getAttribute === "undefined" ) { + return jQuery.prop( elem, name, value ); + } + + // Attribute hooks are determined by the lowercase version + // Grab necessary hook if one is defined + if ( nType !== 1 || !jQuery.isXMLDoc( elem ) ) { + hooks = jQuery.attrHooks[ name.toLowerCase() ] || + ( jQuery.expr.match.bool.test( name ) ? boolHook : undefined ); + } + + if ( value !== undefined ) { + if ( value === null ) { + jQuery.removeAttr( elem, name ); + return; + } + + if ( hooks && "set" in hooks && + ( ret = hooks.set( elem, value, name ) ) !== undefined ) { + return ret; + } + + elem.setAttribute( name, value + "" ); + return value; + } + + if ( hooks && "get" in hooks && ( ret = hooks.get( elem, name ) ) !== null ) { + return ret; + } + + ret = jQuery.find.attr( elem, name ); + + // Non-existent attributes return null, we normalize to undefined + return ret == null ? undefined : ret; + }, + + attrHooks: { + type: { + set: function( elem, value ) { + if ( !support.radioValue && value === "radio" && + jQuery.nodeName( elem, "input" ) ) { + var val = elem.value; + elem.setAttribute( "type", value ); + if ( val ) { + elem.value = val; + } + return value; + } + } + } + }, + + removeAttr: function( elem, value ) { + var name, + i = 0, + + // Attribute names can contain non-HTML whitespace characters + // https://html.spec.whatwg.org/multipage/syntax.html#attributes-2 + attrNames = value && value.match( rnothtmlwhite ); + + if ( attrNames && elem.nodeType === 1 ) { + while ( ( name = attrNames[ i++ ] ) ) { + elem.removeAttribute( name ); + } + } + } +} ); + +// Hooks for boolean attributes +boolHook = { + set: function( elem, value, name ) { + if ( value === false ) { + + // Remove boolean attributes when set to false + jQuery.removeAttr( elem, name ); + } else { + elem.setAttribute( name, name ); + } + return name; + } +}; + +jQuery.each( jQuery.expr.match.bool.source.match( /\w+/g ), function( i, name ) { + var getter = attrHandle[ name ] || jQuery.find.attr; + + attrHandle[ name ] = function( elem, name, isXML ) { + var ret, handle, + lowercaseName = name.toLowerCase(); + + if ( !isXML ) { + + // Avoid an infinite loop by temporarily removing this function from the getter + handle = attrHandle[ lowercaseName ]; + attrHandle[ lowercaseName ] = ret; + ret = getter( elem, name, isXML ) != null ? + lowercaseName : + null; + attrHandle[ lowercaseName ] = handle; + } + return ret; + }; +} ); + + + + +var rfocusable = /^(?:input|select|textarea|button)$/i, + rclickable = /^(?:a|area)$/i; + +jQuery.fn.extend( { + prop: function( name, value ) { + return access( this, jQuery.prop, name, value, arguments.length > 1 ); + }, + + removeProp: function( name ) { + return this.each( function() { + delete this[ jQuery.propFix[ name ] || name ]; + } ); + } +} ); + +jQuery.extend( { + prop: function( elem, name, value ) { + var ret, hooks, + nType = elem.nodeType; + + // Don't get/set properties on text, comment and attribute nodes + if ( nType === 3 || nType === 8 || nType === 2 ) { + return; + } + + if ( nType !== 1 || !jQuery.isXMLDoc( elem ) ) { + + // Fix name and attach hooks + name = jQuery.propFix[ name ] || name; + hooks = jQuery.propHooks[ name ]; + } + + if ( value !== undefined ) { + if ( hooks && "set" in hooks && + ( ret = hooks.set( elem, value, name ) ) !== undefined ) { + return ret; + } + + return ( elem[ name ] = value ); + } + + if ( hooks && "get" in hooks && ( ret = hooks.get( elem, name ) ) !== null ) { + return ret; + } + + return elem[ name ]; + }, + + propHooks: { + tabIndex: { + get: function( elem ) { + + // Support: IE <=9 - 11 only + // elem.tabIndex doesn't always return the + // correct value when it hasn't been explicitly set + // https://web.archive.org/web/20141116233347/http://fluidproject.org/blog/2008/01/09/getting-setting-and-removing-tabindex-values-with-javascript/ + // Use proper attribute retrieval(#12072) + var tabindex = jQuery.find.attr( elem, "tabindex" ); + + if ( tabindex ) { + return parseInt( tabindex, 10 ); + } + + if ( + rfocusable.test( elem.nodeName ) || + rclickable.test( elem.nodeName ) && + elem.href + ) { + return 0; + } + + return -1; + } + } + }, + + propFix: { + "for": "htmlFor", + "class": "className" + } +} ); + +// Support: IE <=11 only +// Accessing the selectedIndex property +// forces the browser to respect setting selected +// on the option +// The getter ensures a default option is selected +// when in an optgroup +// eslint rule "no-unused-expressions" is disabled for this code +// since it considers such accessions noop +if ( !support.optSelected ) { + jQuery.propHooks.selected = { + get: function( elem ) { + + /* eslint no-unused-expressions: "off" */ + + var parent = elem.parentNode; + if ( parent && parent.parentNode ) { + parent.parentNode.selectedIndex; + } + return null; + }, + set: function( elem ) { + + /* eslint no-unused-expressions: "off" */ + + var parent = elem.parentNode; + if ( parent ) { + parent.selectedIndex; + + if ( parent.parentNode ) { + parent.parentNode.selectedIndex; + } + } + } + }; +} + +jQuery.each( [ + "tabIndex", + "readOnly", + "maxLength", + "cellSpacing", + "cellPadding", + "rowSpan", + "colSpan", + "useMap", + "frameBorder", + "contentEditable" +], function() { + jQuery.propFix[ this.toLowerCase() ] = this; +} ); + + + + + // Strip and collapse whitespace according to HTML spec + // https://html.spec.whatwg.org/multipage/infrastructure.html#strip-and-collapse-whitespace + function stripAndCollapse( value ) { + var tokens = value.match( rnothtmlwhite ) || []; + return tokens.join( " " ); + } + + +function getClass( elem ) { + return elem.getAttribute && elem.getAttribute( "class" ) || ""; +} + +jQuery.fn.extend( { + addClass: function( value ) { + var classes, elem, cur, curValue, clazz, j, finalValue, + i = 0; + + if ( jQuery.isFunction( value ) ) { + return this.each( function( j ) { + jQuery( this ).addClass( value.call( this, j, getClass( this ) ) ); + } ); + } + + if ( typeof value === "string" && value ) { + classes = value.match( rnothtmlwhite ) || []; + + while ( ( elem = this[ i++ ] ) ) { + curValue = getClass( elem ); + cur = elem.nodeType === 1 && ( " " + stripAndCollapse( curValue ) + " " ); + + if ( cur ) { + j = 0; + while ( ( clazz = classes[ j++ ] ) ) { + if ( cur.indexOf( " " + clazz + " " ) < 0 ) { + cur += clazz + " "; + } + } + + // Only assign if different to avoid unneeded rendering. + finalValue = stripAndCollapse( cur ); + if ( curValue !== finalValue ) { + elem.setAttribute( "class", finalValue ); + } + } + } + } + + return this; + }, + + removeClass: function( value ) { + var classes, elem, cur, curValue, clazz, j, finalValue, + i = 0; + + if ( jQuery.isFunction( value ) ) { + return this.each( function( j ) { + jQuery( this ).removeClass( value.call( this, j, getClass( this ) ) ); + } ); + } + + if ( !arguments.length ) { + return this.attr( "class", "" ); + } + + if ( typeof value === "string" && value ) { + classes = value.match( rnothtmlwhite ) || []; + + while ( ( elem = this[ i++ ] ) ) { + curValue = getClass( elem ); + + // This expression is here for better compressibility (see addClass) + cur = elem.nodeType === 1 && ( " " + stripAndCollapse( curValue ) + " " ); + + if ( cur ) { + j = 0; + while ( ( clazz = classes[ j++ ] ) ) { + + // Remove *all* instances + while ( cur.indexOf( " " + clazz + " " ) > -1 ) { + cur = cur.replace( " " + clazz + " ", " " ); + } + } + + // Only assign if different to avoid unneeded rendering. + finalValue = stripAndCollapse( cur ); + if ( curValue !