nextflow.config

/*
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    nf-core/readsimulator Nextflow config file
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    Default config options for all compute environments
----------------------------------------------------------------------------------------
*/

// Global default params, used in configs
params {

    // Input options
    input                      = null
    // References
    genome                     = null
    igenomes_base              = 's3://ngi-igenomes/igenomes/'
    igenomes_ignore            = false
    fasta                      = null
    ncbidownload_accessions    = null
    ncbidownload_taxids        = null
    ncbidownload_group         = "all"
    ncbidownload_section       = "refseq"

    // Simulation options
    amplicon                   = false
    target_capture             = false
    metagenome                 = false
    wholegenome                = false

    // Amplicon options
    amplicon_fw_primer         = 'GTCGGTAAAACTCGTGCCAGC'
    amplicon_rv_primer         = 'CATAGTGGGGTATCTAATCCCAGTTTG'
    amplicon_read_count        = 500
    amplicon_read_length       = 130
    amplicon_seq_system        = 'HS25'
    amplicon_crabs_ispcr_error = 4.5

    // Target capture options
    probe_file                 = null
    probe_ref_name             = 'Tetrapods-UCE-5Kv1'
    target_capture_mode        = 'illumina'
    target_capture_fmedian     = 500
    target_capture_fshape      = 6.0
    target_capture_smedian     = 1300
    target_capture_sshape      = 6.0
    target_capture_tmedian     = null
    target_capture_tshape      = null
    target_capture_num         = 500000
    target_capture_illen       = 150
    target_capture_pblen       = 30000
    target_capture_ilmode      = 'pe'

    // Metagenome options
    metagenome_abundance       = 'lognormal'
    metagenome_abundance_file  = null
    metagenome_coverage        = null
    metagenome_coverage_file   = null
    metagenome_input_format    = 'genomes'
    metagenome_n_reads         = '1M'
    metagenome_mode            = 'kde'
    metagenome_model           = 'MiSeq'
    metagenome_gc_bias         = null

    // Whole Genome options
    wholegenome_error_rate     = 0.02
    wholegenome_outer_dist     = 500
    wholegenome_standard_dev   = 50
    wholegenome_n_reads        = 1000000
    wholegenome_r1_length      = 70
    wholegenome_r2_length      = 70
    wholegenome_mutation_rate  = 0.001
    wholegenome_indel_fraction = 0.15
    wholegenome_indel_extended = 0.3

    // MultiQC options
    multiqc_config             = null
    multiqc_title              = null
    multiqc_logo               = null
    max_multiqc_email_size     = '25.MB'
    multiqc_methods_description = null

    // Boilerplate options
    outdir                     = null
    publish_dir_mode           = 'copy'
    email                      = null
    email_on_fail              = null
    plaintext_email            = false
    monochrome_logs            = false
    hook_url                   = null
    help                       = false
    version                    = false

    // Config options
    config_profile_name        = null
    config_profile_description = null
    custom_config_version      = 'master'
    custom_config_base         = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}"
    config_profile_contact     = null
    config_profile_url         = null

    // Max resource options
    // Defaults only, expecting to be overwritten
    max_memory                 = '128.GB'
    max_cpus                   = 16
    max_time                   = '240.h'

    // Schema validation default options
    validationFailUnrecognisedParams = false
    validationLenientMode            = false
    validationSchemaIgnoreParams     = 'genomes,igenomes_base,probe_ref_db'
    validationShowHiddenParams       = false
    validate_params                  = true
}

// Load base.config by default for all pipelines
includeConfig 'conf/base.config'

// Load ref_databases.config for reference taxonomy
includeConfig 'conf/ref_databases.config'

// Load nf-core custom profiles from different Institutions
try {
    includeConfig "${params.custom_config_base}/nfcore_custom.config"
} catch (Exception e) {
    System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config")
}

