BAGEL-v2-tutorial.html

<!DOCTYPE html>
<html>
<head><meta charset="utf-8" />
<title>BAGEL-v2-tutorial</title>

<script src="https://cdnjs.cloudflare.com/ajax/libs/require.js/2.1.10/require.min.js"></script>
<script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script>

<style type="text/css">
    /*!
*
* Twitter Bootstrap
*
*/
/*!
 * Bootstrap v3.3.6 (http://getbootstrap.com)
 * Copyright 2011-2015 Twitter, Inc.
 * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
 */
/*! normalize.css v3.0.3 | MIT License | github.com/necolas/normalize.css */
html {
  font-family: sans-serif;
  -ms-text-size-adjust: 100%;
  -webkit-text-size-adjust: 100%;
}
body {
  margin: 0;
}
article,
aside,
details,
figcaption,
figure,
footer,
header,
hgroup,
main,
menu,
nav,
section,
summary {
  display: block;
}
audio,
canvas,
progress,
video {
  display: inline-block;
  vertical-align: baseline;
}
audio:not([controls]) {
  display: none;
  height: 0;
}
[hidden],
template {
  display: none;
}
a {
  background-color: transparent;
}
a:active,
a:hover {
  outline: 0;
}
abbr[title] {
  border-bottom: 1px dotted;
}
b,
strong {
  font-weight: bold;
}
dfn {
  font-style: italic;
}
h1 {
  font-size: 2em;
  margin: 0.67em 0;
}
mark {
  background: #ff0;
  color: #000;
}
small {
  font-size: 80%;
}
sub,
sup {
  font-size: 75%;
  line-height: 0;
  position: relative;
  vertical-align: baseline;
}
sup {
  top: -0.5em;
}
sub {
  bottom: -0.25em;
}
img {
  border: 0;
}
svg:not(:root) {
  overflow: hidden;
}
figure {
  margin: 1em 40px;
}
hr {
  box-sizing: content-box;
  height: 0;
}
pre {
  overflow: auto;
}
code,
kbd,
pre,
samp {
  font-family: monospace, monospace;
  font-size: 1em;
}
button,
input,
optgroup,
select,
textarea {
  color: inherit;
  font: inherit;
  margin: 0;
}
button {
  overflow: visible;
}
button,
select {
  text-transform: none;
}
button,
html input[type="button"],
input[type="reset"],
input[type="submit"] {
  -webkit-appearance: button;
  cursor: pointer;
}
button[disabled],
html input[disabled] {
  cursor: default;
}
button::-moz-focus-inner,
input::-moz-focus-inner {
  border: 0;
  padding: 0;
}
input {
  line-height: normal;
}
input[type="checkbox"],
input[type="radio"] {
  box-sizing: border-box;
  padding: 0;
}
input[type="number"]::-webkit-inner-spin-button,
input[type="number"]::-webkit-outer-spin-button {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: textfield;
  box-sizing: content-box;
}
input[type="search"]::-webkit-search-cancel-button,
input[type="search"]::-webkit-search-decoration {
  -webkit-appearance: none;
}
fieldset {
  border: 1px solid #c0c0c0;
  margin: 0 2px;
  padding: 0.35em 0.625em 0.75em;
}
legend {
  border: 0;
  padding: 0;
}
textarea {
  overflow: auto;
}
optgroup {
  font-weight: bold;
}
table {
  border-collapse: collapse;
  border-spacing: 0;
}
td,
th {
  padding: 0;
}
/*! Source: https://github.com/h5bp/html5-boilerplate/blob/master/src/css/main.css */
@media print {
  *,
  *:before,
  *:after {
    background: transparent !important;
    color: #000 !important;
    box-shadow: none !important;
    text-shadow: none !important;
  }
  a,
  a:visited {
    text-decoration: underline;
  }
  a[href]:after {
    content: " (" attr(href) ")";
  }
  abbr[title]:after {
    content: " (" attr(title) ")";
  }
  a[href^="#"]:after,
  a[href^="javascript:"]:after {
    content: "";
  }
  pre,
  blockquote {
    border: 1px solid #999;
    page-break-inside: avoid;
  }
  thead {
    display: table-header-group;
  }
  tr,
  img {
    page-break-inside: avoid;
  }
  img {
    max-width: 100% !important;
  }
  p,
  h2,
  h3 {
    orphans: 3;
    widows: 3;
  }
  h2,
  h3 {
    page-break-after: avoid;
  }
  .navbar {
    display: none;
  }
  .btn > .caret,
  .dropup > .btn > .caret {
    border-top-color: #000 !important;
  }
  .label {
    border: 1px solid #000;
  }
  .table {
    border-collapse: collapse !important;
  }
  .table td,
  .table th {
    background-color: #fff !important;
  }
  .table-bordered th,
  .table-bordered td {
    border: 1px solid #ddd !important;
  }
}
@font-face {
  font-family: 'Glyphicons Halflings';
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot');
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot?#iefix') format('embedded-opentype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff2') format('woff2'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff') format('woff'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.ttf') format('truetype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular') format('svg');
}
.glyphicon {
  position: relative;
  top: 1px;
  display: inline-block;
  font-family: 'Glyphicons Halflings';
  font-style: normal;
  font-weight: normal;
  line-height: 1;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
.glyphicon-asterisk:before {
  content: "\002a";
}
.glyphicon-plus:before {
  content: "\002b";
}
.glyphicon-euro:before,
.glyphicon-eur:before {
  content: "\20ac";
}
.glyphicon-minus:before {
  content: "\2212";
}
.glyphicon-cloud:before {
  content: "\2601";
}
.glyphicon-envelope:before {
  content: "\2709";
}
.glyphicon-pencil:before {
  content: "\270f";
}
.glyphicon-glass:before {
  content: "\e001";
}
.glyphicon-music:before {
  content: "\e002";
}
.glyphicon-search:before {
  content: "\e003";
}
.glyphicon-heart:before {
  content: "\e005";
}
.glyphicon-star:before {
  content: "\e006";
}
.glyphicon-star-empty:before {
  content: "\e007";
}
.glyphicon-user:before {
  content: "\e008";
}
.glyphicon-film:before {
  content: "\e009";
}
.glyphicon-th-large:before {
  content: "\e010";
}
.glyphicon-th:before {
  content: "\e011";
}
.glyphicon-th-list:before {
  content: "\e012";
}
.glyphicon-ok:before {
  content: "\e013";
}
.glyphicon-remove:before {
  content: "\e014";
}
.glyphicon-zoom-in:before {
  content: "\e015";
}
.glyphicon-zoom-out:before {
  content: "\e016";
}
.glyphicon-off:before {
  content: "\e017";
}
.glyphicon-signal:before {
  content: "\e018";
}
.glyphicon-cog:before {
  content: "\e019";
}
.glyphicon-trash:before {
  content: "\e020";
}
.glyphicon-home:before {
  content: "\e021";
}
.glyphicon-file:before {
  content: "\e022";
}
.glyphicon-time:before {
  content: "\e023";
}
.glyphicon-road:before {
  content: "\e024";
}
.glyphicon-download-alt:before {
  content: "\e025";
}
.glyphicon-download:before {
  content: "\e026";
}
.glyphicon-upload:before {
  content: "\e027";
}
.glyphicon-inbox:before {
  content: "\e028";
}
.glyphicon-play-circle:before {
  content: "\e029";
}
.glyphicon-repeat:before {
  content: "\e030";
}
.glyphicon-refresh:before {
  content: "\e031";
}
.glyphicon-list-alt:before {
  content: "\e032";
}
.glyphicon-lock:before {
  content: "\e033";
}
.glyphicon-flag:before {
  content: "\e034";
}
.glyphicon-headphones:before {
  content: "\e035";
}
.glyphicon-volume-off:before {
  content: "\e036";
}
.glyphicon-volume-down:before {
  content: "\e037";
}
.glyphicon-volume-up:before {
  content: "\e038";
}
.glyphicon-qrcode:before {
  content: "\e039";
}
.glyphicon-barcode:before {
  content: "\e040";
}
.glyphicon-tag:before {
  content: "\e041";
}
.glyphicon-tags:before {
  content: "\e042";
}
.glyphicon-book:before {
  content: "\e043";
}
.glyphicon-bookmark:before {
  content: "\e044";
}
.glyphicon-print:before {
  content: "\e045";
}
.glyphicon-camera:before {
  content: "\e046";
}
.glyphicon-font:before {
  content: "\e047";
}
.glyphicon-bold:before {
  content: "\e048";
}
.glyphicon-italic:before {
  content: "\e049";
}
.glyphicon-text-height:before {
  content: "\e050";
}
.glyphicon-text-width:before {
  content: "\e051";
}
.glyphicon-align-left:before {
  content: "\e052";
}
.glyphicon-align-center:before {
  content: "\e053";
}
.glyphicon-align-right:before {
  content: "\e054";
}
.glyphicon-align-justify:before {
  content: "\e055";
}
.glyphicon-list:before {
  content: "\e056";
}
.glyphicon-indent-left:before {
  content: "\e057";
}
.glyphicon-indent-right:before {
  content: "\e058";
}
.glyphicon-facetime-video:before {
  content: "\e059";
}
.glyphicon-picture:before {
  content: "\e060";
}
.glyphicon-map-marker:before {
  content: "\e062";
}
.glyphicon-adjust:before {
  content: "\e063";
}
.glyphicon-tint:before {
  content: "\e064";
}
.glyphicon-edit:before {
  content: "\e065";
}
.glyphicon-share:before {
  content: "\e066";
}
.glyphicon-check:before {
  content: "\e067";
}
.glyphicon-move:before {
  content: "\e068";
}
.glyphicon-step-backward:before {
  content: "\e069";
}
.glyphicon-fast-backward:before {
  content: "\e070";
}
.glyphicon-backward:before {
  content: "\e071";
}
.glyphicon-play:before {
  content: "\e072";
}
.glyphicon-pause:before {
  content: "\e073";
}
.glyphicon-stop:before {
  content: "\e074";
}
.glyphicon-forward:before {
  content: "\e075";
}
.glyphicon-fast-forward:before {
  content: "\e076";
}
.glyphicon-step-forward:before {
  content: "\e077";
}
.glyphicon-eject:before {
  content: "\e078";
}
.glyphicon-chevron-left:before {
  content: "\e079";
}
.glyphicon-chevron-right:before {
  content: "\e080";
}
.glyphicon-plus-sign:before {
  content: "\e081";
}
.glyphicon-minus-sign:before {
  content: "\e082";
}
.glyphicon-remove-sign:before {
  content: "\e083";
}
.glyphicon-ok-sign:before {
  content: "\e084";
}
.glyphicon-question-sign:before {
  content: "\e085";
}
.glyphicon-info-sign:before {
  content: "\e086";
}
.glyphicon-screenshot:before {
  content: "\e087";
}
.glyphicon-remove-circle:before {
  content: "\e088";
}
.glyphicon-ok-circle:before {
  content: "\e089";
}
.glyphicon-ban-circle:before {
  content: "\e090";
}
.glyphicon-arrow-left:before {
  content: "\e091";
}
.glyphicon-arrow-right:before {
  content: "\e092";
}
.glyphicon-arrow-up:before {
  content: "\e093";
}
.glyphicon-arrow-down:before {
  content: "\e094";
}
.glyphicon-share-alt:before {
  content: "\e095";
}
.glyphicon-resize-full:before {
  content: "\e096";
}
.glyphicon-resize-small:before {
  content: "\e097";
}
.glyphicon-exclamation-sign:before {
  content: "\e101";
}
.glyphicon-gift:before {
  content: "\e102";
}
.glyphicon-leaf:before {
  content: "\e103";
}
.glyphicon-fire:before {
  content: "\e104";
}
.glyphicon-eye-open:before {
  content: "\e105";
}
.glyphicon-eye-close:before {
  content: "\e106";
}
.glyphicon-warning-sign:before {
  content: "\e107";
}
.glyphicon-plane:before {
  content: "\e108";
}
.glyphicon-calendar:before {
  content: "\e109";
}
.glyphicon-random:before {
  content: "\e110";
}
.glyphicon-comment:before {
  content: "\e111";
}
.glyphicon-magnet:before {
  content: "\e112";
}
.glyphicon-chevron-up:before {
  content: "\e113";
}
.glyphicon-chevron-down:before {
  content: "\e114";
}
.glyphicon-retweet:before {
  content: "\e115";
}
.glyphicon-shopping-cart:before {
  content: "\e116";
}
.glyphicon-folder-close:before {
  content: "\e117";
}
.glyphicon-folder-open:before {
  content: "\e118";
}
.glyphicon-resize-vertical:before {
  content: "\e119";
}
.glyphicon-resize-horizontal:before {
  content: "\e120";
}
.glyphicon-hdd:before {
  content: "\e121";
}
.glyphicon-bullhorn:before {
  content: "\e122";
}
.glyphicon-bell:before {
  content: "\e123";
}
.glyphicon-certificate:before {
  content: "\e124";
}
.glyphicon-thumbs-up:before {
  content: "\e125";
}
.glyphicon-thumbs-down:before {
  content: "\e126";
}
.glyphicon-hand-right:before {
  content: "\e127";
}
.glyphicon-hand-left:before {
  content: "\e128";
}
.glyphicon-hand-up:before {
  content: "\e129";
}
.glyphicon-hand-down:before {
  content: "\e130";
}
.glyphicon-circle-arrow-right:before {
  content: "\e131";
}
.glyphicon-circle-arrow-left:before {
  content: "\e132";
}
.glyphicon-circle-arrow-up:before {
  content: "\e133";
}
.glyphicon-circle-arrow-down:before {
  content: "\e134";
}
.glyphicon-globe:before {
  content: "\e135";
}
.glyphicon-wrench:before {
  content: "\e136";
}
.glyphicon-tasks:before {
  content: "\e137";
}
.glyphicon-filter:before {
  content: "\e138";
}
.glyphicon-briefcase:before {
  content: "\e139";
}
.glyphicon-fullscreen:before {
  content: "\e140";
}
.glyphicon-dashboard:before {
  content: "\e141";
}
.glyphicon-paperclip:before {
  content: "\e142";
}
.glyphicon-heart-empty:before {
  content: "\e143";
}
.glyphicon-link:before {
  content: "\e144";
}
.glyphicon-phone:before {
  content: "\e145";
}
.glyphicon-pushpin:before {
  content: "\e146";
}
.glyphicon-usd:before {
  content: "\e148";
}
.glyphicon-gbp:before {
  content: "\e149";
}
.glyphicon-sort:before {
  content: "\e150";
}
.glyphicon-sort-by-alphabet:before {
  content: "\e151";
}
.glyphicon-sort-by-alphabet-alt:before {
  content: "\e152";
}
.glyphicon-sort-by-order:before {
  content: "\e153";
}
.glyphicon-sort-by-order-alt:before {
  content: "\e154";
}
.glyphicon-sort-by-attributes:before {
  content: "\e155";
}
.glyphicon-sort-by-attributes-alt:before {
  content: "\e156";
}
.glyphicon-unchecked:before {
  content: "\e157";
}
.glyphicon-expand:before {
  content: "\e158";
}
.glyphicon-collapse-down:before {
  content: "\e159";
}
.glyphicon-collapse-up:before {
  content: "\e160";
}
.glyphicon-log-in:before {
  content: "\e161";
}
.glyphicon-flash:before {
  content: "\e162";
}
.glyphicon-log-out:before {
  content: "\e163";
}
.glyphicon-new-window:before {
  content: "\e164";
}
.glyphicon-record:before {
  content: "\e165";
}
.glyphicon-save:before {
  content: "\e166";
}
.glyphicon-open:before {
  content: "\e167";
}
.glyphicon-saved:before {
  content: "\e168";
}
.glyphicon-import:before {
  content: "\e169";
}
.glyphicon-export:before {
  content: "\e170";
}
.glyphicon-send:before {
  content: "\e171";
}
.glyphicon-floppy-disk:before {
  content: "\e172";
}
.glyphicon-floppy-saved:before {
  content: "\e173";
}
.glyphicon-floppy-remove:before {
  content: "\e174";
}
.glyphicon-floppy-save:before {
  content: "\e175";
}
.glyphicon-floppy-open:before {
  content: "\e176";
}
.glyphicon-credit-card:before {
  content: "\e177";
}
.glyphicon-transfer:before {
  content: "\e178";
}
.glyphicon-cutlery:before {
  content: "\e179";
}
.glyphicon-header:before {
  content: "\e180";
}
.glyphicon-compressed:before {
  content: "\e181";
}
.glyphicon-earphone:before {
  content: "\e182";
}
.glyphicon-phone-alt:before {
  content: "\e183";
}
.glyphicon-tower:before {
  content: "\e184";
}
.glyphicon-stats:before {
  content: "\e185";
}
.glyphicon-sd-video:before {
  content: "\e186";
}
.glyphicon-hd-video:before {
  content: "\e187";
}
.glyphicon-subtitles:before {
  content: "\e188";
}
.glyphicon-sound-stereo:before {
  content: "\e189";
}
.glyphicon-sound-dolby:before {
  content: "\e190";
}
.glyphicon-sound-5-1:before {
  content: "\e191";
}
.glyphicon-sound-6-1:before {
  content: "\e192";
}
.glyphicon-sound-7-1:before {
  content: "\e193";
}
.glyphicon-copyright-mark:before {
  content: "\e194";
}
.glyphicon-registration-mark:before {
  content: "\e195";
}
.glyphicon-cloud-download:before {
  content: "\e197";
}
.glyphicon-cloud-upload:before {
  content: "\e198";
}
.glyphicon-tree-conifer:before {
  content: "\e199";
}
.glyphicon-tree-deciduous:before {
  content: "\e200";
}
.glyphicon-cd:before {
  content: "\e201";
}
.glyphicon-save-file:before {
  content: "\e202";
}
.glyphicon-open-file:before {
  content: "\e203";
}
.glyphicon-level-up:before {
  content: "\e204";
}
.glyphicon-copy:before {
  content: "\e205";
}
.glyphicon-paste:before {
  content: "\e206";
}
.glyphicon-alert:before {
  content: "\e209";
}
.glyphicon-equalizer:before {
  content: "\e210";
}
.glyphicon-king:before {
  content: "\e211";
}
.glyphicon-queen:before {
  content: "\e212";
}
.glyphicon-pawn:before {
  content: "\e213";
}