== finalValue ) { + elem.setAttribute( "class", finalValue ); + } + } + } + } + + return this; + }, + + toggleClass: function( value, stateVal ) { + var type = typeof value; + + if ( typeof stateVal === "boolean" && type === "string" ) { + return stateVal ? this.addClass( value ) : this.removeClass( value ); + } + + if ( jQuery.isFunction( value ) ) { + return this.each( function( i ) { + jQuery( this ).toggleClass( + value.call( this, i, getClass( this ), stateVal ), + stateVal + ); + } ); + } + + return this.each( function() { + var className, i, self, classNames; + + if ( type === "string" ) { + + // Toggle individual class names + i = 0; + self = jQuery( this ); + classNames = value.match( rnothtmlwhite ) || []; + + while ( ( className = classNames[ i++ ] ) ) { + + // Check each className given, space separated list + if ( self.hasClass( className ) ) { + self.removeClass( className ); + } else { + self.addClass( className ); + } + } + + // Toggle whole class name + } else if ( value === undefined || type === "boolean" ) { + className = getClass( this ); + if ( className ) { + + // Store className if set + dataPriv.set( this, "__className__", className ); + } + + // If the element has a class name or if we're passed `false`, + // then remove the whole classname (if there was one, the above saved it). + // Otherwise bring back whatever was previously saved (if anything), + // falling back to the empty string if nothing was stored. + if ( this.setAttribute ) { + this.setAttribute( "class", + className || value === false ? + "" : + dataPriv.get( this, "__className__" ) || "" + ); + } + } + } ); + }, + + hasClass: function( selector ) { + var className, elem, + i = 0; + + className = " " + selector + " "; + while ( ( elem = this[ i++ ] ) ) { + if ( elem.nodeType === 1 && + ( " " + stripAndCollapse( getClass( elem ) ) + " " ).indexOf( className ) > -1 ) { + return true; + } + } + + return false; + } +} ); + + + + +var rreturn = /\r/g; + +jQuery.fn.extend( { + val: function( value ) { + var hooks, ret, isFunction, + elem = this[ 0 ]; + + if ( !arguments.length ) { + if ( elem ) { + hooks = jQuery.valHooks[ elem.type ] || + jQuery.valHooks[ elem.nodeName.toLowerCase() ]; + + if ( hooks && + "get" in hooks && + ( ret = hooks.get( elem, "value" ) ) !== undefined + ) { + return ret; + } + + ret = elem.value; + + // Handle most common string cases + if ( typeof ret === "string" ) { + return ret.replace( rreturn, "" ); + } + + // Handle cases where value is null/undef or number + return ret == null ? "" : ret; + } + + return; + } + + isFunction = jQuery.isFunction( value ); + + return this.each( function( i ) { + var val; + + if ( this.nodeType !== 1 ) { + return; + } + + if ( isFunction ) { + val = value.call( this, i, jQuery( this ).val() ); + } else { + val = value; + } + + // Treat null/undefined as ""; convert numbers to string + if ( val == null ) { + val = ""; + + } else if ( typeof val === "number" ) { + val += ""; + + } else if ( jQuery.isArray( val ) ) { + val = jQuery.map( val, function( value ) { + return value == null ? "" : value + ""; + } ); + } + + hooks = jQuery.valHooks[ this.type ] || jQuery.valHooks[ this.nodeName.toLowerCase() ]; + + // If set returns undefined, fall back to normal setting + if ( !hooks || !( "set" in hooks ) || hooks.set( this, val, "value" ) === undefined ) { + this.value = val; + } + } ); + } +} ); + +jQuery.extend( { + valHooks: { + option: { + get: function( elem ) { + + var val = jQuery.find.attr( elem, "value" ); + return val != null ? + val : + + // Support: IE <=10 - 11 only + // option.text throws exceptions (#14686, #14858) + // Strip and collapse whitespace + // https://html.spec.whatwg.org/#strip-and-collapse-whitespace + stripAndCollapse( jQuery.text( elem ) ); + } + }, + select: { + get: function( elem ) { + var value, option, i, + options = elem.options, + index = elem.selectedIndex, + one = elem.type === "select-one", + values = one ? null : [], + max = one ? index + 1 : options.length; + + if ( index < 0 ) { + i = max; + + } else { + i = one ? index : 0; + } + + // Loop through all the selected options + for ( ; i < max; i++ ) { + option = options[ i ]; + + // Support: IE <=9 only + // IE8-9 doesn't update selected after form reset (#2551) + if ( ( option.selected || i === index ) && + + // Don't return options that are disabled or in a disabled optgroup + !option.disabled && + ( !option.parentNode.disabled || + !jQuery.nodeName( option.parentNode, "optgroup" ) ) ) { + + // Get the specific value for the option + value = jQuery( option ).val(); + + // We don't need an array for one selects + if ( one ) { + return value; + } + + // Multi-Selects return an array + values.push( value ); + } + } + + return values; + }, + + set: function( elem, value ) { + var optionSet, option, + options = elem.options, + values = jQuery.makeArray( value ), + i = options.length; + + while ( i-- ) { + option = options[ i ]; + + /* eslint-disable no-cond-assign */ + + if ( option.selected = + jQuery.inArray( jQuery.valHooks.option.get( option ), values ) > -1 + ) { + optionSet = true; + } + + /* eslint-enable no-cond-assign */ + } + + // Force browsers to behave consistently when non-matching value is set + if ( !optionSet ) { + elem.selectedIndex = -1; + } + return values; + } + } + } +} ); + +// Radios and checkboxes getter/setter +jQuery.each( [ "radio", "checkbox" ], function() { + jQuery.valHooks[ this ] = { + set: function( elem, value ) { + if ( jQuery.isArray( value ) ) { + return ( elem.checked = jQuery.inArray( jQuery( elem ).val(), value ) > -1 ); + } + } + }; + if ( !support.checkOn ) { + jQuery.valHooks[ this ].get = function( elem ) { + return elem.getAttribute( "value" ) === null ? "on" : elem.value; + }; + } +} ); + + + + +// Return jQuery for attributes-only inclusion + + +var rfocusMorph = /^(?:focusinfocus|focusoutblur)$/; + +jQuery.extend( jQuery.event, { + + trigger: function( event, data, elem, onlyHandlers ) { + + var i, cur, tmp, bubbleType, ontype, handle, special, + eventPath = [ elem || document ], + type = hasOwn.call( event, "type" ) ? event.type : event, + namespaces = hasOwn.call( event, "namespace" ) ? event.namespace.split( "." ) : []; + + cur = tmp = elem = elem || document; + + // Don't do events on text and comment nodes + if ( elem.nodeType === 3 || elem.nodeType === 8 ) { + return; + } + + // focus/blur morphs to focusin/out; ensure we're not firing them right now + if ( rfocusMorph.test( type + jQuery.event.triggered ) ) { + return; + } + + if ( type.indexOf( "." ) > -1 ) { + + // Namespaced trigger; create a regexp to match event type in handle() + namespaces = type.split( "." ); + type = namespaces.shift(); + namespaces.sort(); + } + ontype = type.indexOf( ":" ) < 0 && "on" + type; + + // Caller can pass in a jQuery.Event object, Object, or just an event type string + event = event[ jQuery.expando ] ? + event : + new jQuery.Event( type, typeof event === "object" && event ); + + // Trigger bitmask: & 1 for native handlers; & 2 for jQuery (always true) + event.isTrigger = onlyHandlers ? 2 : 3; + event.namespace = namespaces.join( "." ); + event.rnamespace = event.namespace ? + new RegExp( "(^|\\.)" + namespaces.join( "\\.(?:.*\\.|)" ) + "(\\.