// Load nf-core/readsimulator custom profiles from different institutions.
// Warning: Uncomment only if a pipeline-specific institutional config already exists on nf-core/configs!
// try {
//   includeConfig "${params.custom_config_base}/pipeline/readsimulator.config"
// } catch (Exception e) {
//   System.err.println("WARNING: Could not load nf-core/config/readsimulator profiles: ${params.custom_config_base}/pipeline/readsimulator.config")
// }
profiles {
    debug {
        dumpHashes             = true
        process.beforeScript   = 'echo $HOSTNAME'
        cleanup                = false
        nextflow.enable.configProcessNamesValidation = true
    }
    conda {
        conda.enabled          = true
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        channels               = ['conda-forge', 'bioconda', 'defaults']
        apptainer.enabled      = false
    }
    mamba {
        conda.enabled          = true
        conda.useMamba         = true
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    docker {
        docker.enabled         = true
        conda.enabled          = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
        docker.runOptions      = '-u $(id -u):$(id -g)'
    }
    arm {
        docker.runOptions      = '-u $(id -u):$(id -g) --platform=linux/amd64'
    }
    singularity {
        singularity.enabled    = true
        singularity.autoMounts = true
        conda.enabled          = false
        docker.enabled         = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    podman {
        podman.enabled         = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    shifter {
        shifter.enabled        = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    charliecloud {
        charliecloud.enabled   = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        apptainer.enabled      = false
    }
    apptainer {
        apptainer.enabled      = true
        apptainer.autoMounts   = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
    }
    gitpod {
        executor.name          = 'local'
        executor.cpus          = 4
        executor.memory        = 8.GB
    }
    test      { includeConfig 'conf/test.config'      }
    test_full { includeConfig 'conf/test_full.config' }
}

// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile
// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled
// Set to your registry if you have a mirror of containers
apptainer.registry   = 'quay.io'
docker.registry      = 'quay.io'
podman.registry      = 'quay.io'
singularity.registry = 'quay.io'

// Nextflow plugins
plugins {
    id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet
}

// Load igenomes.config if required
if (!params.igenomes_ignore) {
    includeConfig 'conf/igenomes.config'
} else {
    params.genomes = [:]
    params.igenomes_base = null
}
// Export these variables to prevent local Python/R libraries from conflicting with those in the container
// The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container.
// See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable.

env {
    PYTHONNOUSERSITE = 1
    R_PROFILE_USER   = "/.Rprofile"
    R_ENVIRON_USER   = "/.Renviron"
    JULIA_DEPOT_PATH = "/usr/local/share/julia"
}

// Capture exit codes from upstream processes when piping
process.shell = ['/bin/bash', '-euo', 'pipefail']

// Disable process selector warnings by default. Use debug profile to enable warnings.
nextflow.enable.configProcessNamesValidation = false

def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
timeline {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html"
}
report {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html"
}
trace {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt"
}
dag {
    enabled = true
    file    = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html"
}

manifest {
    name            = 'nf-core/readsimulator'
    author          = """Adam Bennett"""
    homePage        = 'https://github.com/nf-core/readsimulator'
    description     = """A workflow to simulate reads"""
    mainScript      = 'main.nf'
    nextflowVersion = '!>=23.04.0'
    version         = '1.0.1'
    doi             = '10.5281/zenodo.10622410'
}

// Load modules.config for DSL2 module specific options
includeConfig 'conf/modules.config'

// Function to ensure that resource requirements don't go beyond
// a maximum limit
def check_max(obj, type) {
    if (type == 'memory') {
        try {
            if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1)
                return params.max_memory as nextflow.util.MemoryUnit
            else
                return obj
        } catch (all) {
            println "   ### ERROR ###   Max memory '${params.max_memory}' is not valid! Using default value: $obj"
            return obj
        }
    } else if (type == 'time') {
        try {
            if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1)
                return params.max_time as nextflow.util.Duration
            else
                return obj
        } catch (all) {
            println "   ### ERROR ###   Max time '${params.max_time}' is not valid! Using default value: $obj"
            return obj
        }
    } else if (type == 'cpus') {
        try {
            return Math.min( obj, params.max_cpus as int )
        } catch (all) {
            println "   ### ERROR ###   Max cpus '${params.max_cpus}' is not valid! Using default value: $obj"
            return obj
        }
    }
}