Input data metrics explanation, % of mtDNA reads of the total sequence reads that mapped to the whole mtDNA

[AliBasuony2022]

Dear friends,

I have got a question from a reviewers regarding % of mtDNA reads of the total sequence reads that mapped to the whole mtDNA in Novoplaty. Where I can find this information, in Novoplasty outputs, please. Is it 0.43 % (see Input data metrics below, please)

Can someone explain the "Input data metrics", please- I'm just confused?

Below is the log file.

Kind regards,
Ali

---

NOVOPlasty: The Organelle Assembler
Version 4.3.1
Author: Nicolas Dierckxsens, (c) 2015-2020

Input parameters from the configuration file: *** Verify if everything is correct ***

Project:

Project name = mito_1_375
Type = mito
Genome range = 15000-18000
K-mer = 33
Max memory = 64
Extended log = 1
Save assembled reads = yes
Seed Input = NC_008434.1_Vv_complete_mitogenome16813bp.fasta
Extend seed directly = no
Reference sequence =
Variance detection =
Chloroplast sequence =

Dataset 1:

Read Length = 151
Insert size = 350
Platform = illumina
Single/Paired = PE
Combined reads =
Forward reads = /mnt/scratch/c1845371/whole_genome/data/375_R1.fastq.gz
Reverse reads = /mnt/scratch/c1845371/whole_genome/data/375_R2.fastq.gz
Store Hash =

Heteroplasmy:

Heteroplasmy =
HP exclude list =
PCR-free =

Optional:

Insert size auto = yes
Use Quality Scores =
Output path = /mnt/scratch/c1845371/whole_genome/mitochondrial_genome/mito_12/

Subsampled fraction: 24.14 %
Forward reads without pair: 13259
Reverse reads without pair: 5025

Retrieve Seed...

Initial read retrieved successfully: TCTTACACCCGCCAGATCTTGCTGTCTATCTATAGATATCATTTCCTTGATATTTTATTTTTTACCGCCTCTATAGTTCGCACCAACAAAGCCAAAAACAAAAGTTAATGTAGCTTAATTAGTAAAGCAAGGCACTGAAAATGCCAAGATG

Start Assembly...

------------Assembly 1 finished: Contigs are automatically merged in Merged_contigs file------------

Contig 01 : 16521 bp
Contig 02 : 349 bp
Contig 03 : 992 bp
Contig 04 : 385 bp
Contig 05 : 881 bp

Total contigs : 5
Largest contig : 16521 bp
Smallest contig : 349 bp
Average insert size : 337 bp

-----------------------------------------Input data metrics-----------------------------------------

Total reads : 105400318
Aligned reads : 455762
Assembled reads : 418834
Organelle genome % : 0.43 %
Average organelle coverage : 4176

---

[ndierckx]

Hi,

Yes it is indeed 0.43%

[AliBasuony2022]

Thanks so much,

But the the number of raw reads (pairs) for both mitochondrial and nuclear together is 216,237,628 . What the number 105400318 in the Input data metrics referes to? Is it the number of mitochondrial reads?

Sorry, I'm still confused.

Best regards,
Ali

[ndierckx]

105400318 is the total reads used. You have put a max memory, so it subsampled your data and only used 105400318 reads, it doesn't call the rest when you subsample. You have a large dataset so don't need to use the complete set

[AliBasuony2022]

Good point.
Thanks so much, Nicolas.

[AliBasuony2022]

Dear Nicolas,

Just a follow up question for this issue.

How do I know the right % of mtDNA reads of the total sequence reads that mapped to the whole mtDNA? I'm doing a comparison between the performance of NOVOPlasty and other de novo assemblies and this information is so important.

When I used adifferent memmory settings (all other settings are fixed), I have got the same lenght of the largest contig, but with differnt number for assembled reads, aligned and total reads.

Does the subsampled fraction: 99.99 % when setting the Max memory= Null is right? if so, the number of total reads is over the number of reads in the raw data. I'm still confused, sorry.

max memory Null
log_mito_1_375_12_6_max memory Null.txt

max memory 100
log_mito_1_375_12_3_max memory 100.txt

memory 64
log_mito_1_375_12_max memory 64.txt

Kind regards,
Ali