|$)" ) : + null; + + // Clean up the event in case it is being reused + event.result = undefined; + if ( !event.target ) { + event.target = elem; + } + + // Clone any incoming data and prepend the event, creating the handler arg list + data = data == null ? + [ event ] : + jQuery.makeArray( data, [ event ] ); + + // Allow special events to draw outside the lines + special = jQuery.event.special[ type ] || {}; + if ( !onlyHandlers && special.trigger && special.trigger.apply( elem, data ) === false ) { + return; + } + + // Determine event propagation path in advance, per W3C events spec (#9951) + // Bubble up to document, then to window; watch for a global ownerDocument var (#9724) + if ( !onlyHandlers && !special.noBubble && !jQuery.isWindow( elem ) ) { + + bubbleType = special.delegateType || type; + if ( !rfocusMorph.test( bubbleType + type ) ) { + cur = cur.parentNode; + } + for ( ; cur; cur = cur.parentNode ) { + eventPath.push( cur ); + tmp = cur; + } + + // Only add window if we got to document (e.g., not plain obj or detached DOM) + if ( tmp === ( elem.ownerDocument || document ) ) { + eventPath.push( tmp.defaultView || tmp.parentWindow || window ); + } + } + + // Fire handlers on the event path + i = 0; + while ( ( cur = eventPath[ i++ ] ) && !event.isPropagationStopped() ) { + + event.type = i > 1 ? + bubbleType : + special.bindType || type; + + // jQuery handler + handle = ( dataPriv.get( cur, "events" ) || {} )[ event.type ] && + dataPriv.get( cur, "handle" ); + if ( handle ) { + handle.apply( cur, data ); + } + + // Native handler + handle = ontype && cur[ ontype ]; + if ( handle && handle.apply && acceptData( cur ) ) { + event.result = handle.apply( cur, data ); + if ( event.result === false ) { + event.preventDefault(); + } + } + } + event.type = type; + + // If nobody prevented the default action, do it now + if ( !onlyHandlers && !event.isDefaultPrevented() ) { + + if ( ( !special._default || + special._default.apply( eventPath.pop(), data ) === false ) && + acceptData( elem ) ) { + + // Call a native DOM method on the target with the same name as the event. + // Don't do default actions on window, that's where global variables be (#6170) + if ( ontype && jQuery.isFunction( elem[ type ] ) && !jQuery.isWindow( elem ) ) { + + // Don't re-trigger an onFOO event when we call its FOO() method + tmp = elem[ ontype ]; + + if ( tmp ) { + elem[ ontype ] = null; + } + + // Prevent re-triggering of the same event, since we already bubbled it above + jQuery.event.triggered = type; + elem[ type ](); + jQuery.event.triggered = undefined; + + if ( tmp ) { + elem[ ontype ] = tmp; + } + } + } + } + + return event.result; + }, + + // Piggyback on a donor event to simulate a different one + // Used only for `focus(in | out)` events + simulate: function( type, elem, event ) { + var e = jQuery.extend( + new jQuery.Event(), + event, + { + type: type, + isSimulated: true + } + ); + + jQuery.event.trigger( e, null, elem ); + } + +} ); + +jQuery.fn.extend( { + + trigger: function( type, data ) { + return this.each( function() { + jQuery.event.trigger( type, data, this ); + } ); + }, + triggerHandler: function( type, data ) { + var elem = this[ 0 ]; + if ( elem ) { + return jQuery.event.trigger( type, data, elem, true ); + } + } +} ); + + +jQuery.each( ( "blur focus focusin focusout resize scroll click dblclick " + + "mousedown mouseup mousemove mouseover mouseout mouseenter mouseleave " + + "change select submit keydown keypress keyup contextmenu" ).split( " " ), + function( i, name ) { + + // Handle event binding + jQuery.fn[ name ] = function( data, fn ) { + return arguments.length > 0 ? + this.on( name, null, data, fn ) : + this.trigger( name ); + }; +} ); + +jQuery.fn.extend( { + hover: function( fnOver, fnOut ) { + return this.mouseenter( fnOver ).mouseleave( fnOut || fnOver ); + } +} ); + + + + +support.focusin = "onfocusin" in window; + + +// Support: Firefox <=44 +// Firefox doesn't have focus(in | out) events +// Related ticket - https://bugzilla.mozilla.org/show_bug.cgi?id=687787 +// +// Support: Chrome <=48 - 49, Safari <=9.0 - 9.1 +// focus(in | out) events fire after focus & blur events, +// which is spec violation - http://www.w3.org/TR/DOM-Level-3-Events/#events-focusevent-event-order +// Related ticket - https://bugs.chromium.org/p/chromium/issues/detail?id=449857 +if ( !support.focusin ) { + jQuery.each( { focus: "focusin", blur: "focusout" }, function( orig, fix ) { + + // Attach a single capturing handler on the document while someone wants focusin/focusout + var handler = function( event ) { + jQuery.event.simulate( fix, event.target, jQuery.event.fix( event ) ); + }; + + jQuery.event.special[ fix ] = { + setup: function() { + var doc = this.ownerDocument || this, + attaches = dataPriv.access( doc, fix ); + + if ( !attaches ) { + doc.addEventListener( orig, handler, true ); + } + dataPriv.access( doc, fix, ( attaches || 0 ) + 1 ); + }, + teardown: function() { + var doc = this.ownerDocument || this, + attaches = dataPriv.access( doc, fix ) - 1; + + if ( !attaches ) { + doc.removeEventListener( orig, handler, true ); + dataPriv.remove( doc, fix ); + + } else { + dataPriv.access( doc, fix, attaches ); + } + } + }; + } ); +} +var location = window.location; + +var nonce = jQuery.now(); + +var rquery = ( /\?/ ); + + + +// Cross-browser xml parsing +jQuery.parseXML = function( data ) { + var xml; + if ( !data || typeof data !== "string" ) { + return null; + } + + // Support: IE 9 - 11 only + // IE throws on parseFromString with invalid input. + try { + xml = ( new window.DOMParser() ).parseFromString( data, "text/xml" ); + } catch ( e ) { + xml = undefined; + } + + if ( !xml || xml.getElementsByTagName( "parsererror" ).length ) { + jQuery.error( "Invalid XML: " + data ); + } + return xml; +}; + + +var + rbracket = /\[\]$/, + rCRLF = /\r?\n/g, + rsubmitterTypes = /^(?:submit|button|image|reset|file)$/i, + rsubmittable = /^(?:input|select|textarea|keygen)/i; + +function buildParams( prefix, obj, traditional, add ) { + var name; + + if ( jQuery.isArray( obj ) ) { + + // Serialize array item. + jQuery.each( obj, function( i, v ) { + if ( traditional || rbracket.test( prefix ) ) { + + // Treat each array item as a scalar. + add( prefix, v ); + + } else { + + // Item is non-scalar (array or object), encode its numeric index. + buildParams( + prefix + "[" + ( typeof v === "object" && v != null ? i : "" ) + "]", + v, + traditional, + add + ); + } + } ); + + } else if ( !traditional && jQuery.type( obj ) === "object" ) { + + // Serialize object item. + for ( name in obj ) { + buildParams( prefix + "[" + name + "]", obj[ name ], traditional, add ); + } + + } else { + + // Serialize scalar item. + add( prefix, obj ); + } +} + +// Serialize an array of form elements or a set of +// key/values into a query string +jQuery.param = function( a, traditional ) { + var prefix, + s = [], + add = function( key, valueOrFunction ) { + + // If value is a function, invoke it and use its return value + var value = jQuery.isFunction( valueOrFunction ) ? + valueOrFunction() : + valueOrFunction; + + s[ s.length ] = encodeURIComponent( key ) + "=" + + encodeURIComponent( value == null ? "" : value ); + }; + + // If an array was passed in, assume that it is an array of form elements. + if ( jQuery.isArray( a ) || ( a.jquery && !jQuery.isPlainObject( a ) ) ) { + + // Serialize the form elements + jQuery.each( a, function() { + add( this.name, this.value ); + } ); + + } else { + + // If traditional, encode the "old" way (the way 1.3.2 or older + // did it), otherwise encode params recursively. + for ( prefix in a ) { + buildParams( prefix, a[ prefix ], traditional, add ); + } + } + + // Return the resulting serialization + return s.join( "&" ); +}; + +jQuery.fn.extend( { + serialize: function() { + return jQuery.param( this.serializeArray() ); + }, + serializeArray: function() { + return this.map( function() { + + // Can add propHook for "elements" to filter or add form elements + var elements = jQuery.prop( this, "elements" ); + return elements ? jQuery.makeArray( elements ) : this; + } ) + .filter( function() { + var type = this.type; + + // Use .is( ":disabled" ) so that fieldset[disabled] works + return this.name && !jQuery( this ).is( ":disabled" ) && + rsubmittable.test( this.nodeName ) && !rsubmitterTypes.test( type ) && + ( this.checked || !rcheckableType.test( type ) ); + } ) + .map( function( i, elem ) { + var val = jQuery( this ).val(); + + if ( val == null ) { + return null; + } + + if ( jQuery.isArray( val ) ) { + return jQuery.map( val, function( val ) { + return { name: elem.name, value: val.replace( rCRLF, "\r\n" ) }; + } ); + } + + return { name: elem.name, value: val.replace( rCRLF, "\r\n" ) }; + } ).get(); + } +} ); + + +var + r20 = /%20/g, + rhash = /#.*$/, + rantiCache = /([?&])_=[^&]*/, + rheaders = /^(.*?):[ \t]*([^\r\n]*)$/mg, + + // #7653, #8125, #8152: local protocol detection + rlocalProtocol = /^(?:about|app|app-storage|.+-extension|file|res|widget):$/, + rnoContent = /^(?:GET|HEAD)$/, + rprotocol = /^\/\//, + + /* Prefilters + * 1) They are useful to introduce custom dataTypes (see ajax/jsonp.js for an example) + * 2) These are called: + * - BEFORE asking for a transport + * - AFTER param serialization (s.data is a string if s.processData is true) + * 3) key is the dataType + * 4) the catchall symbol "*" can be used + * 5) execution will start with transport dataType and THEN continue down to "*" if needed + */ + prefilters = {}, + + /* Transports bindings + * 1) key is the dataType + * 2) the catchall symbol "*" can be used + * 3) selection will start with transport dataType and THEN go to "*" if needed + */ + transports = {}, + + // Avoid comment-prolog char sequence (#10098); must appease lint and evade compression + allTypes = "*/".concat( "*" ), + + // Anchor tag for parsing the document origin + originAnchor = document.createElement( "a" ); + originAnchor.href = location.href; + +// Base "constructor" for jQuery.ajaxPrefilter and jQuery.ajaxTransport +function addToPrefiltersOrTransports( structure ) { + + // dataTypeExpression is optional and defaults to "*" + return function( dataTypeExpression, func ) { + + if ( typeof dataTypeExpression !== "string" ) { + func = dataTypeExpression; + dataTypeExpression = "*"; + } + + var dataType, + i = 0, + dataTypes = dataTypeExpression.toLowerCase().match( rnothtmlwhite ) || []; + + if ( jQuery.isFunction( func ) ) { + + // For each dataType in the dataTypeExpression + while ( ( dataType = dataTypes[ i++ ] ) ) { + + // Prepend if requested + if ( dataType[ 0 ] === "+" ) { + dataType = dataType.slice( 1 ) || "*"; + ( structure[ dataType ] = structure[ dataType ] || [] ).unshift( func ); + + // Otherwise append + } else { + ( structure[ dataType ] = structure[ dataType ] || [] ).push( func ); + } + } + } + }; +} + +// Base inspection function for prefilters and transports +function inspectPrefiltersOrTransports( structure, options, originalOptions, jqXHR ) { + + var inspected = {}, + seekingTransport = ( structure === transports ); + + function inspect( dataType ) { + var selected; + inspected[ dataType ] = true; + jQuery.each( structure[ dataType ] || [], function( _, prefilterOrFactory ) { + var dataTypeOrTransport = prefilterOrFactory( options, originalOptions, jqXHR ); + if ( typeof dataTypeOrTransport === "string" && + !seekingTransport && !inspected[ dataTypeOrTransport ] ) { + + options.dataTypes.unshift( dataTypeOrTransport ); + inspect( dataTypeOrTransport ); + return false; + } else if ( seekingTransport ) { + return !( selected = dataTypeOrTransport ); + } + } ); + return selected; + } + + return inspect( options.dataTypes[ 0 ] ) || !inspected[ "*" ] && inspect( "*" ); +} + +// A special extend for ajax options +// that takes "flat" options (not to be deep extended) +// Fixes #9887 +function ajaxExtend( target, src ) { + var key, deep, + flatOptions = jQuery.ajaxSettings.flatOptions || {}; + + for ( key in src ) { + if ( src[ key ] !== undefined ) { + ( flatOptions[ key ] ? target : ( deep || ( deep = {} ) ) )[ key ] = src[ key ]; + } + } + if ( deep ) { + jQuery.extend( true, target, deep ); + } + + return target; +} + +/* Handles responses to an ajax request: + * - finds the right dataType (mediates between content-type and expected dataType) + * - returns the corresponding response + */ +function ajaxHandleResponses( s, jqXHR, responses ) { + + var ct, type, finalDataType, firstDataType, + contents = s.contents, + dataTypes = s.dataTypes; + + // Remove auto dataType and get content-type in the process + while ( dataTypes[ 0 ] === "*" ) { + dataTypes.shift(); + if ( ct === undefined ) { + ct = s.mimeType || jqXHR.getResponseHeader( "Content-Type" ); + } + } + + // Check if we're dealing with a known content-type + if ( ct ) { + for ( type in contents ) { + if ( contents[ type ] && contents[ type ].test( ct ) ) { + dataTypes.unshift( type ); + break; + } + } + } + + // Check to see if we have a response for the expected dataType + if ( dataTypes[ 0 ] in responses ) { + finalDataType = dataTypes[ 0 ]; + } else { + + // Try convertible dataTypes + for ( type in responses ) { + if ( !dataTypes[ 0 ] || s.converters[ type + " " + dataTypes[ 0 ] ] ) { + finalDataType = type; + break; + } + if ( !firstDataType ) { + firstDataType = type; + } + } + + // Or just use first one + finalDataType = finalDataType || firstDataType; + } + + // If we found a dataType + // We add the dataType to the list if needed + // and return the corresponding response + if ( finalDataType ) { + if ( finalDataType !== dataTypes[ 0 ] ) { + dataTypes.unshift( finalDataType ); + } + return responses[ finalDataType ]; + } +} + +/* Chain conversions given the request and the original response + * Also sets the responseXXX fields on the jqXHR instance + */ +function ajaxConvert( s, response, jqXHR, isSuccess ) { + var conv2, current, conv, tmp, prev, + converters = {}, + + // Work with a copy of dataTypes in case we need to modify it for conversion + dataTypes = s.dataTypes.slice(); + + // Create converters map with lowercased keys + if ( dataTypes[ 1 ] ) { + for ( conv in s.converters ) { + converters[ conv.toLowerCase() ] = s.converters[ conv ]; + } + } + + current = dataTypes.shift(); + + // Convert to each sequential dataType + while ( current ) { + + if ( s.responseFields[ current ] ) { + jqXHR[ s.responseFields[ current ] ] = response; + } + + // Apply the dataFilter if provided + if ( !prev && isSuccess && s.dataFilter ) { + response = s.dataFilter( response, s.dataType ); + } + + prev = current; + current = dataTypes.shift(); + + if ( current ) { + + // There's only work to do if current dataType is non-auto + if ( current === "*" ) { + + current = prev; + + // Convert response if prev dataType is non-auto and differs from current + } else if ( prev !