.glyphicon-bishop:before {
  content: "\e214";
}
.glyphicon-knight:before {
  content: "\e215";
}
.glyphicon-baby-formula:before {
  content: "\e216";
}
.glyphicon-tent:before {
  content: "\26fa";
}
.glyphicon-blackboard:before {
  content: "\e218";
}
.glyphicon-bed:before {
  content: "\e219";
}
.glyphicon-apple:before {
  content: "\f8ff";
}
.glyphicon-erase:before {
  content: "\e221";
}
.glyphicon-hourglass:before {
  content: "\231b";
}
.glyphicon-lamp:before {
  content: "\e223";
}
.glyphicon-duplicate:before {
  content: "\e224";
}
.glyphicon-piggy-bank:before {
  content: "\e225";
}
.glyphicon-scissors:before {
  content: "\e226";
}
.glyphicon-bitcoin:before {
  content: "\e227";
}
.glyphicon-btc:before {
  content: "\e227";
}
.glyphicon-xbt:before {
  content: "\e227";
}
.glyphicon-yen:before {
  content: "\00a5";
}
.glyphicon-jpy:before {
  content: "\00a5";
}
.glyphicon-ruble:before {
  content: "\20bd";
}
.glyphicon-rub:before {
  content: "\20bd";
}
.glyphicon-scale:before {
  content: "\e230";
}
.glyphicon-ice-lolly:before {
  content: "\e231";
}
.glyphicon-ice-lolly-tasted:before {
  content: "\e232";
}
.glyphicon-education:before {
  content: "\e233";
}
.glyphicon-option-horizontal:before {
  content: "\e234";
}
.glyphicon-option-vertical:before {
  content: "\e235";
}
.glyphicon-menu-hamburger:before {
  content: "\e236";
}
.glyphicon-modal-window:before {
  content: "\e237";
}
.glyphicon-oil:before {
  content: "\e238";
}
.glyphicon-grain:before {
  content: "\e239";
}
.glyphicon-sunglasses:before {
  content: "\e240";
}
.glyphicon-text-size:before {
  content: "\e241";
}
.glyphicon-text-color:before {
  content: "\e242";
}
.glyphicon-text-background:before {
  content: "\e243";
}
.glyphicon-object-align-top:before {
  content: "\e244";
}
.glyphicon-object-align-bottom:before {
  content: "\e245";
}
.glyphicon-object-align-horizontal:before {
  content: "\e246";
}
.glyphicon-object-align-left:before {
  content: "\e247";
}
.glyphicon-object-align-vertical:before {
  content: "\e248";
}
.glyphicon-object-align-right:before {
  content: "\e249";
}
.glyphicon-triangle-right:before {
  content: "\e250";
}
.glyphicon-triangle-left:before {
  content: "\e251";
}
.glyphicon-triangle-bottom:before {
  content: "\e252";
}
.glyphicon-triangle-top:before {
  content: "\e253";
}
.glyphicon-console:before {
  content: "\e254";
}
.glyphicon-superscript:before {
  content: "\e255";
}
.glyphicon-subscript:before {
  content: "\e256";
}
.glyphicon-menu-left:before {
  content: "\e257";
}
.glyphicon-menu-right:before {
  content: "\e258";
}
.glyphicon-menu-down:before {
  content: "\e259";
}
.glyphicon-menu-up:before {
  content: "\e260";
}
* {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
*:before,
*:after {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
html {
  font-size: 10px;
  -webkit-tap-highlight-color: rgba(0, 0, 0, 0);
}
body {
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-size: 13px;
  line-height: 1.42857143;
  color: #000;
  background-color: #fff;
}
input,
button,
select,
textarea {
  font-family: inherit;
  font-size: inherit;
  line-height: inherit;
}
a {
  color: #337ab7;
  text-decoration: none;
}
a:hover,
a:focus {
  color: #23527c;
  text-decoration: underline;
}
a:focus {
  outline: thin dotted;
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
figure {
  margin: 0;
}
img {
  vertical-align: middle;
}
.img-responsive,
.thumbnail > img,
.thumbnail a > img,
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  display: block;
  max-width: 100%;
  height: auto;
}
.img-rounded {
  border-radius: 3px;
}
.img-thumbnail {
  padding: 4px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: all 0.2s ease-in-out;
  -o-transition: all 0.2s ease-in-out;
  transition: all 0.2s ease-in-out;
  display: inline-block;
  max-width: 100%;
  height: auto;
}
.img-circle {
  border-radius: 50%;
}
hr {
  margin-top: 18px;
  margin-bottom: 18px;
  border: 0;
  border-top: 1px solid #eeeeee;
}
.sr-only {
  position: absolute;
  width: 1px;
  height: 1px;
  margin: -1px;
  padding: 0;
  overflow: hidden;
  clip: rect(0, 0, 0, 0);
  border: 0;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
[role="button"] {
  cursor: pointer;
}
h1,
h2,
h3,
h4,
h5,
h6,
.h1,
.h2,
.h3,
.h4,
.h5,
.h6 {
  font-family: inherit;
  font-weight: 500;
  line-height: 1.1;
  color: inherit;
}
h1 small,
h2 small,
h3 small,
h4 small,
h5 small,
h6 small,
.h1 small,
.h2 small,
.h3 small,
.h4 small,
.h5 small,
.h6 small,
h1 .small,
h2 .small,
h3 .small,
h4 .small,
h5 .small,
h6 .small,
.h1 .small,
.h2 .small,
.h3 .small,
.h4 .small,
.h5 .small,
.h6 .small {
  font-weight: normal;
  line-height: 1;
  color: #777777;
}
h1,
.h1,
h2,
.h2,
h3,
.h3 {
  margin-top: 18px;
  margin-bottom: 9px;
}
h1 small,
.h1 small,
h2 small,
.h2 small,
h3 small,
.h3 small,
h1 .small,
.h1 .small,
h2 .small,
.h2 .small,
h3 .small,
.h3 .small {
  font-size: 65%;
}
h4,
.h4,
h5,
.h5,
h6,
.h6 {
  margin-top: 9px;
  margin-bottom: 9px;
}
h4 small,
.h4 small,
h5 small,
.h5 small,
h6 small,
.h6 small,
h4 .small,
.h4 .small,
h5 .small,
.h5 .small,
h6 .small,
.h6 .small {
  font-size: 75%;
}
h1,
.h1 {
  font-size: 33px;
}
h2,
.h2 {
  font-size: 27px;
}
h3,
.h3 {
  font-size: 23px;
}
h4,
.h4 {
  font-size: 17px;
}
h5,
.h5 {
  font-size: 13px;
}
h6,
.h6 {
  font-size: 12px;
}
p {
  margin: 0 0 9px;
}
.lead {
  margin-bottom: 18px;
  font-size: 14px;
  font-weight: 300;
  line-height: 1.4;
}
@media (min-width: 768px) {
  .lead {
    font-size: 19.5px;
  }
}
small,
.small {
  font-size: 92%;
}
mark,
.mark {
  background-color: #fcf8e3;
  padding: .2em;
}
.text-left {
  text-align: left;
}
.text-right {
  text-align: right;
}
.text-center {
  text-align: center;
}
.text-justify {
  text-align: justify;
}
.text-nowrap {
  white-space: nowrap;
}
.text-lowercase {
  text-transform: lowercase;
}
.text-uppercase {
  text-transform: uppercase;
}
.text-capitalize {
  text-transform: capitalize;
}
.text-muted {
  color: #777777;
}
.text-primary {
  color: #337ab7;
}
a.text-primary:hover,
a.text-primary:focus {
  color: #286090;
}
.text-success {
  color: #3c763d;
}
a.text-success:hover,
a.text-success:focus {
  color: #2b542c;
}
.text-info {
  color: #31708f;
}
a.text-info:hover,
a.text-info:focus {
  color: #245269;
}
.text-warning {
  color: #8a6d3b;
}
a.text-warning:hover,
a.text-warning:focus {
  color: #66512c;
}
.text-danger {
  color: #a94442;
}
a.text-danger:hover,
a.text-danger:focus {
  color: #843534;
}
.bg-primary {
  color: #fff;
  background-color: #337ab7;
}
a.bg-primary:hover,
a.bg-primary:focus {
  background-color: #286090;
}
.bg-success {
  background-color: #dff0d8;
}
a.bg-success:hover,
a.bg-success:focus {
  background-color: #c1e2b3;
}
.bg-info {
  background-color: #d9edf7;
}
a.bg-info:hover,
a.bg-info:focus {
  background-color: #afd9ee;
}
.bg-warning {
  background-color: #fcf8e3;
}
a.bg-warning:hover,
a.bg-warning:focus {
  background-color: #f7ecb5;
}
.bg-danger {
  background-color: #f2dede;
}
a.bg-danger:hover,
a.bg-danger:focus {
  background-color: #e4b9b9;
}
.page-header {
  padding-bottom: 8px;
  margin: 36px 0 18px;
  border-bottom: 1px solid #eeeeee;
}
ul,
ol {
  margin-top: 0;
  margin-bottom: 9px;
}
ul ul,
ol ul,
ul ol,
ol ol {
  margin-bottom: 0;
}
.list-unstyled {
  padding-left: 0;
  list-style: none;
}
.list-inline {
  padding-left: 0;
  list-style: none;
  margin-left: -5px;
}
.list-inline > li {
  display: inline-block;
  padding-left: 5px;
  padding-right: 5px;
}
dl {
  margin-top: 0;
  margin-bottom: 18px;
}
dt,
dd {
  line-height: 1.42857143;
}
dt {
  font-weight: bold;
}
dd {
  margin-left: 0;
}
@media (min-width: 541px) {
  .dl-horizontal dt {
    float: left;
    width: 160px;
    clear: left;
    text-align: right;
    overflow: hidden;
    text-overflow: ellipsis;
    white-space: nowrap;
  }
  .dl-horizontal dd {
    margin-left: 180px;
  }
}
abbr[title],
abbr[data-original-title] {
  cursor: help;
  border-bottom: 1px dotted #777777;
}
.initialism {
  font-size: 90%;
  text-transform: uppercase;
}
blockquote {
  padding: 9px 18px;
  margin: 0 0 18px;
  font-size: inherit;
  border-left: 5px solid #eeeeee;
}
blockquote p:last-child,
blockquote ul:last-child,
blockquote ol:last-child {
  margin-bottom: 0;
}
blockquote footer,
blockquote small,
blockquote .small {
  display: block;
  font-size: 80%;
  line-height: 1.42857143;
  color: #777777;
}
blockquote footer:before,
blockquote small:before,
blockquote .small:before {
  content: '\2014 \00A0';
}
.blockquote-reverse,
blockquote.pull-right {
  padding-right: 15px;
  padding-left: 0;
  border-right: 5px solid #eeeeee;
  border-left: 0;
  text-align: right;
}
.blockquote-reverse footer:before,
blockquote.pull-right footer:before,
.blockquote-reverse small:before,
blockquote.pull-right small:before,
.blockquote-reverse .small:before,
blockquote.pull-right .small:before {
  content: '';
}
.blockquote-reverse footer:after,
blockquote.pull-right footer:after,
.blockquote-reverse small:after,
blockquote.pull-right small:after,
.blockquote-reverse .small:after,
blockquote.pull-right .small:after {
  content: '\00A0 \2014';
}
address {
  margin-bottom: 18px;
  font-style: normal;
  line-height: 1.42857143;
}
code,
kbd,
pre,
samp {
  font-family: monospace;
}
code {
  padding: 2px 4px;
  font-size: 90%;
  color: #c7254e;
  background-color: #f9f2f4;
  border-radius: 2px;
}
kbd {
  padding: 2px 4px;
  font-size: 90%;
  color: #888;
  background-color: transparent;
  border-radius: 1px;
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.25);
}
kbd kbd {
  padding: 0;
  font-size: 100%;
  font-weight: bold;
  box-shadow: none;
}
pre {
  display: block;
  padding: 8.5px;
  margin: 0 0 9px;
  font-size: 12px;
  line-height: 1.42857143;
  word-break: break-all;
  word-wrap: break-word;
  color: #333333;
  background-color: #f5f5f5;
  border: 1px solid #ccc;
  border-radius: 2px;
}
pre code {
  padding: 0;
  font-size: inherit;
  color: inherit;
  white-space: pre-wrap;
  background-color: transparent;
  border-radius: 0;
}
.pre-scrollable {
  max-height: 340px;
  overflow-y: scroll;
}
.container {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
@media (min-width: 768px) {
  .container {
    width: 768px;
  }
}
@media (min-width: 992px) {
  .container {
    width: 940px;
  }
}
@media (min-width: 1200px) {
  .container {
    width: 1140px;
  }
}
.container-fluid {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
.row {
  margin-left: 0px;
  margin-right: 0px;
}
.col-xs-1, .col-sm-1, .col-md-1, .col-lg-1, .col-xs-2, .col-sm-2, .col-md-2, .col-lg-2, .col-xs-3, .col-sm-3, .col-md-3, .col-lg-3, .col-xs-4, .col-sm-4, .col-md-4, .col-lg-4, .col-xs-5, .col-sm-5, .col-md-5, .col-lg-5, .col-xs-6, .col-sm-6, .col-md-6, .col-lg-6, .col-xs-7, .col-sm-7, .col-md-7, .col-lg-7, .col-xs-8, .col-sm-8, .col-md-8, .col-lg-8, .col-xs-9, .col-sm-9, .col-md-9, .col-lg-9, .col-xs-10, .col-sm-10, .col-md-10, .col-lg-10, .col-xs-11, .col-sm-11, .col-md-11, .col-lg-11, .col-xs-12, .col-sm-12, .col-md-12, .col-lg-12 {
  position: relative;
  min-height: 1px;
  padding-left: 0px;
  padding-right: 0px;
}
.col-xs-1, .col-xs-2, .col-xs-3, .col-xs-4, .col-xs-5, .col-xs-6, .col-xs-7, .col-xs-8, .col-xs-9, .col-xs-10, .col-xs-11, .col-xs-12 {
  float: left;
}
.col-xs-12 {
  width: 100%;
}
.col-xs-11 {
  width: 91.66666667%;
}
.col-xs-10 {
  width: 83.33333333%;
}
.col-xs-9 {
  width: 75%;
}
.col-xs-8 {
  width: 66.66666667%;
}
.col-xs-7 {
  width: 58.33333333%;
}
.col-xs-6 {
  width: 50%;
}
.col-xs-5 {
  width: 41.66666667%;
}
.col-xs-4 {
  width: 33.33333333%;
}
.col-xs-3 {
  width: 25%;
}
.col-xs-2 {
  width: 16.66666667%;
}
.col-xs-1 {
  width: 8.33333333%;
}
.col-xs-pull-12 {
  right: 100%;
}
.col-xs-pull-11 {
  right: 91.66666667%;
}
.col-xs-pull-10 {
  right: 83.33333333%;
}
.col-xs-pull-9 {
  right: 75%;
}
.col-xs-pull-8 {
  right: 66.66666667%;
}
.col-xs-pull-7 {
  right: 58.33333333%;
}
.col-xs-pull-6 {
  right: 50%;
}
.col-xs-pull-5 {
  right: 41.66666667%;
}
.col-xs-pull-4 {
  right: 33.33333333%;
}
.col-xs-pull-3 {
  right: 25%;
}
.col-xs-pull-2 {
  right: 16.66666667%;
}
.col-xs-pull-1 {
  right: 8.33333333%;
}
.col-xs-pull-0 {
  right: auto;
}
.col-xs-push-12 {
  left: 100%;
}
.col-xs-push-11 {
  left: 91.66666667%;
}
.col-xs-push-10 {
  left: 83.33333333%;
}
.col-xs-push-9 {
  left: 75%;
}
.col-xs-push-8 {
  left: 66.66666667%;
}
.col-xs-push-7 {
  left: 58.33333333%;
}
.col-xs-push-6 {
  left: 50%;
}
.col-xs-push-5 {
  left: 41.66666667%;
}
.col-xs-push-4 {
  left: 33.33333333%;
}
.col-xs-push-3 {
  left: 25%;
}
.col-xs-push-2 {
  left: 16.66666667%;
}
.col-xs-push-1 {
  left: 8.33333333%;
}
.col-xs-push-0 {
  left: auto;
}
.col-xs-offset-12 {
  margin-left: 100%;
}
.col-xs-offset-11 {
  margin-left: 91.66666667%;
}
.col-xs-offset-10 {
  margin-left: 83.33333333%;
}
.col-xs-offset-9 {
  margin-left: 75%;
}
.col-xs-offset-8 {
  margin-left: 66.66666667%;
}
.col-xs-offset-7 {
  margin-left: 58.33333333%;
}
.col-xs-offset-6 {
  margin-left: 50%;
}
.col-xs-offset-5 {
  margin-left: 41.66666667%;
}
.col-xs-offset-4 {
  margin-left: 33.33333333%;
}
.col-xs-offset-3 {
  margin-left: 25%;
}
.col-xs-offset-2 {
  margin-left: 16.66666667%;
}
.col-xs-offset-1 {
  margin-left: 8.33333333%;
}
.col-xs-offset-0 {
  margin-left: 0%;
}
@media (min-width: 768px) {
  .col-sm-1, .col-sm-2, .col-sm-3, .col-sm-4, .col-sm-5, .col-sm-6, .col-sm-7, .col-sm-8, .col-sm-9, .col-sm-10, .col-sm-11, .col-sm-12 {
    float: left;
  }
  .col-sm-12 {
    width: 100%;
  }
  .col-sm-11 {
    width: 91.66666667%;
  }
  .col-sm-10 {
    width: 83.33333333%;
  }
  .col-sm-9 {
    width: 75%;
  }
  .col-sm-8 {
    width: 66.66666667%;
  }
  .col-sm-7 {
    width: 58.33333333%;
  }
  .col-sm-6 {
    width: 50%;
  }
  .col-sm-5 {
    width: 41.66666667%;
  }
  .col-sm-4 {
    width: 33.33333333%;
  }
  .col-sm-3 {
    width: 25%;
  }
  .col-sm-2 {
    width: 16.66666667%;
  }
  .col-sm-1 {
    width: 8.33333333%;
  }
  .col-sm-pull-12 {
    right: 100%;
  }
  .col-sm-pull-11 {
    right: 91.66666667%;
  }
  .col-sm-pull-10 {
    right: 83.33333333%;
  }
  .col-sm-pull-9 {
    right: 75%;
  }
  .col-sm-pull-8 {
    right: 66.66666667%;
  }
  .col-sm-pull-7 {
    right: 58.33333333%;
  }
  .col-sm-pull-6 {
    right: 50%;
  }
  .col-sm-pull-5 {
    right: 41.66666667%;
  }
  .col-sm-pull-4 {
    right: 33.33333333%;
  }
  .col-sm-pull-3 {
    right: 25%;
  }
  .col-sm-pull-2 {
    right: 16.66666667%;
  }
  .col-sm-pull-1 {
    right: 8.33333333%;
  }
  .col-sm-pull-0 {
    right: auto;
  }
  .col-sm-push-12 {
    left: 100%;
  }
  .col-sm-push-11 {
    left: 91.66666667%;
  }
  .col-sm-push-10 {
    left: 83.33333333%;
  }
  .col-sm-push-9 {
    left: 75%;
  }
  .col-sm-push-8 {
    left: 66.66666667%;
  }
  .col-sm-push-7 {
    left: 58.33333333%;
  }
  .col-sm-push-6 {
    left: 50%;
  }
  .col-sm-push-5 {
    left: 41.66666667%;
  }
  .col-sm-push-4 {
    left: 33.33333333%;
  }
  .col-sm-push-3 {
    left: 25%;
  }
  .col-sm-push-2 {
    left: 16.66666667%;
  }
  .col-sm-push-1 {
    left: 8.33333333%;
  }
  .col-sm-push-0 {
    left: auto;
  }
  .col-sm-offset-12 {
    margin-left: 100%;
  }
  .col-sm-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-sm-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-sm-offset-9 {
    margin-left: 75%;
  }
  .col-sm-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-sm-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-sm-offset-6 {
    margin-left: 50%;
  }
  .col-sm-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-sm-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-sm-offset-3 {
    margin-left: 25%;
  }
