Unable to merge paired reads in batch mode

[sharagyaltshen]

I haven't been able to merge my paired reads in batch mode. My reads do cover most of my amplicon so I'm not sure what the issue is. This the code and the files I used:

CRISPRessoBatch --batch_settings batch_list.txt --amplicon_seq GATGTCGAAGAGAACCCTGGCCCTGGTTCCGATATCTCTAGAGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCG -p 4 --base_edit -g CTCGTGACCACgtTGACgTg -wc -10 -w 20 -e GATGTCGAAGAGAACCCTGGCCCTGGTTCCGATATCTCTAGAGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACgtTGACgTggGGCGTcCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCG --trimmomatic_options_string ILLUMNINA:nextera_adapter.fa:0:90:10:0:true

batch_list.txt
nextera_adapter.txt
1_S1_L001_R1_001.fastq.gz
1_S1_L001_R2_001.fastq.gz
2_S2_L001_R1_001.fastq.gz
2_S2_L001_R2_001.fastq.gz
3_S3_L001_R1_001.fastq.gz
3_S3_L001_R2_001.fastq.gz
4_S4_L001_R1_001.fastq.gz
4_S4_L001_R2_001.fastq.gz
5_S5_L001_R1_001.fastq.gz
5_S5_L001_R2_001.fastq.gz

[kclem]

HI @sharagyaltshen Thanks for using CRISPResso!

I looked at a few of your reads from 1_S1, and it looks like they all start with "GCCACAAGTTCAGCGTGTCCGGCGAGGGCG" which aligns to about halfway through your reference amplicon.

Can you double-check that you used the correct sequencing primers?

thanks,

Kendell

[sharagyaltshen]

I had the wrong primer pair. I put in the right primers and it's working fine now. Thanks so much for the quick response!

[Colelyman]

Also, it looks like the reads are separated into different samples instead of pairing up the mates. See below for how to pass in paired-end reads using CRISPRessoBatch.

name	fastq_r1	fastq_r2
1	1_S1_L001_R1_001.fastq.gz	1_S1_L001_R2_001.fastq.gz
2	2_S2_L001_R1_001.fastq.gz	2_S2_L001_R2_001.fastq.gz
3	3_S3_L001_R1_001.fastq.gz	3_S3_L001_R2_001.fastq.gz
4	4_S4_L001_R1_001.fastq.gz	4_S4_L001_R2_001.fastq.gz
5	5_S5_L001_R1_001.fastq.gz	5_S5_L001_R2_001.fastq.gz

[sharagyaltshen]

I had tried that previously and it didn't work. Realised that there were invisible characters, removed them and now they're being merged successfully. Thank you!

[mah3mu]

I'm having a similar issue. Flash is able to merge my reads when I run them one at a time, but when I try to run them using CRISPRessoBatch they are not able to merge. I'm wondering if my batch settings file is the issue.
braf_batch.txt

This is an example of the error message that comes up for each sample in the batch:

ERROR: CRISPResso batch #0 failed. For more information, try running the command: "CRISPResso -o "/Users/kaufmanlab/Desktop/Michael Data/sequencing0530/CRISPRessoBatch_on_braf_batch" --name AB_1 --aln_seed_min 2 --prime_editing_pegRNA_extension_seq GCGGGACTTCTCTGTAGCGAGACCGAAATCTCCAATC --max_rows_alleles_around_cut_to_plot 50 --default_min_aln_score 60 --min_frequency_alleles_around_cut_to_plot 0.2 --prime_editing_pegRNA_scaffold_min_match_length 1 --min_bp_quality_or_N 0 --fastq_r2 Kaufman_AB_braf_1_SIC_index_1366_SIC_Index2_128_CCGCAACACA_TTTCTA_S203_R2_001.fastq --prime_editing_pegRNA_scaffold_seq GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC --verbosity 3 --aln_seed_count 5 --min_single_bp_quality 0 --min_average_read_quality 0 --n_processes 1 --amplicon_seq GCCGTAACATCACTTCTCTAGACATCTTTTTGCACGAGGATTTAACGGTAAAGATTGGAGATTTCGGTCTGGCTACAGTGAAGTCCCGCTGGAGCGGATCACACCAGTTTGAGCAACTTTCAGGCTCTATCTTGTGGATGGTGAGTGAAGGAA --exclude_bp_from_left 15 --prime_editing_pegRNA_extension_quantification_window_size 5 --aln_seed_len 10 --fastq_r1 Kaufman_AB_braf_1_SIC_index_1366_SIC_Index2_128_CCGCAACACA_TTTCTA_S203_R1_001.fastq --exclude_bp_from_right 15 --quantification_window_size 1 --max_paired_end_reads_overlap 100 --conversion_nuc_to T --needleman_wunsch_gap_open -20 --prime_editing_pegRNA_spacer_seq AAAGATTGGAGATTTCGGTC --needleman_wunsch_gap_extend -2 --flexiguide_homology 80 --needleman_wunsch_aln_matrix_loc EDNAFULL --conversion_nuc_from C --plot_window_size 20 --min_paired_end_reads_overlap 10 --needleman_wunsch_gap_incentive 1 --trimmomatic_command trimmomatic --quantification_window_center -3 --flash_command flash --amplicon_name Reference"

Any help would be greatly appreciated!

[kclem]

Hi @mah3mu do you get an error when you try to run that CRISPResso command?

[mah3mu]

When I run the CRISPResso command from the error message, I get
"2.00% Merging error, please check your input.

ERROR: Flash failed to run, please check the log file." in the status file and "CRISPResso2.CRISPRessoShared.FlashException: Flash failed to run, please check the log file.

Merging error, please check your input.

ERROR: Flash failed to run, please check the log file." in the running log.

[kclem]

What version of CRISPResso are you using? And do you have flash installed? e.g. when you run 'flash' what do you get?

[mah3mu]

My computer has CRISPResso version 2.2.12 installed and this is what I get when I run flash:
Usage: flash [OPTIONS] MATES_1.FASTQ MATES_2.FASTQ
Run `flash --help | less' for more information.

I was able to use CRISPResso to run the samples one by one and then compile then using CRISPRessoAggregate though.

[Haldrup]

I get the exact same error.

Does it make any sense to run CRISPResso 2.3.0 instead as it dont rely on flash?

[kclem]

Hi @Haldrup,

You can use the branch with fastp integration here: #253

Otherwise, I'm not sure what caused this error in the first place. Can you run the 'flash' command on the command line? And does this flash error happen only when you run in batch mode, but you can run single runs correctly (like mah3mu)? Is there a file in your current directory called 'flash'?