== "*" && prev !== current ) { + + // Seek a direct converter + conv = converters[ prev + " " + current ] || converters[ "* " + current ]; + + // If none found, seek a pair + if ( !conv ) { + for ( conv2 in converters ) { + + // If conv2 outputs current + tmp = conv2.split( " " ); + if ( tmp[ 1 ] === current ) { + + // If prev can be converted to accepted input + conv = converters[ prev + " " + tmp[ 0 ] ] || + converters[ "* " + tmp[ 0 ] ]; + if ( conv ) { + + // Condense equivalence converters + if ( conv === true ) { + conv = converters[ conv2 ]; + + // Otherwise, insert the intermediate dataType + } else if ( converters[ conv2 ] !== true ) { + current = tmp[ 0 ]; + dataTypes.unshift( tmp[ 1 ] ); + } + break; + } + } + } + } + + // Apply converter (if not an equivalence) + if ( conv !== true ) { + + // Unless errors are allowed to bubble, catch and return them + if ( conv && s.throws ) { + response = conv( response ); + } else { + try { + response = conv( response ); + } catch ( e ) { + return { + state: "parsererror", + error: conv ? e : "No conversion from " + prev + " to " + current + }; + } + } + } + } + } + } + + return { state: "success", data: response }; +} + +jQuery.extend( { + + // Counter for holding the number of active queries + active: 0, + + // Last-Modified header cache for next request + lastModified: {}, + etag: {}, + + ajaxSettings: { + url: location.href, + type: "GET", + isLocal: rlocalProtocol.test( location.protocol ), + global: true, + processData: true, + async: true, + contentType: "application/x-www-form-urlencoded; charset=UTF-8", + + /* + timeout: 0, + data: null, + dataType: null, + username: null, + password: null, + cache: null, + throws: false, + traditional: false, + headers: {}, + */ + + accepts: { + "*": allTypes, + text: "text/plain", + html: "text/html", + xml: "application/xml, text/xml", + json: "application/json, text/javascript" + }, + + contents: { + xml: /\bxml\b/, + html: /\bhtml/, + json: /\bjson\b/ + }, + + responseFields: { + xml: "responseXML", + text: "responseText", + json: "responseJSON" + }, + + // Data converters + // Keys separate source (or catchall "*") and destination types with a single space + converters: { + + // Convert anything to text + "* text": String, + + // Text to html (true = no transformation) + "text html": true, + + // Evaluate text as a json expression + "text json": JSON.parse, + + // Parse text as xml + "text xml": jQuery.parseXML + }, + + // For options that shouldn't be deep extended: + // you can add your own custom options here if + // and when you create one that shouldn't be + // deep extended (see ajaxExtend) + flatOptions: { + url: true, + context: true + } + }, + + // Creates a full fledged settings object into target + // with both ajaxSettings and settings fields. + // If target is omitted, writes into ajaxSettings. + ajaxSetup: function( target, settings ) { + return settings ? + + // Building a settings object + ajaxExtend( ajaxExtend( target, jQuery.ajaxSettings ), settings ) : + + // Extending ajaxSettings + ajaxExtend( jQuery.ajaxSettings, target ); + }, + + ajaxPrefilter: addToPrefiltersOrTransports( prefilters ), + ajaxTransport: addToPrefiltersOrTransports( transports ), + + // Main method + ajax: function( url, options ) { + + // If url is an object, simulate pre-1.5 signature + if ( typeof url === "object" ) { + options = url; + url = undefined; + } + + // Force options to be an object + options = options || {}; + + var transport, + + // URL without anti-cache param + cacheURL, + + // Response headers + responseHeadersString, + responseHeaders, + + // timeout handle + timeoutTimer, + + // Url cleanup var + urlAnchor, + + // Request state (becomes false upon send and true upon completion) + completed, + + // To know if global events are to be dispatched + fireGlobals, + + // Loop variable + i, + + // uncached part of the url + uncached, + + // Create the final options object + s = jQuery.ajaxSetup( {}, options ), + + // Callbacks context + callbackContext = s.context || s, + + // Context for global events is callbackContext if it is a DOM node or jQuery collection + globalEventContext = s.context && + ( callbackContext.nodeType || callbackContext.jquery ) ? + jQuery( callbackContext ) : + jQuery.event, + + // Deferreds + deferred = jQuery.Deferred(), + completeDeferred = jQuery.Callbacks( "once memory" ), + + // Status-dependent callbacks + statusCode = s.statusCode || {}, + + // Headers (they are sent all at once) + requestHeaders = {}, + requestHeadersNames = {}, + + // Default abort message + strAbort = "canceled", + + // Fake xhr + jqXHR = { + readyState: 0, + + // Builds headers hashtable if needed + getResponseHeader: function( key ) { + var match; + if ( completed ) { + if ( !responseHeaders ) { + responseHeaders = {}; + while ( ( match = rheaders.exec( responseHeadersString ) ) ) { + responseHeaders[ match[ 1 ].toLowerCase() ] = match[ 2 ]; + } + } + match = responseHeaders[ key.toLowerCase() ]; + } + return match == null ? null : match; + }, + + // Raw string + getAllResponseHeaders: function() { + return completed ? responseHeadersString : null; + }, + + // Caches the header + setRequestHeader: function( name, value ) { + if ( completed == null ) { + name = requestHeadersNames[ name.toLowerCase() ] = + requestHeadersNames[ name.toLowerCase() ] || name; + requestHeaders[ name ] = value; + } + return this; + }, + + // Overrides response content-type header + overrideMimeType: function( type ) { + if ( completed == null ) { + s.mimeType = type; + } + return this; + }, + + // Status-dependent callbacks + statusCode: function( map ) { + var code; + if ( map ) { + if ( completed ) { + + // Execute the appropriate callbacks + jqXHR.always( map[ jqXHR.status ] ); + } else { + + // Lazy-add the new callbacks in a way that preserves old ones + for ( code in map ) { + statusCode[ code ] = [ statusCode[ code ], map[ code ] ]; + } + } + } + return this; + }, + + // Cancel the request + abort: function( statusText ) { + var finalText = statusText || strAbort; + if ( transport ) { + transport.abort( finalText ); + } + done( 0, finalText ); + return this; + } + }; + + // Attach deferreds + deferred.promise( jqXHR ); + + // Add protocol if not provided (prefilters might expect it) + // Handle falsy url in the settings object (#10093: consistency with old signature) + // We also use the url parameter if available + s.url = ( ( url || s.url || location.href ) + "" ) + .replace( rprotocol, location.protocol + "//" ); + + // Alias method option to type as per ticket #12004 + s.type = options.method || options.type || s.method || s.type; + + // Extract dataTypes list + s.dataTypes = ( s.dataType || "*" ).toLowerCase().match( rnothtmlwhite ) || [ "" ]; + + // A cross-domain request is in order when the origin doesn't match the current origin. + if ( s.crossDomain == null ) { + urlAnchor = document.createElement( "a" ); + + // Support: IE <=8 - 11, Edge 12 - 13 + // IE throws exception on accessing the href property if url is malformed, + // e.g. http://example.com:80x/ + try { + urlAnchor.href = s.url; + + // Support: IE <=8 - 11 only + // Anchor's host property isn't correctly set when s.url is relative + urlAnchor.href = urlAnchor.href; + s.crossDomain = originAnchor.protocol + "//" + originAnchor.host !