  .col-sm-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-sm-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-sm-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 992px) {
  .col-md-1, .col-md-2, .col-md-3, .col-md-4, .col-md-5, .col-md-6, .col-md-7, .col-md-8, .col-md-9, .col-md-10, .col-md-11, .col-md-12 {
    float: left;
  }
  .col-md-12 {
    width: 100%;
  }
  .col-md-11 {
    width: 91.66666667%;
  }
  .col-md-10 {
    width: 83.33333333%;
  }
  .col-md-9 {
    width: 75%;
  }
  .col-md-8 {
    width: 66.66666667%;
  }
  .col-md-7 {
    width: 58.33333333%;
  }
  .col-md-6 {
    width: 50%;
  }
  .col-md-5 {
    width: 41.66666667%;
  }
  .col-md-4 {
    width: 33.33333333%;
  }
  .col-md-3 {
    width: 25%;
  }
  .col-md-2 {
    width: 16.66666667%;
  }
  .col-md-1 {
    width: 8.33333333%;
  }
  .col-md-pull-12 {
    right: 100%;
  }
  .col-md-pull-11 {
    right: 91.66666667%;
  }
  .col-md-pull-10 {
    right: 83.33333333%;
  }
  .col-md-pull-9 {
    right: 75%;
  }
  .col-md-pull-8 {
    right: 66.66666667%;
  }
  .col-md-pull-7 {
    right: 58.33333333%;
  }
  .col-md-pull-6 {
    right: 50%;
  }
  .col-md-pull-5 {
    right: 41.66666667%;
  }
  .col-md-pull-4 {
    right: 33.33333333%;
  }
  .col-md-pull-3 {
    right: 25%;
  }
  .col-md-pull-2 {
    right: 16.66666667%;
  }
  .col-md-pull-1 {
    right: 8.33333333%;
  }
  .col-md-pull-0 {
    right: auto;
  }
  .col-md-push-12 {
    left: 100%;
  }
  .col-md-push-11 {
    left: 91.66666667%;
  }
  .col-md-push-10 {
    left: 83.33333333%;
  }
  .col-md-push-9 {
    left: 75%;
  }
  .col-md-push-8 {
    left: 66.66666667%;
  }
  .col-md-push-7 {
    left: 58.33333333%;
  }
  .col-md-push-6 {
    left: 50%;
  }
  .col-md-push-5 {
    left: 41.66666667%;
  }
  .col-md-push-4 {
    left: 33.33333333%;
  }
  .col-md-push-3 {
    left: 25%;
  }
  .col-md-push-2 {
    left: 16.66666667%;
  }
  .col-md-push-1 {
    left: 8.33333333%;
  }
  .col-md-push-0 {
    left: auto;
  }
  .col-md-offset-12 {
    margin-left: 100%;
  }
  .col-md-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-md-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-md-offset-9 {
    margin-left: 75%;
  }
  .col-md-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-md-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-md-offset-6 {
    margin-left: 50%;
  }
  .col-md-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-md-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-md-offset-3 {
    margin-left: 25%;
  }
  .col-md-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-md-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-md-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 1200px) {
  .col-lg-1, .col-lg-2, .col-lg-3, .col-lg-4, .col-lg-5, .col-lg-6, .col-lg-7, .col-lg-8, .col-lg-9, .col-lg-10, .col-lg-11, .col-lg-12 {
    float: left;
  }
  .col-lg-12 {
    width: 100%;
  }
  .col-lg-11 {
    width: 91.66666667%;
  }
  .col-lg-10 {
    width: 83.33333333%;
  }
  .col-lg-9 {
    width: 75%;
  }
  .col-lg-8 {
    width: 66.66666667%;
  }
  .col-lg-7 {
    width: 58.33333333%;
  }
  .col-lg-6 {
    width: 50%;
  }
  .col-lg-5 {
    width: 41.66666667%;
  }
  .col-lg-4 {
    width: 33.33333333%;
  }
  .col-lg-3 {
    width: 25%;
  }
  .col-lg-2 {
    width: 16.66666667%;
  }
  .col-lg-1 {
    width: 8.33333333%;
  }
  .col-lg-pull-12 {
    right: 100%;
  }
  .col-lg-pull-11 {
    right: 91.66666667%;
  }
  .col-lg-pull-10 {
    right: 83.33333333%;
  }
  .col-lg-pull-9 {
    right: 75%;
  }
  .col-lg-pull-8 {
    right: 66.66666667%;
  }
  .col-lg-pull-7 {
    right: 58.33333333%;
  }
  .col-lg-pull-6 {
    right: 50%;
  }
  .col-lg-pull-5 {
    right: 41.66666667%;
  }
  .col-lg-pull-4 {
    right: 33.33333333%;
  }
  .col-lg-pull-3 {
    right: 25%;
  }
  .col-lg-pull-2 {
    right: 16.66666667%;
  }
  .col-lg-pull-1 {
    right: 8.33333333%;
  }
  .col-lg-pull-0 {
    right: auto;
  }
  .col-lg-push-12 {
    left: 100%;
  }
  .col-lg-push-11 {
    left: 91.66666667%;
  }
  .col-lg-push-10 {
    left: 83.33333333%;
  }
  .col-lg-push-9 {
    left: 75%;
  }
  .col-lg-push-8 {
    left: 66.66666667%;
  }
  .col-lg-push-7 {
    left: 58.33333333%;
  }
  .col-lg-push-6 {
    left: 50%;
  }
  .col-lg-push-5 {
    left: 41.66666667%;
  }
  .col-lg-push-4 {
    left: 33.33333333%;
  }
  .col-lg-push-3 {
    left: 25%;
  }
  .col-lg-push-2 {
    left: 16.66666667%;
  }
  .col-lg-push-1 {
    left: 8.33333333%;
  }
  .col-lg-push-0 {
    left: auto;
  }
  .col-lg-offset-12 {
    margin-left: 100%;
  }
  .col-lg-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-lg-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-lg-offset-9 {
    margin-left: 75%;
  }
  .col-lg-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-lg-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-lg-offset-6 {
    margin-left: 50%;
  }
  .col-lg-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-lg-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-lg-offset-3 {
    margin-left: 25%;
  }
  .col-lg-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-lg-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-lg-offset-0 {
    margin-left: 0%;
  }
}
table {
  background-color: transparent;
}
caption {
  padding-top: 8px;
  padding-bottom: 8px;
  color: #777777;
  text-align: left;
}
th {
  text-align: left;
}
.table {
  width: 100%;
  max-width: 100%;
  margin-bottom: 18px;
}
.table > thead > tr > th,
.table > tbody > tr > th,
.table > tfoot > tr > th,
.table > thead > tr > td,
.table > tbody > tr > td,
.table > tfoot > tr > td {
  padding: 8px;
  line-height: 1.42857143;
  vertical-align: top;
  border-top: 1px solid #ddd;
}
.table > thead > tr > th {
  vertical-align: bottom;
  border-bottom: 2px solid #ddd;
}
.table > caption + thead > tr:first-child > th,
.table > colgroup + thead > tr:first-child > th,
.table > thead:first-child > tr:first-child > th,
.table > caption + thead > tr:first-child > td,
.table > colgroup + thead > tr:first-child > td,
.table > thead:first-child > tr:first-child > td {
  border-top: 0;
}
.table > tbody + tbody {
  border-top: 2px solid #ddd;
}
.table .table {
  background-color: #fff;
}
.table-condensed > thead > tr > th,
.table-condensed > tbody > tr > th,
.table-condensed > tfoot > tr > th,
.table-condensed > thead > tr > td,
.table-condensed > tbody > tr > td,
.table-condensed > tfoot > tr > td {
  padding: 5px;
}
.table-bordered {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > tbody > tr > th,
.table-bordered > tfoot > tr > th,
.table-bordered > thead > tr > td,
.table-bordered > tbody > tr > td,
.table-bordered > tfoot > tr > td {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > thead > tr > td {
  border-bottom-width: 2px;
}
.table-striped > tbody > tr:nth-of-type(odd) {
  background-color: #f9f9f9;
}
.table-hover > tbody > tr:hover {
  background-color: #f5f5f5;
}
table col[class*="col-"] {
  position: static;
  float: none;
  display: table-column;
}
table td[class*="col-"],
table th[class*="col-"] {
  position: static;
  float: none;
  display: table-cell;
}
.table > thead > tr > td.active,
.table > tbody > tr > td.active,
.table > tfoot > tr > td.active,
.table > thead > tr > th.active,
.table > tbody > tr > th.active,
.table > tfoot > tr > th.active,
.table > thead > tr.active > td,
.table > tbody > tr.active > td,
.table > tfoot > tr.active > td,
.table > thead > tr.active > th,
.table > tbody > tr.active > th,
.table > tfoot > tr.active > th {
  background-color: #f5f5f5;
}
.table-hover > tbody > tr > td.active:hover,
.table-hover > tbody > tr > th.active:hover,
.table-hover > tbody > tr.active:hover > td,
.table-hover > tbody > tr:hover > .active,
.table-hover > tbody > tr.active:hover > th {
  background-color: #e8e8e8;
}
.table > thead > tr > td.success,
.table > tbody > tr > td.success,
.table > tfoot > tr > td.success,
.table > thead > tr > th.success,
.table > tbody > tr > th.success,
.table > tfoot > tr > th.success,
.table > thead > tr.success > td,
.table > tbody > tr.success > td,
.table > tfoot > tr.success > td,
.table > thead > tr.success > th,
.table > tbody > tr.success > th,
.table > tfoot > tr.success > th {
  background-color: #dff0d8;
}
.table-hover > tbody > tr > td.success:hover,
.table-hover > tbody > tr > th.success:hover,
.table-hover > tbody > tr.success:hover > td,
.table-hover > tbody > tr:hover > .success,
.table-hover > tbody > tr.success:hover > th {
  background-color: #d0e9c6;
}
.table > thead > tr > td.info,
.table > tbody > tr > td.info,
.table > tfoot > tr > td.info,
.table > thead > tr > th.info,
.table > tbody > tr > th.info,
.table > tfoot > tr > th.info,
.table > thead > tr.info > td,
.table > tbody > tr.info > td,
.table > tfoot > tr.info > td,
.table > thead > tr.info > th,
.table > tbody > tr.info > th,
.table > tfoot > tr.info > th {
  background-color: #d9edf7;
}
.table-hover > tbody > tr > td.info:hover,
.table-hover > tbody > tr > th.info:hover,
.table-hover > tbody > tr.info:hover > td,
.table-hover > tbody > tr:hover > .info,
.table-hover > tbody > tr.info:hover > th {
  background-color: #c4e3f3;
}
.table > thead > tr > td.warning,
.table > tbody > tr > td.warning,
.table > tfoot > tr > td.warning,
.table > thead > tr > th.warning,
.table > tbody > tr > th.warning,
.table > tfoot > tr > th.warning,
.table > thead > tr.warning > td,
.table > tbody > tr.warning > td,
.table > tfoot > tr.warning > td,
.table > thead > tr.warning > th,
.table > tbody > tr.warning > th,
.table > tfoot > tr.warning > th {
  background-color: #fcf8e3;
}
.table-hover > tbody > tr > td.warning:hover,
.table-hover > tbody > tr > th.warning:hover,
.table-hover > tbody > tr.warning:hover > td,
.table-hover > tbody > tr:hover > .warning,
.table-hover > tbody > tr.warning:hover > th {
  background-color: #faf2cc;
}
.table > thead > tr > td.danger,
.table > tbody > tr > td.danger,
.table > tfoot > tr > td.danger,
.table > thead > tr > th.danger,
.table > tbody > tr > th.danger,
.table > tfoot > tr > th.danger,
.table > thead > tr.danger > td,
.table > tbody > tr.danger > td,
.table > tfoot > tr.danger > td,
.table > thead > tr.danger > th,
.table > tbody > tr.danger > th,
.table > tfoot > tr.danger > th {
  background-color: #f2dede;
}
.table-hover > tbody > tr > td.danger:hover,
.table-hover > tbody > tr > th.danger:hover,
.table-hover > tbody > tr.danger:hover > td,
.table-hover > tbody > tr:hover > .danger,
.table-hover > tbody > tr.danger:hover > th {
  background-color: #ebcccc;
}
.table-responsive {
  overflow-x: auto;
  min-height: 0.01%;
}
@media screen and (max-width: 767px) {
  .table-responsive {
    width: 100%;
    margin-bottom: 13.5px;
    overflow-y: hidden;
    -ms-overflow-style: -ms-autohiding-scrollbar;
    border: 1px solid #ddd;
  }
  .table-responsive > .table {
    margin-bottom: 0;
  }
  .table-responsive > .table > thead > tr > th,
  .table-responsive > .table > tbody > tr > th,
  .table-responsive > .table > tfoot > tr > th,
  .table-responsive > .table > thead > tr > td,
  .table-responsive > .table > tbody > tr > td,
  .table-responsive > .table > tfoot > tr > td {
    white-space: nowrap;
  }
  .table-responsive > .table-bordered {
    border: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:first-child,
  .table-responsive > .table-bordered > tbody > tr > th:first-child,
  .table-responsive > .table-bordered > tfoot > tr > th:first-child,
  .table-responsive > .table-bordered > thead > tr > td:first-child,
  .table-responsive > .table-bordered > tbody > tr > td:first-child,
  .table-responsive > .table-bordered > tfoot > tr > td:first-child {
    border-left: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:last-child,
  .table-responsive > .table-bordered > tbody > tr > th:last-child,
  .table-responsive > .table-bordered > tfoot > tr > th:last-child,
  .table-responsive > .table-bordered > thead > tr > td:last-child,
  .table-responsive > .table-bordered > tbody > tr > td:last-child,
  .table-responsive > .table-bordered > tfoot > tr > td:last-child {
    border-right: 0;
  }
  .table-responsive > .table-bordered > tbody > tr:last-child > th,
  .table-responsive > .table-bordered > tfoot > tr:last-child > th,
  .table-responsive > .table-bordered > tbody > tr:last-child > td,
  .table-responsive > .table-bordered > tfoot > tr:last-child > td {
    border-bottom: 0;
  }
}
fieldset {
  padding: 0;
  margin: 0;
  border: 0;
  min-width: 0;
}
legend {
  display: block;
  width: 100%;
  padding: 0;
  margin-bottom: 18px;
  font-size: 19.5px;
  line-height: inherit;
  color: #333333;
  border: 0;
  border-bottom: 1px solid #e5e5e5;
}
label {
  display: inline-block;
  max-width: 100%;
  margin-bottom: 5px;
  font-weight: bold;
}
input[type="search"] {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
input[type="radio"],
input[type="checkbox"] {
  margin: 4px 0 0;
  margin-top: 1px \9;
  line-height: normal;
}
input[type="file"] {
  display: block;
}
input[type="range"] {
  display: block;
  width: 100%;
}
select[multiple],
select[size] {
  height: auto;
}
input[type="file"]:focus,
input[type="radio"]:focus,
input[type="checkbox"]:focus {
  outline: thin dotted;
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
output {
  display: block;
  padding-top: 7px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
}
.form-control {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
}
.form-control:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.form-control::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.form-control:-ms-input-placeholder {
  color: #999;
}
.form-control::-webkit-input-placeholder {
  color: #999;
}
.form-control::-ms-expand {
  border: 0;
  background-color: transparent;
}
.form-control[disabled],
.form-control[readonly],
fieldset[disabled] .form-control {
  background-color: #eeeeee;
  opacity: 1;
}
.form-control[disabled],
fieldset[disabled] .form-control {
  cursor: not-allowed;
}
textarea.form-control {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: none;
}
@media screen and (-webkit-min-device-pixel-ratio: 0) {
  input[type="date"].form-control,
  input[type="time"].form-control,
  input[type="datetime-local"].form-control,
  input[type="month"].form-control {
    line-height: 32px;
  }
  input[type="date"].input-sm,
  input[type="time"].input-sm,
  input[type="datetime-local"].input-sm,
  input[type="month"].input-sm,
  .input-group-sm input[type="date"],
  .input-group-sm input[type="time"],
  .input-group-sm input[type="datetime-local"],
  .input-group-sm input[type="month"] {
    line-height: 30px;
  }
  input[type="date"].input-lg,
  input[type="time"].input-lg,
  input[type="datetime-local"].input-lg,
  input[type="month"].input-lg,
  .input-group-lg input[type="date"],
  .input-group-lg input[type="time"],
  .input-group-lg input[type="datetime-local"],
  .input-group-lg input[type="month"] {
    line-height: 45px;
  }
}
.form-group {
  margin-bottom: 15px;
}
.radio,
.checkbox {
  position: relative;
  display: block;
  margin-top: 10px;
  margin-bottom: 10px;
}
.radio label,
.checkbox label {
  min-height: 18px;
  padding-left: 20px;
  margin-bottom: 0;
  font-weight: normal;
  cursor: pointer;
}
.radio input[type="radio"],
.radio-inline input[type="radio"],
.checkbox input[type="checkbox"],
.checkbox-inline input[type="checkbox"] {
  position: absolute;
  margin-left: -20px;
  margin-top: 4px \9;
}
.radio + .radio,
.checkbox + .checkbox {
  margin-top: -5px;
}
.radio-inline,
.checkbox-inline {
  position: relative;
  display: inline-block;
  padding-left: 20px;
  margin-bottom: 0;
  vertical-align: middle;
  font-weight: normal;
  cursor: pointer;
}