== + urlAnchor.protocol + "//" + urlAnchor.host; + } catch ( e ) { + + // If there is an error parsing the URL, assume it is crossDomain, + // it can be rejected by the transport if it is invalid + s.crossDomain = true; + } + } + + // Convert data if not already a string + if ( s.data && s.processData && typeof s.data !== "string" ) { + s.data = jQuery.param( s.data, s.traditional ); + } + + // Apply prefilters + inspectPrefiltersOrTransports( prefilters, s, options, jqXHR ); + + // If request was aborted inside a prefilter, stop there + if ( completed ) { + return jqXHR; + } + + // We can fire global events as of now if asked to + // Don't fire events if jQuery.event is undefined in an AMD-usage scenario (#15118) + fireGlobals = jQuery.event && s.global; + + // Watch for a new set of requests + if ( fireGlobals && jQuery.active++ === 0 ) { + jQuery.event.trigger( "ajaxStart" ); + } + + // Uppercase the type + s.type = s.type.toUpperCase(); + + // Determine if request has content + s.hasContent = !rnoContent.test( s.type ); + + // Save the URL in case we're toying with the If-Modified-Since + // and/or If-None-Match header later on + // Remove hash to simplify url manipulation + cacheURL = s.url.replace( rhash, "" ); + + // More options handling for requests with no content + if ( !s.hasContent ) { + + // Remember the hash so we can put it back + uncached = s.url.slice( cacheURL.length ); + + // If data is available, append data to url + if ( s.data ) { + cacheURL += ( rquery.test( cacheURL ) ? "&" : "?" ) + s.data; + + // #9682: remove data so that it's not used in an eventual retry + delete s.data; + } + + // Add or update anti-cache param if needed + if ( s.cache === false ) { + cacheURL = cacheURL.replace( rantiCache, "$1" ); + uncached = ( rquery.test( cacheURL ) ? "&" : "?" ) + "_=" + ( nonce++ ) + uncached; + } + + // Put hash and anti-cache on the URL that will be requested (gh-1732) + s.url = cacheURL + uncached; + + // Change '%20' to '+' if this is encoded form body content (gh-2658) + } else if ( s.data && s.processData && + ( s.contentType || "" ).indexOf( "application/x-www-form-urlencoded" ) === 0 ) { + s.data = s.data.replace( r20, "+" ); + } + + // Set the If-Modified-Since and/or If-None-Match header, if in ifModified mode. + if ( s.ifModified ) { + if ( jQuery.lastModified[ cacheURL ] ) { + jqXHR.setRequestHeader( "If-Modified-Since", jQuery.lastModified[ cacheURL ] ); + } + if ( jQuery.etag[ cacheURL ] ) { + jqXHR.setRequestHeader( "If-None-Match", jQuery.etag[ cacheURL ] ); + } + } + + // Set the correct header, if data is being sent + if ( s.data && s.hasContent && s.contentType !== false || options.contentType ) { + jqXHR.setRequestHeader( "Content-Type", s.contentType ); + } + + // Set the Accepts header for the server, depending on the dataType + jqXHR.setRequestHeader( + "Accept", + s.dataTypes[ 0 ] && s.accepts[ s.dataTypes[ 0 ] ] ? + s.accepts[ s.dataTypes[ 0 ] ] + + ( s.dataTypes[ 0 ] !== "*" ? ", " + allTypes + "; q=0.01" : "" ) : + s.accepts[ "*" ] + ); + + // Check for headers option + for ( i in s.headers ) { + jqXHR.setRequestHeader( i, s.headers[ i ] ); + } + + // Allow custom headers/mimetypes and early abort + if ( s.beforeSend && + ( s.beforeSend.call( callbackContext, jqXHR, s ) === false || completed ) ) { + + // Abort if not done already and return + return jqXHR.abort(); + } + + // Aborting is no longer a cancellation + strAbort = "abort"; + + // Install callbacks on deferreds + completeDeferred.add( s.complete ); + jqXHR.done( s.success ); + jqXHR.fail( s.error ); + + // Get transport + transport = inspectPrefiltersOrTransports( transports, s, options, jqXHR ); + + // If no transport, we auto-abort + if ( !transport ) { + done( -1, "No Transport" ); + } else { + jqXHR.readyState = 1; + + // Send global event + if ( fireGlobals ) { + globalEventContext.trigger( "ajaxSend", [ jqXHR, s ] ); + } + + // If request was aborted inside ajaxSend, stop there + if ( completed ) { + return jqXHR; + } + + // Timeout + if ( s.async && s.timeout > 0 ) { + timeoutTimer = window.setTimeout( function() { + jqXHR.abort( "timeout" ); + }, s.timeout ); + } + + try { + completed = false; + transport.send( requestHeaders, done ); + } catch ( e ) { + + // Rethrow post-completion exceptions + if ( completed ) { + throw e; + } + + // Propagate others as results + done( -1, e ); + } + } + + // Callback for when everything is done + function done( status, nativeStatusText, responses, headers ) { + var isSuccess, success, error, response, modified, + statusText = nativeStatusText; + + // Ignore repeat invocations + if ( completed ) { + return; + } + + completed = true; + + // Clear timeout if it exists + if ( timeoutTimer ) { + window.clearTimeout( timeoutTimer ); + } + + // Dereference transport for early garbage collection + // (no matter how long the jqXHR object will be used) + transport = undefined; + + // Cache response headers + responseHeadersString = headers || ""; + + // Set readyState + jqXHR.readyState = status > 0 ? 4 : 0; + + // Determine if successful + isSuccess = status >= 200 && status < 300 || status === 304; + + // Get response data + if ( responses ) { + response = ajaxHandleResponses( s, jqXHR, responses ); + } + + // Convert no matter what (that way responseXXX fields are always set) + response = ajaxConvert( s, response, jqXHR, isSuccess ); + + // If successful, handle type chaining + if ( isSuccess ) { + + // Set the If-Modified-Since and/or If-None-Match header, if in ifModified mode. + if ( s.ifModified ) { + modified = jqXHR.getResponseHeader( "Last-Modified" ); + if ( modified ) { + jQuery.lastModified[ cacheURL ] = modified; + } + modified = jqXHR.getResponseHeader( "etag" ); + if ( modified ) { + jQuery.etag[ cacheURL ] = modified; + } + } + + // if no content + if ( status === 204 || s.type === "HEAD" ) { + statusText = "nocontent"; + + // if not modified + } else if ( status === 304 ) { + statusText = "notmodified"; + + // If we have data, let's convert it + } else { + statusText = response.state; + success = response.data; + error = response.error; + isSuccess = !error; + } + } else { + + // Extract error from statusText and normalize for non-aborts + error = statusText; + if ( status || !statusText ) { + statusText = "error"; + if ( status < 0 ) { + status = 0; + } + } + } + + // Set data for the fake xhr object + jqXHR.status = status; + jqXHR.statusText = ( nativeStatusText || statusText ) + ""; + + // Success/Error + if ( isSuccess ) { + deferred.resolveWith( callbackContext, [ success, statusText, jqXHR ] ); + } else { + deferred.rejectWith( callbackContext, [ jqXHR, statusText, error ] ); + } + + // Status-dependent callbacks + jqXHR.statusCode( statusCode ); + statusCode = undefined; + + if ( fireGlobals ) { + globalEventContext.trigger( isSuccess ? "ajaxSuccess" : "ajaxError", + [ jqXHR, s, isSuccess ? success : error ] ); + } + + // Complete + completeDeferred.fireWith( callbackContext, [ jqXHR, statusText ] ); + + if ( fireGlobals ) { + globalEventContext.trigger( "ajaxComplete", [ jqXHR, s ] ); + + // Handle the global AJAX counter + if ( !