.radio-inline + .radio-inline,
.checkbox-inline + .checkbox-inline {
  margin-top: 0;
  margin-left: 10px;
}
input[type="radio"][disabled],
input[type="checkbox"][disabled],
input[type="radio"].disabled,
input[type="checkbox"].disabled,
fieldset[disabled] input[type="radio"],
fieldset[disabled] input[type="checkbox"] {
  cursor: not-allowed;
}
.radio-inline.disabled,
.checkbox-inline.disabled,
fieldset[disabled] .radio-inline,
fieldset[disabled] .checkbox-inline {
  cursor: not-allowed;
}
.radio.disabled label,
.checkbox.disabled label,
fieldset[disabled] .radio label,
fieldset[disabled] .checkbox label {
  cursor: not-allowed;
}
.form-control-static {
  padding-top: 7px;
  padding-bottom: 7px;
  margin-bottom: 0;
  min-height: 31px;
}
.form-control-static.input-lg,
.form-control-static.input-sm {
  padding-left: 0;
  padding-right: 0;
}
.input-sm {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-sm {
  height: 30px;
  line-height: 30px;
}
textarea.input-sm,
select[multiple].input-sm {
  height: auto;
}
.form-group-sm .form-control {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.form-group-sm select.form-control {
  height: 30px;
  line-height: 30px;
}
.form-group-sm textarea.form-control,
.form-group-sm select[multiple].form-control {
  height: auto;
}
.form-group-sm .form-control-static {
  height: 30px;
  min-height: 30px;
  padding: 6px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.input-lg {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-lg {
  height: 45px;
  line-height: 45px;
}
textarea.input-lg,
select[multiple].input-lg {
  height: auto;
}
.form-group-lg .form-control {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.form-group-lg select.form-control {
  height: 45px;
  line-height: 45px;
}
.form-group-lg textarea.form-control,
.form-group-lg select[multiple].form-control {
  height: auto;
}
.form-group-lg .form-control-static {
  height: 45px;
  min-height: 35px;
  padding: 11px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.has-feedback {
  position: relative;
}
.has-feedback .form-control {
  padding-right: 40px;
}
.form-control-feedback {
  position: absolute;
  top: 0;
  right: 0;
  z-index: 2;
  display: block;
  width: 32px;
  height: 32px;
  line-height: 32px;
  text-align: center;
  pointer-events: none;
}
.input-lg + .form-control-feedback,
.input-group-lg + .form-control-feedback,
.form-group-lg .form-control + .form-control-feedback {
  width: 45px;
  height: 45px;
  line-height: 45px;
}
.input-sm + .form-control-feedback,
.input-group-sm + .form-control-feedback,
.form-group-sm .form-control + .form-control-feedback {
  width: 30px;
  height: 30px;
  line-height: 30px;
}
.has-success .help-block,
.has-success .control-label,
.has-success .radio,
.has-success .checkbox,
.has-success .radio-inline,
.has-success .checkbox-inline,
.has-success.radio label,
.has-success.checkbox label,
.has-success.radio-inline label,
.has-success.checkbox-inline label {
  color: #3c763d;
}
.has-success .form-control {
  border-color: #3c763d;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-success .form-control:focus {
  border-color: #2b542c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
}
.has-success .input-group-addon {
  color: #3c763d;
  border-color: #3c763d;
  background-color: #dff0d8;
}
.has-success .form-control-feedback {
  color: #3c763d;
}
.has-warning .help-block,
.has-warning .control-label,
.has-warning .radio,
.has-warning .checkbox,
.has-warning .radio-inline,
.has-warning .checkbox-inline,
.has-warning.radio label,
.has-warning.checkbox label,
.has-warning.radio-inline label,
.has-warning.checkbox-inline label {
  color: #8a6d3b;
}
.has-warning .form-control {
  border-color: #8a6d3b;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-warning .form-control:focus {
  border-color: #66512c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
}
.has-warning .input-group-addon {
  color: #8a6d3b;
  border-color: #8a6d3b;
  background-color: #fcf8e3;
}
.has-warning .form-control-feedback {
  color: #8a6d3b;
}
.has-error .help-block,
.has-error .control-label,
.has-error .radio,
.has-error .checkbox,
.has-error .radio-inline,
.has-error .checkbox-inline,
.has-error.radio label,
.has-error.checkbox label,
.has-error.radio-inline label,
.has-error.checkbox-inline label {
  color: #a94442;
}
.has-error .form-control {
  border-color: #a94442;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-error .form-control:focus {
  border-color: #843534;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
}
.has-error .input-group-addon {
  color: #a94442;
  border-color: #a94442;
  background-color: #f2dede;
}
.has-error .form-control-feedback {
  color: #a94442;
}
.has-feedback label ~ .form-control-feedback {
  top: 23px;
}
.has-feedback label.sr-only ~ .form-control-feedback {
  top: 0;
}
.help-block {
  display: block;
  margin-top: 5px;
  margin-bottom: 10px;
  color: #404040;
}
@media (min-width: 768px) {
  .form-inline .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .form-inline .form-control-static {
    display: inline-block;
  }
  .form-inline .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .form-inline .input-group .input-group-addon,
  .form-inline .input-group .input-group-btn,
  .form-inline .input-group .form-control {
    width: auto;
  }
  .form-inline .input-group > .form-control {
    width: 100%;
  }
  .form-inline .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio,
  .form-inline .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio label,
  .form-inline .checkbox label {
    padding-left: 0;
  }
  .form-inline .radio input[type="radio"],
  .form-inline .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .form-inline .has-feedback .form-control-feedback {
    top: 0;
  }
}
.form-horizontal .radio,
.form-horizontal .checkbox,
.form-horizontal .radio-inline,
.form-horizontal .checkbox-inline {
  margin-top: 0;
  margin-bottom: 0;
  padding-top: 7px;
}
.form-horizontal .radio,
.form-horizontal .checkbox {
  min-height: 25px;
}
.form-horizontal .form-group {
  margin-left: 0px;
  margin-right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .control-label {
    text-align: right;
    margin-bottom: 0;
    padding-top: 7px;
  }
}
.form-horizontal .has-feedback .form-control-feedback {
  right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .form-group-lg .control-label {
    padding-top: 11px;
    font-size: 17px;
  }
}
@media (min-width: 768px) {
  .form-horizontal .form-group-sm .control-label {
    padding-top: 6px;
    font-size: 12px;
  }
}
.btn {
  display: inline-block;
  margin-bottom: 0;
  font-weight: normal;
  text-align: center;
  vertical-align: middle;
  touch-action: manipulation;
  cursor: pointer;
  background-image: none;
  border: 1px solid transparent;
  white-space: nowrap;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  border-radius: 2px;
  -webkit-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
}
.btn:focus,
.btn:active:focus,
.btn.active:focus,
.btn.focus,
.btn:active.focus,
.btn.active.focus {
  outline: thin dotted;
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
.btn:hover,
.btn:focus,
.btn.focus {
  color: #333;
  text-decoration: none;
}
.btn:active,
.btn.active {
  outline: 0;
  background-image: none;
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn.disabled,
.btn[disabled],
fieldset[disabled] .btn {
  cursor: not-allowed;
  opacity: 0.65;
  filter: alpha(opacity=65);
  -webkit-box-shadow: none;
  box-shadow: none;
}
a.btn.disabled,
fieldset[disabled] a.btn {
  pointer-events: none;
}
.btn-default {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.btn-default:focus,
.btn-default.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.btn-default:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active:hover,
.btn-default.active:hover,
.open > .dropdown-toggle.btn-default:hover,
.btn-default:active:focus,
.btn-default.active:focus,
.open > .dropdown-toggle.btn-default:focus,
.btn-default:active.focus,
.btn-default.active.focus,
.open > .dropdown-toggle.btn-default.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  background-image: none;
}
.btn-default.disabled:hover,
.btn-default[disabled]:hover,
fieldset[disabled] .btn-default:hover,
.btn-default.disabled:focus,
.btn-default[disabled]:focus,
fieldset[disabled] .btn-default:focus,
.btn-default.disabled.focus,
.btn-default[disabled].focus,
fieldset[disabled] .btn-default.focus {
  background-color: #fff;
  border-color: #ccc;
}
.btn-default .badge {
  color: #fff;
  background-color: #333;
}
.btn-primary {
  color: #fff;
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary:focus,
.btn-primary.focus {
  color: #fff;
  background-color: #286090;
  border-color: #122b40;
}
.btn-primary:hover {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active:hover,
.btn-primary.active:hover,
.open > .dropdown-toggle.btn-primary:hover,
.btn-primary:active:focus,
.btn-primary.active:focus,
.open > .dropdown-toggle.btn-primary:focus,
.btn-primary:active.focus,
.btn-primary.active.focus,
.open > .dropdown-toggle.btn-primary.focus {
  color: #fff;
  background-color: #204d74;
  border-color: #122b40;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  background-image: none;
}
.btn-primary.disabled:hover,
.btn-primary[disabled]:hover,
fieldset[disabled] .btn-primary:hover,
.btn-primary.disabled:focus,
.btn-primary[disabled]:focus,
fieldset[disabled] .btn-primary:focus,
.btn-primary.disabled.focus,
.btn-primary[disabled].focus,
fieldset[disabled] .btn-primary.focus {
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary .badge {
  color: #337ab7;
  background-color: #fff;
}
.btn-success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success:focus,
.btn-success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.btn-success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active:hover,
.btn-success.active:hover,
.open > .dropdown-toggle.btn-success:hover,
.btn-success:active:focus,
.btn-success.active:focus,
.open > .dropdown-toggle.btn-success:focus,
.btn-success:active.focus,
.btn-success.active.focus,
.open > .dropdown-toggle.btn-success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  background-image: none;
}
.btn-success.disabled:hover,
.btn-success[disabled]:hover,
fieldset[disabled] .btn-success:hover,
.btn-success.disabled:focus,
.btn-success[disabled]:focus,
fieldset[disabled] .btn-success:focus,
.btn-success.disabled.focus,
.btn-success[disabled].focus,
fieldset[disabled] .btn-success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.btn-info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info:focus,
.btn-info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.btn-info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active:hover,
.btn-info.active:hover,
.open > .dropdown-toggle.btn-info:hover,
.btn-info:active:focus,
.btn-info.active:focus,
.open > .dropdown-toggle.btn-info:focus,
.btn-info:active.focus,
.btn-info.active.focus,
.open > .dropdown-toggle.btn-info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  background-image: none;
}
.btn-info.disabled:hover,
.btn-info[disabled]:hover,
fieldset[disabled] .btn-info:hover,
.btn-info.disabled:focus,
.btn-info[disabled]:focus,
fieldset[disabled] .btn-info:focus,
.btn-info.disabled.focus,
.btn-info[disabled].focus,
fieldset[disabled] .btn-info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.btn-warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning:focus,
.btn-warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.btn-warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active:hover,
.btn-warning.active:hover,
.open > .dropdown-toggle.btn-warning:hover,
.btn-warning:active:focus,
.btn-warning.active:focus,
.open > .dropdown-toggle.btn-warning:focus,
.btn-warning:active.focus,
.btn-warning.active.focus,
.open > .dropdown-toggle.btn-warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  background-image: none;
}
.btn-warning.disabled:hover,
.btn-warning[disabled]:hover,
fieldset[disabled] .btn-warning:hover,
.btn-warning.disabled:focus,
.btn-warning[disabled]:focus,
fieldset[disabled] .btn-warning:focus,
.btn-warning.disabled.focus,
.btn-warning[disabled].focus,
fieldset[disabled] .btn-warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.btn-danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger:focus,
.btn-danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.btn-danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active:hover,
.btn-danger.active:hover,
.open > .dropdown-toggle.btn-danger:hover,
.btn-danger:active:focus,
.btn-danger.active:focus,
.open > .dropdown-toggle.btn-danger:focus,
.btn-danger:active.focus,
.btn-danger.active.focus,
.open > .dropdown-toggle.btn-danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  background-image: none;
}
.btn-danger.disabled:hover,
.btn-danger[disabled]:hover,
fieldset[disabled] .btn-danger:hover,
.btn-danger.disabled:focus,
.btn-danger[disabled]:focus,
fieldset[disabled] .btn-danger:focus,
.btn-danger.disabled.focus,
.btn-danger[disabled].focus,
fieldset[disabled] .btn-danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger .badge {
  color: #d9534f;
  background-color: #fff;
}
.btn-link {
  color: #337ab7;
  font-weight: normal;
  border-radius: 0;
}
.btn-link,
.btn-link:active,
.btn-link.active,
.btn-link[disabled],
fieldset[disabled] .btn-link {
  background-color: transparent;
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn-link,
.btn-link:hover,
.btn-link:focus,
.btn-link:active {
  border-color: transparent;
}
.btn-link:hover,
.btn-link:focus {
  color: #23527c;
  text-decoration: underline;
  background-color: transparent;
}
.btn-link[disabled]:hover,
fieldset[disabled] .btn-link:hover,
.btn-link[disabled]:focus,
fieldset[disabled] .btn-link:focus {
  color: #777777;
  text-decoration: none;
}
.btn-lg,
.btn-group-lg > .btn {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.btn-sm,
.btn-group-sm > .btn {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-xs,
.btn-group-xs > .btn {
  padding: 1px 5px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-block {
  display: block;
  width: 100%;
}
.btn-block + .btn-block {
  margin-top: 5px;
}
input[type="submit"].btn-block,
input[type="reset"].btn-block,
input[type="button"].btn-block {
  width: 100%;
}
.fade {
  opacity: 0;
  -webkit-transition: opacity 0.15s linear;
  -o-transition: opacity 0.15s linear;
  transition: opacity 0.15s linear;
}
.fade.in {
  opacity: 1;
}
.collapse {
  display: none;
}
.collapse.in {
  display: block;
}
tr.collapse.in {
  display: table-row;
}
tbody.collapse.in {
  display: table-row-group;
}
.collapsing {
  position: relative;
  height: 0;
  overflow: hidden;
  -webkit-transition-property: height, visibility;
  transition-property: height, visibility;
  -webkit-transition-duration: 0.35s;
  transition-duration: 0.35s;
  -webkit-transition-timing-function: ease;
  transition-timing-function: ease;
}
.caret {
  display: inline-block;
  width: 0;
  height: 0;
  margin-left: 2px;
  vertical-align: middle;
  border-top: 4px dashed;
  border-top: 4px solid \9;
  border-right: 4px solid transparent;
  border-left: 4px solid transparent;
}
.dropup,
.dropdown {
  position: relative;
}
.dropdown-toggle:focus {
  outline: 0;
}
.dropdown-menu {
  position: absolute;
  top: 100%;
  left: 0;
  z-index: 1000;
  display: none;
  float: left;
  min-width: 160px;
  padding: 5px 0;
  margin: 2px 0 0;
  list-style: none;
  font-size: 13px;
  text-align: left;
  background-color: #fff;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.15);
  border-radius: 2px;