( --jQuery.active ) ) { + jQuery.event.trigger( "ajaxStop" ); + } + } + } + + return jqXHR; + }, + + getJSON: function( url, data, callback ) { + return jQuery.get( url, data, callback, "json" ); + }, + + getScript: function( url, callback ) { + return jQuery.get( url, undefined, callback, "script" ); + } +} ); + +jQuery.each( [ "get", "post" ], function( i, method ) { + jQuery[ method ] = function( url, data, callback, type ) { + + // Shift arguments if data argument was omitted + if ( jQuery.isFunction( data ) ) { + type = type || callback; + callback = data; + data = undefined; + } + + // The url can be an options object (which then must have .url) + return jQuery.ajax( jQuery.extend( { + url: url, + type: method, + dataType: type, + data: data, + success: callback + }, jQuery.isPlainObject( url ) && url ) ); + }; +} ); + + +jQuery._evalUrl = function( url ) { + return jQuery.ajax( { + url: url, + + // Make this explicit, since user can override this through ajaxSetup (#11264) + type: "GET", + dataType: "script", + cache: true, + async: false, + global: false, + "throws": true + } ); +}; + + +jQuery.fn.extend( { + wrapAll: function( html ) { + var wrap; + + if ( this[ 0 ] ) { + if ( jQuery.isFunction( html ) ) { + html = html.call( this[ 0 ] ); + } + + // The elements to wrap the target around + wrap = jQuery( html, this[ 0 ].ownerDocument ).eq( 0 ).clone( true ); + + if ( this[ 0 ].parentNode ) { + wrap.insertBefore( this[ 0 ] ); + } + + wrap.map( function() { + var elem = this; + + while ( elem.firstElementChild ) { + elem = elem.firstElementChild; + } + + return elem; + } ).append( this ); + } + + return this; + }, + + wrapInner: function( html ) { + if ( jQuery.isFunction( html ) ) { + return this.each( function( i ) { + jQuery( this ).wrapInner( html.call( this, i ) ); + } ); + } + + return this.each( function() { + var self = jQuery( this ), + contents = self.contents(); + + if ( contents.length ) { + contents.wrapAll( html ); + + } else { + self.append( html ); + } + } ); + }, + + wrap: function( html ) { + var isFunction = jQuery.isFunction( html ); + + return this.each( function( i ) { + jQuery( this ).wrapAll( isFunction ? html.call( this, i ) : html ); + } ); + }, + + unwrap: function( selector ) { + this.parent( selector ).not( "body" ).each( function() { + jQuery( this ).replaceWith( this.childNodes ); + } ); + return this; + } +} ); + + +jQuery.expr.pseudos.hidden = function( elem ) { + return !jQuery.expr.pseudos.visible( elem ); +}; +jQuery.expr.pseudos.visible = function( elem ) { + return !!( elem.offsetWidth || elem.offsetHeight || elem.getClientRects().length ); +}; + + + + +jQuery.ajaxSettings.xhr = function() { + try { + return new window.XMLHttpRequest(); + } catch ( e ) {} +}; + +var xhrSuccessStatus = { + + // File protocol always yields status code 0, assume 200 + 0: 200, + + // Support: IE <=9 only + // #1450: sometimes IE returns 1223 when it should be 204 + 1223: 204 + }, + xhrSupported = jQuery.ajaxSettings.xhr(); + +support.cors = !!xhrSupported && ( "withCredentials" in xhrSupported ); +support.ajax = xhrSupported = !!xhrSupported; + +jQuery.ajaxTransport( function( options ) { + var callback, errorCallback; + + // Cross domain only allowed if supported through XMLHttpRequest + if ( support.cors || xhrSupported && !options.crossDomain ) { + return { + send: function( headers, complete ) { + var i, + xhr = options.xhr(); + + xhr.open( + options.type, + options.url, + options.async, + options.username, + options.password + ); + + // Apply custom fields if provided + if ( options.xhrFields ) { + for ( i in options.xhrFields ) { + xhr[ i ] = options.xhrFields[ i ]; + } + } + + // Override mime type if needed + if ( options.mimeType && xhr.overrideMimeType ) { + xhr.overrideMimeType( options.mimeType ); + } + + // X-Requested-With header + // For cross-domain requests, seeing as conditions for a preflight are + // akin to a jigsaw puzzle, we simply never set it to be sure. + // (it can always be set on a per-request basis or even using ajaxSetup) + // For same-domain requests, won't change header if already provided. + if ( !options.crossDomain && !headers[ "X-Requested-With" ] ) { + headers[ "X-Requested-With" ] = "XMLHttpRequest"; + } + + // Set headers + for ( i in headers ) { + xhr.setRequestHeader( i, headers[ i ] ); + } + + // Callback + callback = function( type ) { + return function() { + if ( callback ) { + callback = errorCallback = xhr.onload = + xhr.onerror = xhr.onabort = xhr.onreadystatechange = null; + + if ( type === "abort" ) { + xhr.abort(); + } else if ( type === "error" ) { + + // Support: IE <=9 only + // On a manual native abort, IE9 throws + // errors on any property access that is not readyState + if ( typeof xhr.status !== "number" ) { + complete( 0, "error" ); + } else { + complete( + + // File: protocol always yields status 0; see #8605, #14207 + xhr.status, + xhr.statusText + ); + } + } else { + complete( + xhrSuccessStatus[ xhr.status ] || xhr.status, + xhr.statusText, + + // Support: IE <=9 only + // IE9 has no XHR2 but throws on binary (trac-11426) + // For XHR2 non-text, let the caller handle it (gh-2498) + ( xhr.responseType || "text" ) !== "text" || + typeof xhr.responseText !== "string" ? + { binary: xhr.response } : + { text: xhr.responseText }, + xhr.getAllResponseHeaders() + ); + } + } + }; + }; + + // Listen to events + xhr.onload = callback(); + errorCallback = xhr.onerror = callback( "error" ); + + // Support: IE 9 only + // Use onreadystatechange to replace onabort + // to handle uncaught aborts + if ( xhr.onabort !== undefined ) { + xhr.onabort = errorCallback; + } else { + xhr.onreadystatechange = function() { + + // Check readyState before timeout as it changes + if ( xhr.readyState === 4 ) { + + // Allow onerror to be called first, + // but that will not handle a native abort + // Also, save errorCallback to a variable + // as xhr.onerror cannot be accessed + window.setTimeout( function() { + if ( callback ) { + errorCallback(); + } + } ); + } + }; + } + + // Create the abort callback + callback = callback( "abort" ); + + try { + + // Do send the request (this may raise an exception) + xhr.send( options.hasContent && options.data || null ); + } catch ( e ) { + + // #14683: Only rethrow if this hasn't been notified as an error yet + if ( callback ) { + throw e; + } + } + }, + + abort: function() { + if ( callback ) { + callback(); + } + } + }; + } +} ); + + + + +// Prevent auto-execution of scripts when no explicit dataType was provided (See gh-2432) +jQuery.ajaxPrefilter( function( s ) { + if ( s.crossDomain ) { + s.contents.script = false; + } +} ); + +// Install script dataType +jQuery.ajaxSetup( { + accepts: { + script: "text/javascript, application/javascript, " + + "application/ecmascript, application/x-ecmascript" + }, + contents: { + script: /\b(?:java|ecma)script\b/ + }, + converters: { + "text script": function( text ) { + jQuery.globalEval( text ); + return text; + } + } +} ); + +// Handle cache's special case and crossDomain +jQuery.ajaxPrefilter( "script", function( s ) { + if ( s.cache === undefined ) { + s.cache = false; + } + if ( s.crossDomain ) { + s.type = "GET"; + } +} ); + +// Bind script tag hack transport +jQuery.ajaxTransport( "script", function( s ) { + + // This transport only deals with cross domain requests + if ( s.crossDomain ) { + var script, callback; + return { + send: function( _, complete ) { + script = jQuery( " + + + + {% block postload_javascript %} + {% endblock %} + + diff --git a/src/templates/contact.html b/src/templates/contact.html new file mode 100644 index 0000000..92278d8 --- /dev/null +++ b/src/templates/contact.html @@ -0,0 +1,11 @@ +{% extends "base.html" %} +{% load static %} + +{% block body %} +
+
+

Contact

+

Check back soon!

+
+
+{% endblock %} diff --git a/src/templates/error.html b/src/templates/error.html new file mode 100644 index 0000000..05c7363 --- /dev/null +++ b/src/templates/error.html @@ -0,0 +1,13 @@ +{% extends "base.html" %} +{% load static %} + +{% block body %} +
+
+

Uh-oh!

+

404 Error - Page Not Found

+
+

Home page »

+
+
+{% endblock %} diff --git a/src/templates/index.html b/src/templates/index.html new file mode 100755 index 0000000..a90d985 --- /dev/null +++ b/src/templates/index.html @@ -0,0 +1,32 @@ +{% extends "base.html" %} +{% load static %} + +{% block body %} +
+
+

Welcome to Project Lovelace!

+

Project Lovelace is an open online platform for learning about science and developing computational thinking through programming and problem solving. We are deploying the website and the problems one by one throughout the winter in preparation for a pilot run in April 2017.

+

Check Out the problems »

+
+
+ +
+
+
+

Problems

+

Each problem teaches a scientific application (e.g. locating earthquakes, DNA splicing) and requires the use of scientific insight and some programming skills to solve.

+

Check out the problems »

+
+
+

Tutorials

+

Tutorials teach computational methods that students and researchers may find useful (e.g. solving differential equations, Bayesian inference) and tend to be more pedagogical than the problems.

+

Check out the tutorials »

+
+
+

About

+

We're hoping to not only become a recreational science and programming website, but also a resource for developing computational thinking in science students.

+

Find out more about us »

+
+
+
+{% endblock %} \ No newline at end of file diff --git a/src/templates/navbar.html b/src/templates/navbar.html new file mode 100644 index 0000000..42a1ebf --- /dev/null +++ b/src/templates/navbar.html @@ -0,0 +1,29 @@ + \ No newline at end of file diff --git a/src/templates/temporary/tutorial_1.html b/src/templates/temporary/tutorial_1.html new file mode 100644 index 0000000..4149ab1 --- /dev/null +++ b/src/templates/temporary/tutorial_1.html @@ -0,0 +1,96 @@ +{% extends "problems/problem.html" %} + +{% block problem_name %}First-order equations: The Euler method{% endblock %} + +{% block required %} +

Required math: Differential calculus.

+{% endblock %} + +{% block introduction %} + +

+ The laws of nature are often written down in terms of differential equations. Everything + from the motion of a baseball and cannon shells to the quantum state of a particle and the + global ocean circulation are described in terms of differential equations. Without them, we + wouldn't be able to understand most physical phenomena! +

+

+ A differential equation (DE) in a dependent variable $y(t)$ is any equation containing + $y(t)$ and its derivatives. A first-order DE only contains $y(t)$ and its first derivative + $\frac{dy}{dt}$. So one way to write a general first-order DE is + + $$ \frac{dy(t)}{dt} = f \left( t,y(t) \right) $$ +

+

+ Many DE's can be solved by hand but many more cannot, making numerical/computational + solutions very useful. In this tutorial you will solve a first-order ordinary differential + equation (ODE) using Euler's method. The appendix discusses Euler's method more generally +

+ + +

+ The ODE given in the problem may be solved by hand however you will solve it using Euler's + method. To implement the method, the first step is to approximate the derivative by a + finite difference + + $$ \frac{\Delta P}{\Delta t} = \left( 1 - \frac{P}{K} \right) rP $$ + + where $\Delta P$ is the change in $P$ between two iterations of Euler's method and + $\Delta t$ is the time step between iterations. Explicitly writing + $\Delta P = P_{i+1} - P_i$ we can write + + $$ \frac{P_{i+1} - P_i}{\Delta t} = \left( 1 - \frac{P_i}{K} \right) rP_i $$ + + or solving for $P_{i+1}$ we get + + $$ P_{i+1} = P_i + \left( 1 - \frac{P_i}{K} \right) rP_i\Delta t $$ +

+

+ We can then pick a small value for $\Delta t$ and approximate the solution starting from + $t=0$. $P(0)=P_0$ is given as an input so we can calculate + + $$ P(\Delta t) = P_1 = P_0 + \left( 1 - \frac{P_0}{K} \right) rP_0\Delta t $$ + $$ P(2\Delta t) = P_2 = P_1 + \left( 1 - \frac{P_1}{K} \right) rP_1\Delta t $$ + + and so on until you have enough of the solution as desired. The smaller you pick $\Delta t$ + to be, the more accurate your solution will be in generaly; however, it will take more + steps to compute. +

+{% endblock %} + +{% block problem_body %} +

+ Let $P = P(t)$ denote the population of geese on a university campus as a function of time + (days). Then the population can be modelled by the differential equation + + $$ \frac{dP}{dt} = \left( 1 - \frac{P}{K} \right) rP \quad $$ + + with the initial condition $P(0) = P_0$, where $K$ is the "carrying capacity" or the + maximum number of geese the campus may sustain according to the model, and $r$ is the + growth rate of the geese. $P_0$ is the initial geese population at time $t=0$. +

+

+ The university would like to keep the population at a reasonable level and so it's your job + to predict when the goose population will reach half the carrying capacity $(K/2)$. +

+{% endblock %} + +{% block input_description %} +

Values for $K$, $r$, and $P_0$.

+{% endblock %} + +{% block input_example %} + K r P_0
+ 800 4.5 150 +{% endblock %} + +{% block output_description %} +

+ The number of days (rounded down to the nearest integer) on which the population reaches + $K/2$. +

+{% endblock %} + +{% block output_example %} + 37 +{% endblock %} diff --git a/src/templates/temporary/tutorials.html b/src/templates/temporary/tutorials.html new file mode 100644 index 0000000..73d4ba6 --- /dev/null +++ b/src/templates/temporary/tutorials.html @@ -0,0 +1,40 @@ +{% extends "base.html" %} +{% load static %} + +{% block body %} +
+
+

Tutorials

+ +

Ordinary differential equations

+ + + + + + + + + + + + + + + + + + + + + + + + + + +

ID#

Tutorial title

T1

First-order equations: The Euler method, Cancerous equations

T2

Coupled first-order equations, Crabs and ants for Christmas

T3

Second-order equations, Projectile motion

+ +
+
+{% endblock %} \ No newline at end of file diff --git a/tutorials.html b/tutorials.html deleted file mode 100644 index 46e7a67..0000000 --- a/tutorials.html +++ /dev/null @@ -1,92 +0,0 @@ - - - - - - - - - - - - Tutorials | Project Lovelace - - - - - - - - - -
-
-

Tutorials

- -

Ordinary differential equations

- - - - - - - - - - - - - - - - - - - - - - - - - - -

ID#

Tutorial title

T1

First-order equations: The Euler method, Cancerous equations

T2

Coupled first-order equations, Crabs and ants for Christmas

T3

Second-order equations, Projectile motion

- -
-
- - - - - - - -