  -webkit-box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  background-clip: padding-box;
}
.dropdown-menu.pull-right {
  right: 0;
  left: auto;
}
.dropdown-menu .divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.dropdown-menu > li > a {
  display: block;
  padding: 3px 20px;
  clear: both;
  font-weight: normal;
  line-height: 1.42857143;
  color: #333333;
  white-space: nowrap;
}
.dropdown-menu > li > a:hover,
.dropdown-menu > li > a:focus {
  text-decoration: none;
  color: #262626;
  background-color: #f5f5f5;
}
.dropdown-menu > .active > a,
.dropdown-menu > .active > a:hover,
.dropdown-menu > .active > a:focus {
  color: #fff;
  text-decoration: none;
  outline: 0;
  background-color: #337ab7;
}
.dropdown-menu > .disabled > a,
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  color: #777777;
}
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  text-decoration: none;
  background-color: transparent;
  background-image: none;
  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);
  cursor: not-allowed;
}
.open > .dropdown-menu {
  display: block;
}
.open > a {
  outline: 0;
}
.dropdown-menu-right {
  left: auto;
  right: 0;
}
.dropdown-menu-left {
  left: 0;
  right: auto;
}
.dropdown-header {
  display: block;
  padding: 3px 20px;
  font-size: 12px;
  line-height: 1.42857143;
  color: #777777;
  white-space: nowrap;
}
.dropdown-backdrop {
  position: fixed;
  left: 0;
  right: 0;
  bottom: 0;
  top: 0;
  z-index: 990;
}
.pull-right > .dropdown-menu {
  right: 0;
  left: auto;
}
.dropup .caret,
.navbar-fixed-bottom .dropdown .caret {
  border-top: 0;
  border-bottom: 4px dashed;
  border-bottom: 4px solid \9;
  content: "";
}
.dropup .dropdown-menu,
.navbar-fixed-bottom .dropdown .dropdown-menu {
  top: auto;
  bottom: 100%;
  margin-bottom: 2px;
}
@media (min-width: 541px) {
  .navbar-right .dropdown-menu {
    left: auto;
    right: 0;
  }
  .navbar-right .dropdown-menu-left {
    left: 0;
    right: auto;
  }
}
.btn-group,
.btn-group-vertical {
  position: relative;
  display: inline-block;
  vertical-align: middle;
}
.btn-group > .btn,
.btn-group-vertical > .btn {
  position: relative;
  float: left;
}
.btn-group > .btn:hover,
.btn-group-vertical > .btn:hover,
.btn-group > .btn:focus,
.btn-group-vertical > .btn:focus,
.btn-group > .btn:active,
.btn-group-vertical > .btn:active,
.btn-group > .btn.active,
.btn-group-vertical > .btn.active {
  z-index: 2;
}
.btn-group .btn + .btn,
.btn-group .btn + .btn-group,
.btn-group .btn-group + .btn,
.btn-group .btn-group + .btn-group {
  margin-left: -1px;
}
.btn-toolbar {
  margin-left: -5px;
}
.btn-toolbar .btn,
.btn-toolbar .btn-group,
.btn-toolbar .input-group {
  float: left;
}
.btn-toolbar > .btn,
.btn-toolbar > .btn-group,
.btn-toolbar > .input-group {
  margin-left: 5px;
}
.btn-group > .btn:not(:first-child):not(:last-child):not(.dropdown-toggle) {
  border-radius: 0;
}
.btn-group > .btn:first-child {
  margin-left: 0;
}
.btn-group > .btn:first-child:not(:last-child):not(.dropdown-toggle) {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn:last-child:not(:first-child),
.btn-group > .dropdown-toggle:not(:first-child) {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group > .btn-group {
  float: left;
}
.btn-group > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group .dropdown-toggle:active,
.btn-group.open .dropdown-toggle {
  outline: 0;
}
.btn-group > .btn + .dropdown-toggle {
  padding-left: 8px;
  padding-right: 8px;
}
.btn-group > .btn-lg + .dropdown-toggle {
  padding-left: 12px;
  padding-right: 12px;
}
.btn-group.open .dropdown-toggle {
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn-group.open .dropdown-toggle.btn-link {
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn .caret {
  margin-left: 0;
}
.btn-lg .caret {
  border-width: 5px 5px 0;
  border-bottom-width: 0;
}
.dropup .btn-lg .caret {
  border-width: 0 5px 5px;
}
.btn-group-vertical > .btn,
.btn-group-vertical > .btn-group,
.btn-group-vertical > .btn-group > .btn {
  display: block;
  float: none;
  width: 100%;
  max-width: 100%;
}
.btn-group-vertical > .btn-group > .btn {
  float: none;
}
.btn-group-vertical > .btn + .btn,
.btn-group-vertical > .btn + .btn-group,
.btn-group-vertical > .btn-group + .btn,
.btn-group-vertical > .btn-group + .btn-group {
  margin-top: -1px;
  margin-left: 0;
}
.btn-group-vertical > .btn:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.btn-group-vertical > .btn:first-child:not(:last-child) {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn:last-child:not(:first-child) {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
.btn-group-vertical > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.btn-group-justified {
  display: table;
  width: 100%;
  table-layout: fixed;
  border-collapse: separate;
}
.btn-group-justified > .btn,
.btn-group-justified > .btn-group {
  float: none;
  display: table-cell;
  width: 1%;
}
.btn-group-justified > .btn-group .btn {
  width: 100%;
}
.btn-group-justified > .btn-group .dropdown-menu {
  left: auto;
}
[data-toggle="buttons"] > .btn input[type="radio"],
[data-toggle="buttons"] > .btn-group > .btn input[type="radio"],
[data-toggle="buttons"] > .btn input[type="checkbox"],
[data-toggle="buttons"] > .btn-group > .btn input[type="checkbox"] {
  position: absolute;
  clip: rect(0, 0, 0, 0);
  pointer-events: none;
}
.input-group {
  position: relative;
  display: table;
  border-collapse: separate;
}
.input-group[class*="col-"] {
  float: none;
  padding-left: 0;
  padding-right: 0;
}
.input-group .form-control {
  position: relative;
  z-index: 2;
  float: left;
  width: 100%;
  margin-bottom: 0;
}
.input-group .form-control:focus {
  z-index: 3;
}
.input-group-lg > .form-control,
.input-group-lg > .input-group-addon,
.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-group-lg > .form-control,
select.input-group-lg > .input-group-addon,
select.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  line-height: 45px;
}
textarea.input-group-lg > .form-control,
textarea.input-group-lg > .input-group-addon,
textarea.input-group-lg > .input-group-btn > .btn,
select[multiple].input-group-lg > .form-control,
select[multiple].input-group-lg > .input-group-addon,
select[multiple].input-group-lg > .input-group-btn > .btn {
  height: auto;
}
.input-group-sm > .form-control,
.input-group-sm > .input-group-addon,
.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-group-sm > .form-control,
select.input-group-sm > .input-group-addon,
select.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  line-height: 30px;
}
textarea.input-group-sm > .form-control,
textarea.input-group-sm > .input-group-addon,
textarea.input-group-sm > .input-group-btn > .btn,
select[multiple].input-group-sm > .form-control,
select[multiple].input-group-sm > .input-group-addon,
select[multiple].input-group-sm > .input-group-btn > .btn {
  height: auto;
}
.input-group-addon,
.input-group-btn,
.input-group .form-control {
  display: table-cell;
}
.input-group-addon:not(:first-child):not(:last-child),
.input-group-btn:not(:first-child):not(:last-child),
.input-group .form-control:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.input-group-addon,
.input-group-btn {
  width: 1%;
  white-space: nowrap;
  vertical-align: middle;
}
.input-group-addon {
  padding: 6px 12px;
  font-size: 13px;
  font-weight: normal;
  line-height: 1;
  color: #555555;
  text-align: center;
  background-color: #eeeeee;
  border: 1px solid #ccc;
  border-radius: 2px;
}
.input-group-addon.input-sm {
  padding: 5px 10px;
  font-size: 12px;
  border-radius: 1px;
}
.input-group-addon.input-lg {
  padding: 10px 16px;
  font-size: 17px;
  border-radius: 3px;
}
.input-group-addon input[type="radio"],
.input-group-addon input[type="checkbox"] {
  margin-top: 0;
}
.input-group .form-control:first-child,
.input-group-addon:first-child,
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group > .btn,
.input-group-btn:first-child > .dropdown-toggle,
.input-group-btn:last-child > .btn:not(:last-child):not(.dropdown-toggle),
.input-group-btn:last-child > .btn-group:not(:last-child) > .btn {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.input-group-addon:first-child {
  border-right: 0;
}
.input-group .form-control:last-child,
.input-group-addon:last-child,
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group > .btn,
.input-group-btn:last-child > .dropdown-toggle,
.input-group-btn:first-child > .btn:not(:first-child),
.input-group-btn:first-child > .btn-group:not(:first-child) > .btn {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.input-group-addon:last-child {
  border-left: 0;
}
.input-group-btn {
  position: relative;
  font-size: 0;
  white-space: nowrap;
}
.input-group-btn > .btn {
  position: relative;
}
.input-group-btn > .btn + .btn {
  margin-left: -1px;
}
.input-group-btn > .btn:hover,
.input-group-btn > .btn:focus,
.input-group-btn > .btn:active {
  z-index: 2;
}
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group {
  margin-right: -1px;
}
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group {
  z-index: 2;
  margin-left: -1px;
}
.nav {
  margin-bottom: 0;
  padding-left: 0;
  list-style: none;
}
.nav > li {
  position: relative;
  display: block;
}
.nav > li > a {
  position: relative;
  display: block;
  padding: 10px 15px;
}
.nav > li > a:hover,
.nav > li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.nav > li.disabled > a {
  color: #777777;
}
.nav > li.disabled > a:hover,
.nav > li.disabled > a:focus {
  color: #777777;
  text-decoration: none;
  background-color: transparent;
  cursor: not-allowed;
}
.nav .open > a,
.nav .open > a:hover,
.nav .open > a:focus {
  background-color: #eeeeee;
  border-color: #337ab7;
}
.nav .nav-divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.nav > li > a > img {
  max-width: none;
}
.nav-tabs {
  border-bottom: 1px solid #ddd;
}
.nav-tabs > li {
  float: left;
  margin-bottom: -1px;
}
.nav-tabs > li > a {
  margin-right: 2px;
  line-height: 1.42857143;
  border: 1px solid transparent;
  border-radius: 2px 2px 0 0;
}
.nav-tabs > li > a:hover {
  border-color: #eeeeee #eeeeee #ddd;
}
.nav-tabs > li.active > a,
.nav-tabs > li.active > a:hover,
.nav-tabs > li.active > a:focus {
  color: #555555;
  background-color: #fff;
  border: 1px solid #ddd;
  border-bottom-color: transparent;
  cursor: default;
}
.nav-tabs.nav-justified {
  width: 100%;
  border-bottom: 0;
}
.nav-tabs.nav-justified > li {
  float: none;
}
.nav-tabs.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-tabs.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-tabs.nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs.nav-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs.nav-justified > .active > a,
.nav-tabs.nav-justified > .active > a:hover,
.nav-tabs.nav-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs.nav-justified > .active > a,
  .nav-tabs.nav-justified > .active > a:hover,
  .nav-tabs.nav-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.nav-pills > li {
  float: left;
}
.nav-pills > li > a {
  border-radius: 2px;
}
.nav-pills > li + li {
  margin-left: 2px;
}
.nav-pills > li.active > a,
.nav-pills > li.active > a:hover,
.nav-pills > li.active > a:focus {
  color: #fff;
  background-color: #337ab7;
}
.nav-stacked > li {
  float: none;
}
.nav-stacked > li + li {
  margin-top: 2px;
  margin-left: 0;
}
.nav-justified {
  width: 100%;
}
.nav-justified > li {
  float: none;
}
.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs-justified {
  border-bottom: 0;
}
.nav-tabs-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs-justified > .active > a,
.nav-tabs-justified > .active > a:hover,
.nav-tabs-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs-justified > .active > a,
  .nav-tabs-justified > .active > a:hover,
  .nav-tabs-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.tab-content > .tab-pane {
  display: none;
}
.tab-content > .active {
  display: block;
}
.nav-tabs .dropdown-menu {
  margin-top: -1px;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar {
  position: relative;
  min-height: 30px;
  margin-bottom: 18px;
  border: 1px solid transparent;
}
@media (min-width: 541px) {
  .navbar {
    border-radius: 2px;
  }
}
@media (min-width: 541px) {
  .navbar-header {
    float: left;
  }
}
.navbar-collapse {
  overflow-x: visible;
  padding-right: 0px;
  padding-left: 0px;
  border-top: 1px solid transparent;
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1);
  -webkit-overflow-scrolling: touch;
}
.navbar-collapse.in {
  overflow-y: auto;
}
@media (min-width: 541px) {
  .navbar-collapse {
    width: auto;
    border-top: 0;
    box-shadow: none;
  }
  .navbar-collapse.collapse {
    display: block !important;
    height: auto !important;
    padding-bottom: 0;
    overflow: visible !important;
  }
  .navbar-collapse.in {
    overflow-y: visible;
  }
  .navbar-fixed-top .navbar-collapse,
  .navbar-static-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    padding-left: 0;
    padding-right: 0;
  }
}
.navbar-fixed-top .navbar-collapse,
.navbar-fixed-bottom .navbar-collapse {
  max-height: 340px;
}
@media (max-device-width: 540px) and (orientation: landscape) {
  .navbar-fixed-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    max-height: 200px;
  }
}
.container > .navbar-header,
.container-fluid > .navbar-header,
.container > .navbar-collapse,
.container-fluid > .navbar-collapse {
  margin-right: 0px;
  margin-left: 0px;
}
@media (min-width: 541px) {
  .container > .navbar-header,
  .container-fluid > .navbar-header,
  .container > .navbar-collapse,
  .container-fluid > .navbar-collapse {
    margin-right: 0;
    margin-left: 0;
  }
}
.navbar-static-top {
  z-index: 1000;
  border-width: 0 0 1px;
}
@media (min-width: 541px) {
  .navbar-static-top {
    border-radius: 0;
  }
}
.navbar-fixed-top,
.navbar-fixed-bottom {
  position: fixed;
  right: 0;
  left: 0;
  z-index: 1030;
}
@media (min-width: 541px) {
  .navbar-fixed-top,
  .navbar-fixed-bottom {
    border-radius: 0;
  }
}
.navbar-fixed-top {
  top: 0;
  border-width: 0 0 1px;
}
.navbar-fixed-bottom {
  bottom: 0;
  margin-bottom: 0;
  border-width: 1px 0 0;
}
.navbar-brand {
  float: left;
  padding: 6px 0px;
  font-size: 17px;
  line-height: 18px;
  height: 30px;
}
.navbar-brand:hover,
.navbar-brand:focus {
  text-decoration: none;
}
.navbar-brand > img {
  display: block;
}
@media (min-width: 541px) {
  .navbar > .container .navbar-brand,
  .navbar > .container-fluid .navbar-brand {
    margin-left: 0px;
  }
}
.navbar-toggle {
  position: relative;
  float: right;
  margin-right: 0px;
  padding: 9px 10px;
  margin-top: -2px;
  margin-bottom: -2px;
  background-color: transparent;
  background-image: none;
  border: 1px solid transparent;
  border-radius: 2px;
}
.navbar-toggle:focus {
  outline: 0;
}
.navbar-toggle .icon-bar {
  display: block;
  width: 22px;
  height: 2px;
  border-radius: 1px;
}
.navbar-toggle .icon-bar + .icon-bar {
  margin-top: 4px;
}
@media (min-width: 541px) {
  .navbar-toggle {
    display: none;
  }
}
.navbar-nav {
  margin: 3px 0px;
}
.navbar-nav > li > a {
  padding-top: 10px;
  padding-bottom: 10px;
  line-height: 18px;
}
@media (max-width: 540px) {
  .navbar-nav .open .dropdown-menu {
    position: static;
    float: none;
    width: auto;
    margin-top: 0;
    background-color: transparent;
    border: 0;
    box-shadow: none;
  }
  .navbar-nav .open .dropdown-menu > li > a,
  .navbar-nav .open .dropdown-menu .dropdown-header {
    padding: 5px 15px 5px 25px;
  }
  .navbar-nav .open .dropdown-menu > li > a {
    line-height: 18px;
  }
  .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-nav .open .dropdown-menu > li > a:focus {
    background-image: none;
  }
}
@media (min-width: 541px) {
  .navbar-nav {
    float: left;
    margin: 0;
  }
  .navbar-nav > li {
    float: left;
  }
  .navbar-nav > li > a {
    padding-top: 6px;
    padding-bottom: 6px;
  }
}
.navbar-form {
  margin-left: 0px;
  margin-right: 0px;
  padding: 10px 0px;
  border-top: 1px solid transparent;
  border-bottom: 1px solid transparent;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  margin-top: -1px;
  margin-bottom: -1px;
}
@media (min-width: 768px) {
  .navbar-form .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .navbar-form .form-control-static {
    display: inline-block;
  }
  .navbar-form .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .navbar-form .input-group .input-group-addon,
  .navbar-form .input-group .input-group-btn,
  .navbar-form .input-group .form-control {
    width: auto;
  }
  .navbar-form .input-group > .form-control {
    width: 100%;
  }
  .navbar-form .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio,
  .navbar-form .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio label,
  .navbar-form .checkbox label {
    padding-left: 0;
  }
  .navbar-form .radio input[type="radio"],
  .navbar-form .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .navbar-form .has-feedback .form-control-feedback {
    top: 0;
  }
}
@media (max-width: 540px) {
  .navbar-form .form-group {
    margin-bottom: 5px;
  }
  .navbar-form .form-group:last-child {
    margin-bottom: 0;
  }
}
@media (min-width: 541px) {
  .navbar-form {
    width: auto;
    border: 0;
    margin-left: 0;
    margin-right: 0;
    padding-top: 0;
    padding-bottom: 0;
    -webkit-box-shadow: none;
    box-shadow: none;
  }
}
.navbar-nav > li > .dropdown-menu {
  margin-top: 0;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar-fixed-bottom .navbar-nav > li > .dropdown-menu {
  margin-bottom: 0;
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.navbar-btn {
  margin-top: -1px;
  margin-bottom: -1px;
}
.navbar-btn.btn-sm {
  margin-top: 0px;
  margin-bottom: 0px;
}
.navbar-btn.btn-xs {
  margin-top: 4px;
  margin-bottom: 4px;
}
.navbar-text {
  margin-top: 6px;
  margin-bottom: 6px;
}
@media (min-width: 541px) {
  .navbar-text {
    float: left;
    margin-left: 0px;
    margin-right: 0px;
  }
}
@media (min-width: 541px) {
  .navbar-left {
    float: left !important;
    float: left;
  }
  .navbar-right {
    float: right !important;
    float: right;
    margin-right: 0px;
  }
  .navbar-right ~ .navbar-right {
    margin-right: 0;
  }
}
.navbar-default {
  background-color: #f8f8f8;
  border-color: #e7e7e7;
}
.navbar-default .navbar-brand {
  color: #777;
}
.navbar-default .navbar-brand:hover,
.navbar-default .navbar-brand:focus {
  color: #5e5e5e;
  background-color: transparent;
}
.navbar-default .navbar-text {
  color: #777;
}
.navbar-default .navbar-nav > li > a {
  color: #777;
}
.navbar-default .navbar-nav > li > a:hover,
.navbar-default .navbar-nav > li > a:focus {
  color: #333;
  background-color: transparent;
}
.navbar-default .navbar-nav > .active > a,
.navbar-default .navbar-nav > .active > a:hover,
.navbar-default .navbar-nav > .active > a:focus {
  color: #555;
  background-color: #e7e7e7;
}
.navbar-default .navbar-nav > .disabled > a,
.navbar-default .navbar-nav > .disabled > a:hover,
.navbar-default .navbar-nav > .disabled > a:focus {
  color: #ccc;
  background-color: transparent;
}
.navbar-default .navbar-toggle {
  border-color: #ddd;
}
.navbar-default .navbar-toggle:hover,
.navbar-default .navbar-toggle:focus {
  background-color: #ddd;
}
.navbar-default .navbar-toggle .icon-bar {
  background-color: #888;
}
.navbar-default .navbar-collapse,
.navbar-default .navbar-form {
  border-color: #e7e7e7;
}
.navbar-default .navbar-nav > .open > a,
.navbar-default .navbar-nav > .open > a:hover,
.navbar-default .navbar-nav > .open > a:focus {
  background-color: #e7e7e7;
  color: #555;
}
@media (max-width: 540px) {
  .navbar-default .navbar-nav .open .dropdown-menu > li > a {
    color: #777;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #333;
    background-color: transparent;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #555;
    background-color: #e7e7e7;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #ccc;
    background-color: transparent;
  }
}
.navbar-default .navbar-link {
  color: #777;
}
.navbar-default .navbar-link:hover {
  color: #333;
}
.navbar-default .btn-link {
  color: #777;
}
.navbar-default .btn-link:hover,
.navbar-default .btn-link:focus {
  color: #333;
}
.navbar-default .btn-link[disabled]:hover,
fieldset[disabled] .navbar-default .btn-link:hover,
.navbar-default .btn-link[disabled]:focus,
fieldset[disabled] .navbar-default .btn-link:focus {
  color: #ccc;
}
.navbar-inverse {
  background-color: #222;
  border-color: #080808;
}
.navbar-inverse .navbar-brand {
  color: #9d9d9d;
}
.navbar-inverse .navbar-brand:hover,
.navbar-inverse .navbar-brand:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-text {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a:hover,
.navbar-inverse .navbar-nav > li > a:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-nav > .active > a,
.navbar-inverse .navbar-nav > .active > a:hover,
.navbar-inverse .navbar-nav > .active > a:focus {
  color: #fff;
  background-color: #080808;
}
.navbar-inverse .navbar-nav > .disabled > a,
.navbar-inverse .navbar-nav > .disabled > a:hover,
.navbar-inverse .navbar-nav > .disabled > a:focus {
  color: #444;
  background-color: transparent;
}
.navbar-inverse .navbar-toggle {
  border-color: #333;
}
.navbar-inverse .navbar-toggle:hover,
.navbar-inverse .navbar-toggle:focus {
  background-color: #333;
}
.navbar-inverse .navbar-toggle .icon-bar {
  background-color: #fff;
}
.navbar-inverse .navbar-collapse,
.navbar-inverse .navbar-form {
  border-color: #101010;
}
.navbar-inverse .navbar-nav > .open > a,
.navbar-inverse .navbar-nav > .open > a:hover,
.navbar-inverse .navbar-nav > .open > a:focus {
  background-color: #080808;
  color: #fff;
}
@media (max-width: 540px) {
  .navbar-inverse .navbar-nav .open .dropdown-menu > .dropdown-header {
    border-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu .divider {
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a {
    color: #9d9d9d;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #fff;
    background-color: transparent;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #fff;
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #444;
    background-color: transparent;
  }
}
.navbar-inverse .navbar-link {
  color: #9d9d9d;
}
.navbar-inverse .navbar-link:hover {
  color: #fff;
}
.navbar-inverse .btn-link {
  color: #9d9d9d;
}
.navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link:focus {
  color: #fff;
}
.navbar-inverse .btn-link[disabled]:hover,
fieldset[disabled] .navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link[disabled]:focus,
fieldset[disabled] .navbar-inverse .btn-link:focus {
  color: #444;
}
.breadcrumb {
  padding: 8px 15px;
  margin-bottom: 18px;
  list-style: none;
  background-color: #f5f5f5;
  border-radius: 2px;
}
.breadcrumb > li {
  display: inline-block;
}
.breadcrumb > li + li:before {
  content: "/\00a0";
  padding: 0 5px;
  color: #5e5e5e;
}
.breadcrumb > .active {
  color: #777777;
}
.pagination {
  display: inline-block;
  padding-left: 0;
  margin: 18px 0;
  border-radius: 2px;
}
.pagination > li {
  display: inline;
}
.pagination > li > a,
.pagination > li > span {
  position: relative;
  float: left;
  padding: 6px 12px;
  line-height: 1.42857143;
  text-decoration: none;
  color: #337ab7;
  background-color: #fff;
  border: 1px solid #ddd;
  margin-left: -1px;
}
.pagination > li:first-child > a,
.pagination > li:first-child > span {
  margin-left: 0;
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.pagination > li:last-child > a,
.pagination > li:last-child > span {
  border-bottom-right-radius: 2px;
  border-top-right-radius: 2px;
}
.pagination > li > a:hover,
.pagination > li > span:hover,
.pagination > li > a:focus,
.pagination > li > span:focus {
  z-index: 2;
  color: #23527c;
  background-color: #eeeeee;
  border-color: #ddd;
}
.pagination > .active > a,
.pagination > .active > span,
.pagination > .active > a:hover,
.pagination > .active > span:hover,
.pagination > .active > a:focus,
.pagination > .active > span:focus {
  z-index: 3;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
  cursor: default;
}
.pagination > .disabled > span,
.pagination > .disabled > span:hover,
.pagination > .disabled > span:focus,
.pagination > .disabled > a,
.pagination > .disabled > a:hover,
.pagination > .disabled > a:focus {
  color: #777777;
  background-color: #fff;
  border-color: #ddd;
  cursor: not-allowed;
}
.pagination-lg > li > a,
.pagination-lg > li > span {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.pagination-lg > li:first-child > a,
.pagination-lg > li:first-child > span {
  border-bottom-left-radius: 3px;
  border-top-left-radius: 3px;
}
.pagination-lg > li:last-child > a,
.pagination-lg > li:last-child > span {
  border-bottom-right-radius: 3px;
  border-top-right-radius: 3px;
}
.pagination-sm > li > a,
.pagination-sm > li > span {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.pagination-sm > li:first-child > a,
.pagination-sm > li:first-child > span {
  border-bottom-left-radius: 1px;
  border-top-left-radius: 1px;
}
.pagination-sm > li:last-child > a,
.pagination-sm > li:last-child > span {
  border-bottom-right-radius: 1px;
  border-top-right-radius: 1px;
}
.pager {
  padding-left: 0;
  margin: 18px 0;
  list-style: none;
  text-align: center;
}
.pager li {
  display: inline;
}
.pager li > a,
.pager li > span {
  display: inline-block;
  padding: 5px 14px;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 15px;
}
.pager li > a:hover,
.pager li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.pager .next > a,
.pager .next > span {
  float: right;
}
.pager .previous > a,
.pager .previous > span {
  float: left;
}
.pager .disabled > a,
.pager .disabled > a:hover,
.pager .disabled > a:focus,
.pager .disabled > span {
  color: #777777;
  background-color: #fff;
  cursor: not-allowed;
}
.label {
  display: inline;
  padding: .2em .6em .3em;
  font-size: 75%;
  font-weight: bold;
  line-height: 1;
  color: #fff;
  text-align: center;
  white-space: nowrap;
  vertical-align: baseline;
  border-radius: .25em;
}
a.label:hover,
a.label:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.label:empty {
  display: none;
}
.btn .label {
  position: relative;
  top: -1px;
}
.label-default {
  background-color: #777777;
}
.label-default[href]:hover,
.label-default[href]:focus {
  background-color: #5e5e5e;
}
.label-primary {
  background-color: #337ab7;
}
.label-primary[href]:hover,
.label-primary[href]:focus {
  background-color: #286090;
}
.label-success {
  background-color: #5cb85c;
}
.label-success[href]:hover,
.label-success[href]:focus {
  background-color: #449d44;
}
.label-info {
  background-color: #5bc0de;
}
.label-info[href]:hover,
.label-info[href]:focus {
  background-color: #31b0d5;
}
.label-warning {
  background-color: #f0ad4e;
}
.label-warning[href]:hover,
.label-warning[href]:focus {
  background-color: #ec971f;
}
.label-danger {
  background-color: #d9534f;
}
.label-danger[href]:hover,
.label-danger[href]:focus {
  background-color: #c9302c;
}
.badge {
  display: inline-block;
  min-width: 10px;
  padding: 3px 7px;
  font-size: 12px;
  font-weight: bold;
  color: #fff;
  line-height: 1;
  vertical-align: middle;
  white-space: nowrap;
  text-align: center;
  background-color: #777777;
  border-radius: 10px;
}
.badge:empty {
  display: none;
}
.btn .badge {
  position: relative;
  top: -1px;
}
.btn-xs .badge,
.btn-group-xs > .btn .badge {
  top: 0;
  padding: 1px 5px;
}
a.badge:hover,
a.badge:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.list-group-item.active > .badge,
.nav-pills > .active > a > .badge {
  color: #337ab7;
  background-color: #fff;
}
.list-group-item > .badge {
  float: right;
}
.list-group-item > .badge + .badge {
  margin-right: 5px;
}
.nav-pills > li > a > .badge {
  margin-left: 3px;
}
.jumbotron {
  padding-top: 30px;
  padding-bottom: 30px;
  margin-bottom: 30px;
  color: inherit;
  background-color: #eeeeee;
}
.jumbotron h1,
.jumbotron .h1 {
  color: inherit;
}
.jumbotron p {
  margin-bottom: 15px;
  font-size: 20px;
  font-weight: 200;
}
.jumbotron > hr {
  border-top-color: #d5d5d5;
}
.container .jumbotron,
.container-fluid .jumbotron {
  border-radius: 3px;
  padding-left: 0px;
  padding-right: 0px;
}
.jumbotron .container {
  max-width: 100%;
}
@media screen and (min-width: 768px) {
  .jumbotron {
    padding-top: 48px;
    padding-bottom: 48px;
  }
  .container .jumbotron,
  .container-fluid .jumbotron {
    padding-left: 60px;
    padding-right: 60px;
  }
  .jumbotron h1,
  .jumbotron .h1 {
    font-size: 59px;
  }
}
.thumbnail {
  display: block;
  padding: 4px;
  margin-bottom: 18px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: border 0.2s ease-in-out;
  -o-transition: border 0.2s ease-in-out;
  transition: border 0.2s ease-in-out;
}
.thumbnail > img,
.thumbnail a > img {
  margin-left: auto;
  margin-right: auto;
}
a.thumbnail:hover,
a.thumbnail:focus,
a.thumbnail.active {
  border-color: #337ab7;
}
.thumbnail .caption {
  padding: 9px;
  color: #000;
}
.alert {
  padding: 15px;
  margin-bottom: 18px;
  border: 1px solid transparent;
  border-radius: 2px;
}
.alert h4 {
  margin-top: 0;
  color: inherit;
}
.alert .alert-link {
  font-weight: bold;
}
.alert > p,
.alert > ul {
  margin-bottom: 0;
}
.alert > p + p {
  margin-top: 5px;
}
.alert-dismissable,
.alert-dismissible {
  padding-right: 35px;
}
.alert-dismissable .close,
.alert-dismissible .close {
  position: relative;
  top: -2px;
  right: -21px;
  color: inherit;
}
.alert-success {
  background-color: #dff0d8;
  border-color: #d6e9c6;
  color: #3c763d;
}
.alert-success hr {
  border-top-color: #c9e2b3;
}
.alert-success .alert-link {
  color: #2b542c;
}
.alert-info {
  background-color: #d9edf7;
  border-color: #bce8f1;
  color: #31708f;
}
.alert-info hr {
  border-top-color: #a6e1ec;
}
.alert-info .alert-link {
  color: #245269;
}
.alert-warning {
  background-color: #fcf8e3;
  border-color: #faebcc;
  color: #8a6d3b;
}
.alert-warning hr {
  border-top-color: #f7e1b5;
}
.alert-warning .alert-link {
  color: #66512c;
}
.alert-danger {
  background-color: #f2dede;
  border-color: #ebccd1;
  color: #a94442;
}
.alert-danger hr {
  border-top-color: #e4b9c0;
}
.alert-danger .alert-link {
  color: #843534;
}
@-webkit-keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
@keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
.progress {
  overflow: hidden;
  height: 18px;
  margin-bottom: 18px;
  background-color: #f5f5f5;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
}
.progress-bar {
  float: left;
  width: 0%;
  height: 100%;
  font-size: 12px;
  line-height: 18px;
  color: #fff;
  text-align: center;
  background-color: #337ab7;
  -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  -webkit-transition: width 0.6s ease;
  -o-transition: width 0.6s ease;
  transition: width 0.6s ease;
}
.progress-striped .progress-bar,
.progress-bar-striped {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-size: 40px 40px;
}
.progress.active .progress-bar,
.progress-bar.active {
  -webkit-animation: progress-bar-stripes 2s linear infinite;
  -o-animation: progress-bar-stripes 2s linear infinite;
  animation: progress-bar-stripes 2s linear infinite;
}
.progress-bar-success {
  background-color: #5cb85c;
}
.progress-striped .progress-bar-success {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-info {
  background-color: #5bc0de;
}
.progress-striped .progress-bar-info {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-warning {
  background-color: #f0ad4e;
}
.progress-striped .progress-bar-warning {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-danger {
  background-color: #d9534f;
}
.progress-striped .progress-bar-danger {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.media {
  margin-top: 15px;
}
.media:first-child {
  margin-top: 0;
}
.media,
.media-body {
  zoom: 1;
  overflow: hidden;
}
.media-body {
  width: 10000px;
}
.media-object {
  display: block;
}
.media-object.img-thumbnail {
  max-width: none;
}
.media-right,
.media > .pull-right {
  padding-left: 10px;
}
.media-left,
.media > .pull-left {
  padding-right: 10px;
}
.media-left,
.media-right,
.media-body {
  display: table-cell;
  vertical-align: top;
}
.media-middle {
  vertical-align: middle;
}
.media-bottom {
  vertical-align: bottom;
}
.media-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.media-list {
  padding-left: 0;
  list-style: none;
}
.list-group {
  margin-bottom: 20px;
  padding-left: 0;
}
.list-group-item {
  position: relative;
  display: block;
  padding: 10px 15px;
  margin-bottom: -1px;
  background-color: #fff;
  border: 1px solid #ddd;
}
.list-group-item:first-child {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
}
.list-group-item:last-child {
  margin-bottom: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
a.list-group-item,
button.list-group-item {
  color: #555;
}
a.list-group-item .list-group-item-heading,
button.list-group-item .list-group-item-heading {
  color: #333;
}
a.list-group-item:hover,
button.list-group-item:hover,
a.list-group-item:focus,
button.list-group-item:focus {
  text-decoration: none;
  color: #555;
  background-color: #f5f5f5;
}
button.list-group-item {
  width: 100%;
  text-align: left;
}
.list-group-item.disabled,
.list-group-item.disabled:hover,
.list-group-item.disabled:focus {
  background-color: #eeeeee;
  color: #777777;
  cursor: not-allowed;
}
.list-group-item.disabled .list-group-item-heading,
.list-group-item.disabled:hover .list-group-item-heading,
.list-group-item.disabled:focus .list-group-item-heading {
  color: inherit;
}
.list-group-item.disabled .list-group-item-text,
.list-group-item.disabled:hover .list-group-item-text,
.list-group-item.disabled:focus .list-group-item-text {
  color: #777777;
}
.list-group-item.active,
.list-group-item.active:hover,
.list-group-item.active:focus {
  z-index: 2;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.list-group-item.active .list-group-item-heading,
.list-group-item.active:hover .list-group-item-heading,
.list-group-item.active:focus .list-group-item-heading,
.list-group-item.active .list-group-item-heading > small,
.list-group-item.active:hover .list-group-item-heading > small,
.list-group-item.active:focus .list-group-item-heading > small,
.list-group-item.active .list-group-item-heading > .small,
.list-group-item.active:hover .list-group-item-heading > .small,
.list-group-item.active:focus .list-group-item-heading > .small {
  color: inherit;
}
.list-group-item.active .list-group-item-text,
.list-group-item.active:hover .list-group-item-text,
.list-group-item.active:focus .list-group-item-text {
  color: #c7ddef;
}
.list-group-item-success {
  color: #3c763d;
  background-color: #dff0d8;
}
a.list-group-item-success,
button.list-group-item-success {
  color: #3c763d;
}
a.list-group-item-success .list-group-item-heading,
button.list-group-item-success .list-group-item-heading {
  color: inherit;
}
a.list-group-item-success:hover,
button.list-group-item-success:hover,
a.list-group-item-success:focus,
button.list-group-item-success:focus {
  color: #3c763d;
  background-color: #d0e9c6;
}
a.list-group-item-success.active,
button.list-group-item-success.active,
a.list-group-item-success.active:hover,
button.list-group-item-success.active:hover,
a.list-group-item-success.active:focus,
button.list-group-item-success.active:focus {
  color: #fff;
  background-color: #3c763d;
  border-color: #3c763d;
}
.list-group-item-info {
  color: #31708f;
  background-color: #d9edf7;
}
a.list-group-item-info,
button.list-group-item-info {
  color: #31708f;
}
a.list-group-item-info .list-group-item-heading,
button.list-group-item-info .list-group-item-heading {
  color: inherit;
}
a.list-group-item-info:hover,
button.list-group-item-info:hover,
a.list-group-item-info:focus,
button.list-group-item-info:focus {
  color: #31708f;
  background-color: #c4e3f3;
}
a.list-group-item-info.active,
button.list-group-item-info.active,
a.list-group-item-info.active:hover,
button.list-group-item-info.active:hover,
a.list-group-item-info.active:focus,
button.list-group-item-info.active:focus {
  color: #fff;
  background-color: #31708f;
  border-color: #31708f;
}
.list-group-item-warning {
  color: #8a6d3b;
  background-color: #fcf8e3;
}
a.list-group-item-warning,
button.list-group-item-warning {
  color: #8a6d3b;
}
a.list-group-item-warning .list-group-item-heading,
button.list-group-item-warning .list-group-item-heading {
  color: inherit;
}
a.list-group-item-warning:hover,
button.list-group-item-warning:hover,
a.list-group-item-warning:focus,
button.list-group-item-warning:focus {
  color: #8a6d3b;
  background-color: #faf2cc;
}
a.list-group-item-warning.active,
button.list-group-item-warning.active,
a.list-group-item-warning.active:hover,
button.list-group-item-warning.active:hover,
a.list-group-item-warning.active:focus,
button.list-group-item-warning.active:focus {
  color: #fff;
  background-color: #8a6d3b;
  border-color: #8a6d3b;
}
.list-group-item-danger {
  color: #a94442;
  background-color: #f2dede;
}
a.list-group-item-danger,
button.list-group-item-danger {
  color: #a94442;
}
a.list-group-item-danger .list-group-item-heading,
button.list-group-item-danger .list-group-item-heading {
  color: inherit;
}
a.list-group-item-danger:hover,
button.list-group-item-danger:hover,
a.list-group-item-danger:focus,
button.list-group-item-danger:focus {
  color: #a94442;
  background-color: #ebcccc;
}
a.list-group-item-danger.active,
button.list-group-item-danger.active,
a.list-group-item-danger.active:hover,
button.list-group-item-danger.active:hover,
a.list-group-item-danger.active:focus,
button.list-group-item-danger.active:focus {
  color: #fff;
  background-color: #a94442;
  border-color: #a94442;
}
.list-group-item-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.list-group-item-text {
  margin-bottom: 0;
  line-height: 1.3;
}
.panel {
  margin-bottom: 18px;
  background-color: #fff;
  border: 1px solid transparent;
  border-radius: 2px;
  -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
}
.panel-body {
  padding: 15px;
}
.panel-heading {
  padding: 10px 15px;
  border-bottom: 1px solid transparent;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel-heading > .dropdown .dropdown-toggle {
  color: inherit;
}
.panel-title {
  margin-top: 0;
  margin-bottom: 0;
  font-size: 15px;
  color: inherit;
}
.panel-title > a,
.panel-title > small,
.panel-title > .small,
.panel-title > small > a,
.panel-title > .small > a {
  color: inherit;
}
.panel-footer {
  padding: 10px 15px;
  background-color: #f5f5f5;
  border-top: 1px solid #ddd;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .list-group,
.panel > .panel-collapse > .list-group {
  margin-bottom: 0;
}
.panel > .list-group .list-group-item,
.panel > .panel-collapse > .list-group .list-group-item {
  border-width: 1px 0;
  border-radius: 0;
}
.panel > .list-group:first-child .list-group-item:first-child,
.panel > .panel-collapse > .list-group:first-child .list-group-item:first-child {
  border-top: 0;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .list-group:last-child .list-group-item:last-child,
.panel > .panel-collapse > .list-group:last-child .list-group-item:last-child {
  border-bottom: 0;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .panel-heading + .panel-collapse > .list-group .list-group-item:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.panel-heading + .list-group .list-group-item:first-child {
  border-top-width: 0;
}
.list-group + .panel-footer {
  border-top-width: 0;
}
.panel > .table,
.panel > .table-responsive > .table,
.panel > .panel-collapse > .table {
  margin-bottom: 0;
}
.panel > .table caption,
.panel > .table-responsive > .table caption,
.panel > .panel-collapse > .table caption {
  padding-left: 15px;
  padding-right: 15px;
}
.panel > .table:first-child,
.panel > .table-responsive:first-child > .table:first-child {
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child {
  border-top-left-radius: 1px;
  border-top-right-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:first-child {
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:last-child {
  border-top-right-radius: 1px;
}
.panel > .table:last-child,
.panel > .table-responsive:last-child > .table:last-child {
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child {
  border-bottom-left-radius: 1px;
  border-bottom-right-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:first-child {
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:last-child {
  border-bottom-right-radius: 1px;
}
.panel > .panel-body + .table,
.panel > .panel-body + .table-responsive,
.panel > .table + .panel-body,
.panel > .table-responsive + .panel-body {
  border-top: 1px solid #ddd;
}
.panel > .table > tbody:first-child > tr:first-child th,
.panel > .table > tbody:first-child > tr:first-child td {
  border-top: 0;
}
.panel > .table-bordered,
.panel > .table-responsive > .table-bordered {
  border: 0;
}
.panel > .table-bordered > thead > tr > th:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:first-child,
.panel > .table-bordered > tbody > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:first-child,
.panel > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-bordered > thead > tr > td:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:first-child,
.panel > .table-bordered > tbody > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:first-child,
.panel > .table-bordered > tfoot > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:first-child {
  border-left: 0;
}
.panel > .table-bordered > thead > tr > th:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:last-child,
.panel > .table-bordered > tbody > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:last-child,
.panel > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-bordered > thead > tr > td:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:last-child,
.panel > .table-bordered > tbody > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:last-child,
.panel > .table-bordered > tfoot > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:last-child {
  border-right: 0;
}
.panel > .table-bordered > thead > tr:first-child > td,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > td,
.panel > .table-bordered > tbody > tr:first-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > td,
.panel > .table-bordered > thead > tr:first-child > th,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > th,
.panel > .table-bordered > tbody > tr:first-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > th {
  border-bottom: 0;
}
.panel > .table-bordered > tbody > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > td,
.panel > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-bordered > tbody > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > th,
.panel > .table-bordered > tfoot > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > th {
  border-bottom: 0;
}
.panel > .table-responsive {
  border: 0;
  margin-bottom: 0;
}
.panel-group {
  margin-bottom: 18px;
}
.panel-group .panel {
  margin-bottom: 0;
  border-radius: 2px;
}
.panel-group .panel + .panel {
  margin-top: 5px;
}
.panel-group .panel-heading {
  border-bottom: 0;
}
.panel-group .panel-heading + .panel-collapse > .panel-body,
.panel-group .panel-heading + .panel-collapse > .list-group {
  border-top: 1px solid #ddd;
}
.panel-group .panel-footer {
  border-top: 0;
}
.panel-group .panel-footer + .panel-collapse .panel-body {
  border-bottom: 1px solid #ddd;
}
.panel-default {
  border-color: #ddd;
}
.panel-default > .panel-heading {
  color: #333333;
  background-color: #f5f5f5;
  border-color: #ddd;
}
.panel-default > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ddd;
}
.panel-default > .panel-heading .badge {
  color: #f5f5f5;
  background-color: #333333;
}
.panel-default > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ddd;
}
.panel-primary {
  border-color: #337ab7;
}
.panel-primary > .panel-heading {
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.panel-primary > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #337ab7;
}
.panel-primary > .panel-heading .badge {
  color: #337ab7;
  background-color: #fff;
}
.panel-primary > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #337ab7;
}
.panel-success {
  border-color: #d6e9c6;
}
.panel-success > .panel-heading {
  color: #3c763d;
  background-color: #dff0d8;
  border-color: #d6e9c6;
}
.panel-success > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #d6e9c6;
}
.panel-success > .panel-heading .badge {
  color: #dff0d8;
  background-color: #3c763d;
}
.panel-success > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #d6e9c6;
}
.panel-info {
  border-color: #bce8f1;
}
.panel-info > .panel-heading {
  color: #31708f;
  background-color: #d9edf7;
  border-color: #bce8f1;
}
.panel-info > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #bce8f1;
}
.panel-info > .panel-heading .badge {
  color: #d9edf7;
  background-color: #31708f;
}
.panel-info > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #bce8f1;
}
.panel-warning {
  border-color: #faebcc;
}
.panel-warning > .panel-heading {
  color: #8a6d3b;
  background-color: #fcf8e3;
  border-color: #faebcc;
}
.panel-warning > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #faebcc;
}
.panel-warning > .panel-heading .badge {
  color: #fcf8e3;
  background-color: #8a6d3b;
}
.panel-warning > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #faebcc;
}
.panel-danger {
  border-color: #ebccd1;
}
.panel-danger > .panel-heading {
  color: #a94442;
  background-color: #f2dede;
  border-color: #ebccd1;
}
.panel-danger > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ebccd1;
}
.panel-danger > .panel-heading .badge {
  color: #f2dede;
  background-color: #a94442;
}
.panel-danger > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ebccd1;
}
.embed-responsive {
  position: relative;
  display: block;
  height: 0;
  padding: 0;
  overflow: hidden;
}
.embed-responsive .embed-responsive-item,
.embed-responsive iframe,
.embed-responsive embed,
.embed-responsive object,
.embed-responsive video {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  height: 100%;
  width: 100%;
  border: 0;
}
.embed-responsive-16by9 {
  padding-bottom: 56.25%;
}
.embed-responsive-4by3 {
  padding-bottom: 75%;
}
.well {
  min-height: 20px;
  padding: 19px;
  margin-bottom: 20px;
  background-color: #f5f5f5;
  border: 1px solid #e3e3e3;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
}
.well blockquote {
  border-color: #ddd;
  border-color: rgba(0, 0, 0, 0.15);
}
.well-lg {
  padding: 24px;
  border-radius: 3px;
}
.well-sm {
  padding: 9px;
  border-radius: 1px;
}
.close {
  float: right;
  font-size: 19.5px;
  font-weight: bold;
  line-height: 1;
  color: #000;
  text-shadow: 0 1px 0 #fff;
  opacity: 0.2;
  filter: alpha(opacity=20);
}
.close:hover,
.close:focus {
  color: #000;
  text-decoration: none;
  cursor: pointer;
  opacity: 0.5;
  filter: alpha(opacity=50);
}
button.close {
  padding: 0;
  cursor: pointer;
  background: transparent;
  border: 0;
  -webkit-appearance: none;
}
.modal-open {
  overflow: hidden;
}
.modal {
  display: none;
  overflow: hidden;
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1050;
  -webkit-overflow-scrolling: touch;
  outline: 0;
}
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, -25%);
  -ms-transform: translate(0, -25%);
  -o-transform: translate(0, -25%);
  transform: translate(0, -25%);
  -webkit-transition: -webkit-transform 0.3s ease-out;
  -moz-transition: -moz-transform 0.3s ease-out;
  -o-transition: -o-transform 0.3s ease-out;
  transition: transform 0.3s ease-out;
}
.modal.in .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
.modal-open .modal {
  overflow-x: hidden;
  overflow-y: auto;
}
.modal-dialog {
  position: relative;
  width: auto;
  margin: 10px;
}
.modal-content {
  position: relative;
  background-color: #fff;
  border: 1px solid #999;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  background-clip: padding-box;
  outline: 0;
}
.modal-backdrop {
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1040;
  background-color: #000;
}
.modal-backdrop.fade {
  opacity: 0;
  filter: alpha(opacity=0);
}
.modal-backdrop.in {
  opacity: 0.5;
  filter: alpha(opacity=50);
}
.modal-header {
  padding: 15px;
  border-bottom: 1px solid #e5e5e5;
}
.modal-header .close {
  margin-top: -2px;
}
.modal-title {
  margin: 0;
  line-height: 1.42857143;
}
.modal-body {
  position: relative;
  padding: 15px;
}
.modal-footer {
  padding: 15px;
  text-align: right;
  border-top: 1px solid #e5e5e5;
}
.modal-footer .btn + .btn {
  margin-left: 5px;
  margin-bottom: 0;
}
.modal-footer .btn-group .btn + .btn {
  margin-left: -1px;
}
.modal-footer .btn-block + .btn-block {
  margin-left: 0;
}
.modal-scrollbar-measure {
  position: absolute;
  top: -9999px;
  width: 50px;
  height: 50px;
  overflow: scroll;
}
@media (min-width: 768px) {
  .modal-dialog {
    width: 600px;
    margin: 30px auto;
  }
  .modal-content {
    -webkit-box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
    box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
  }
  .modal-sm {
    width: 300px;
  }
}
@media (min-width: 992px) {
  .modal-lg {
    width: 900px;
  }
}
.tooltip {
  position: absolute;
  z-index: 1070;
  display: block;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 12px;
  opacity: 0;
  filter: alpha(opacity=0);
}
.tooltip.in {
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.tooltip.top {
  margin-top: -3px;
  padding: 5px 0;
}
.tooltip.right {
  margin-left: 3px;
  padding: 0 5px;
}
.tooltip.bottom {
  margin-top: 3px;
  padding: 5px 0;
}
.tooltip.left {
  margin-left: -3px;
  padding: 0 5px;
}
.tooltip-inner {
  max-width: 200px;
  padding: 3px 8px;
  color: #fff;
  text-align: center;
  background-color: #000;
  border-radius: 2px;
}
.tooltip-arrow {
  position: absolute;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.tooltip.top .tooltip-arrow {
  bottom: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-left .tooltip-arrow {
  bottom: 0;
  right: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-right .tooltip-arrow {
  bottom: 0;
  left: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.right .tooltip-arrow {
  top: 50%;
  left: 0;
  margin-top: -5px;
  border-width: 5px 5px 5px 0;
  border-right-color: #000;
}
.tooltip.left .tooltip-arrow {
  top: 50%;
  right: 0;
  margin-top: -5px;
  border-width: 5px 0 5px 5px;
  border-left-color: #000;
}
.tooltip.bottom .tooltip-arrow {
  top: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-left .tooltip-arrow {
  top: 0;
  right: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-right .tooltip-arrow {
  top: 0;
  left: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.popover {
  position: absolute;
  top: 0;
  left: 0;
  z-index: 1060;
  display: none;
  max-width: 276px;
  padding: 1px;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 13px;
  background-color: #fff;
  background-clip: padding-box;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
  box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
}
.popover.top {
  margin-top: -10px;
}
.popover.right {
  margin-left: 10px;
}
.popover.bottom {
  margin-top: 10px;
}
.popover.left {
  margin-left: -10px;
}
.popover-title {
  margin: 0;
  padding: 8px 14px;
  font-size: 13px;
  background-color: #f7f7f7;
  border-bottom: 1px solid #ebebeb;
  border-radius: 2px 2px 0 0;
}
.popover-content {
  padding: 9px 14px;
}
.popover > .arrow,
.popover > .arrow:after {
  position: absolute;
  display: block;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.popover > .arrow {
  border-width: 11px;
}
.popover > .arrow:after {
  border-width: 10px;
  content: "";
}
.popover.top > .arrow {
  left: 50%;
  margin-left: -11px;
  border-bottom-width: 0;
  border-top-color: #999999;
  border-top-color: rgba(0, 0, 0, 0.25);
  bottom: -11px;
}
.popover.top > .arrow:after {
  content: " ";
  bottom: 1px;
  margin-left: -10px;
  border-bottom-width: 0;
  border-top-color: #fff;
}
.popover.right > .arrow {
  top: 50%;
  left: -11px;
  margin-top: -11px;
  border-left-width: 0;
  border-right-color: #999999;
  border-right-color: rgba(0, 0, 0, 0.25);
}
.popover.right > .arrow:after {
  content: " ";
  left: 1px;
  bottom: -10px;
  border-left-width: 0;
  border-right-color: #fff;
}
.popover.bottom > .arrow {
  left: 50%;
  margin-left: -11px;
  border-top-width: 0;
  border-bottom-color: #999999;
  border-bottom-color: rgba(0, 0, 0, 0.25);
  top: -11px;
}
.popover.bottom > .arrow:after {
  content: " ";
  top: 1px;
  margin-left: -10px;
  border-top-width: 0;
  border-bottom-color: #fff;
}
.popover.left > .arrow {
  top: 50%;
  right: -11px;
  margin-top: -11px;
  border-right-width: 0;
  border-left-color: #999999;
  border-left-color: rgba(0, 0, 0, 0.25);
}
.popover.left > .arrow:after {
  content: " ";
  right: 1px;
  border-right-width: 0;
  border-left-color: #fff;
  bottom: -10px;
}
.carousel {
  position: relative;
}
.carousel-inner {
  position: relative;
  overflow: hidden;
  width: 100%;
}
.carousel-inner > .item {
  display: none;
  position: relative;
  -webkit-transition: 0.6s ease-in-out left;
  -o-transition: 0.6s ease-in-out left;
  transition: 0.6s ease-in-out left;
}
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  line-height: 1;
}
@media all and (transform-3d), (-webkit-transform-3d) {
  .carousel-inner > .item {
    -webkit-transition: -webkit-transform 0.6s ease-in-out;
    -moz-transition: -moz-transform 0.6s ease-in-out;
    -o-transition: -o-transform 0.6s ease-in-out;
    transition: transform 0.6s ease-in-out;
    -webkit-backface-visibility: hidden;
    -moz-backface-visibility: hidden;
    backface-visibility: hidden;
    -webkit-perspective: 1000px;
    -moz-perspective: 1000px;
    perspective: 1000px;
  }
  .carousel-inner > .item.next,
  .carousel-inner > .item.active.right {
    -webkit-transform: translate3d(100%, 0, 0);
    transform: translate3d(100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.prev,
  .carousel-inner > .item.active.left {
    -webkit-transform: translate3d(-100%, 0, 0);
    transform: translate3d(-100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.next.left,
  .carousel-inner > .item.prev.right,
  .carousel-inner > .item.active {
    -webkit-transform: translate3d(0, 0, 0);
    transform: translate3d(0, 0, 0);
    left: 0;
  }
}
.carousel-inner > .active,
.carousel-inner > .next,
.carousel-inner > .prev {
  display: block;
}
.carousel-inner > .active {
  left: 0;
}
.carousel-inner > .next,
.carousel-inner > .prev {
  position: absolute;
  top: 0;
  width: 100%;
}
.carousel-inner > .next {
  left: 100%;
}
.carousel-inner > .prev {
  left: -100%;
}
.carousel-inner > .next.left,
.carousel-inner > .prev.right {
  left: 0;
}
.carousel-inner > .active.left {
  left: -100%;
}
.carousel-inner > .active.right {
  left: 100%;
}
.carousel-control {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  width: 15%;
  opacity: 0.5;
  filter: alpha(opacity=50);
  font-size: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
  background-color: rgba(0, 0, 0, 0);
}
.carousel-control.left {
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);
}
.carousel-control.right {
  left: auto;
  right: 0;
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);
}
.carousel-control:hover,
.carousel-control:focus {
  outline: 0;
  color: #fff;
  text-decoration: none;
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.carousel-control .icon-prev,
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-left,
.carousel-control .glyphicon-chevron-right {
  position: absolute;
  top: 50%;
  margin-top: -10px;
  z-index: 5;
  display: inline-block;
}
.carousel-control .icon-prev,
.carousel-control .glyphicon-chevron-left {
  left: 50%;
  margin-left: -10px;
}
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-right {
  right: 50%;
  margin-right: -10px;
}
.carousel-control .icon-prev,
.carousel-control .icon-next {
  width: 20px;
  height: 20px;
  line-height: 1;
  font-family: serif;
}
.carousel-control .icon-prev:before {
  content: '\2039';
}
.carousel-control .icon-next:before {
  content: '\203a';
}
.carousel-indicators {
  position: absolute;
  bottom: 10px;
  left: 50%;
  z-index: 15;
  width: 60%;
  margin-left: -30%;
  padding-left: 0;
  list-style: none;
  text-align: center;
}
.carousel-indicators li {
  display: inline-block;
  width: 10px;
  height: 10px;
  margin: 1px;
  text-indent: -999px;
  border: 1px solid #fff;
  border-radius: 10px;
  cursor: pointer;
  background-color: #000 \9;
  background-color: rgba(0, 0, 0, 0);
}
.carousel-indicators .active {
  margin: 0;
  width: 12px;
  height: 12px;
  background-color: #fff;
}
.carousel-caption {
  position: absolute;
  left: 15%;
  right: 15%;
  bottom: 20px;
  z-index: 10;
  padding-top: 20px;
  padding-bottom: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
}
.carousel-caption .btn {
  text-shadow: none;
}
@media screen and (min-width: 768px) {
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-prev,
  .carousel-control .icon-next {
    width: 30px;
    height: 30px;
    margin-top: -10px;
    font-size: 30px;
  }
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .icon-prev {
    margin-left: -10px;
  }
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-next {
    margin-right: -10px;
  }
  .carousel-caption {
    left: 20%;
    right: 20%;
    padding-bottom: 30px;
  }
  .carousel-indicators {
    bottom: 20px;
  }
}
.clearfix:before,
.clearfix:after,
.dl-horizontal dd:before,
.dl-horizontal dd:after,
.container:before,
.container:after,
.container-fluid:before,
.container-fluid:after,
.row:before,
.row:after,
.form-horizontal .form-group:before,
.form-horizontal .form-group:after,
.btn-toolbar:before,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:before,
.btn-group-vertical > .btn-group:after,
.nav:before,
.nav:after,
.navbar:before,
.navbar:after,
.navbar-header:before,
.navbar-header:after,
.navbar-collapse:before,
.navbar-collapse:after,
.pager:before,
.pager:after,
.panel-body:before,
.panel-body:after,
.modal-header:before,
.modal-header:after,
.modal-footer:before,
.modal-footer:after,
.item_buttons:before,
.item_buttons:after {
  content: " ";
  display: table;
}
.clearfix:after,
.dl-horizontal dd:after,
.container:after,
.container-fluid:after,
.row:after,
.form-horizontal .form-group:after,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:after,
.nav:after,
.navbar:after,
.navbar-header:after,
.navbar-collapse:after,
.pager:after,
.panel-body:after,
.modal-header:after,
.modal-footer:after,
.item_buttons:after {
  clear: both;
}
.center-block {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.pull-right {
  float: right !important;
}
.pull-left {
  float: left !important;
}
.hide {
  display: none !important;
}
.show {
  display: block !important;
}
.invisible {
  visibility: hidden;
}
.text-hide {
  font: 0/0 a;
  color: transparent;
  text-shadow: none;
  background-color: transparent;
  border: 0;
}
.hidden {
  display: none !important;
}
.affix {
  position: fixed;
}
@-ms-viewport {
  width: device-width;
}
.visible-xs,
.visible-sm,
.visible-md,
.visible-lg {
  display: none !important;
}
.visible-xs-block,
.visible-xs-inline,
.visible-xs-inline-block,
.visible-sm-block,
.visible-sm-inline,
.visible-sm-inline-block,
.visible-md-block,
.visible-md-inline,
.visible-md-inline-block,
.visible-lg-block,
.visible-lg-inline,
.visible-lg-inline-block {
  display: none !important;
}
@media (max-width: 767px) {
  .visible-xs {
    display: block !important;
  }
  table.visible-xs {
    display: table !important;
  }
  tr.visible-xs {
    display: table-row !important;
  }
  th.visible-xs,
  td.visible-xs {
    display: table-cell !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-block {
    display: block !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline {
    display: inline !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm {
    display: block !important;
  }
  table.visible-sm {
    display: table !important;
  }
  tr.visible-sm {
    display: table-row !important;
  }
  th.visible-sm,
  td.visible-sm {
    display: table-cell !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-block {
    display: block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline {
    display: inline !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md {
    display: block !important;
  }
  table.visible-md {
    display: table !important;
  }
  tr.visible-md {
    display: table-row !important;
  }
  th.visible-md,
  td.visible-md {
    display: table-cell !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-block {
    display: block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline {
    display: inline !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg {
    display: block !important;
  }
  table.visible-lg {
    display: table !important;
  }
  tr.visible-lg {
    display: table-row !important;
  }
  th.visible-lg,
  td.visible-lg {
    display: table-cell !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-block {
    display: block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline {
    display: inline !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline-block {
    display: inline-block !important;
  }
}
@media (max-width: 767px) {
  .hidden-xs {
    display: none !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .hidden-sm {
    display: none !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .hidden-md {
    display: none !important;
  }
}
@media (min-width: 1200px) {
  .hidden-lg {
    display: none !important;
  }
}
.visible-print {
  display: none !important;
}
@media print {
  .visible-print {
    display: block !important;
  }
  table.visible-print {
    display: table !important;
  }
  tr.visible-print {
    display: table-row !important;
  }
  th.visible-print,
  td.visible-print {
    display: table-cell !important;
  }
}
.visible-print-block {
  display: none !important;
}
@media print {
  .visible-print-block {
    display: block !important;
  }
}
.visible-print-inline {
  display: none !important;
}
@media print {
  .visible-print-inline {
    display: inline !important;
  }
}
.visible-print-inline-block {
  display: none !important;
}
@media print {
  .visible-print-inline-block {
    display: inline-block !important;
  }
}
@media print {
  .hidden-print {
    display: none !important;
  }
}
/*!
*
* Font Awesome
*
*/
/*!
 *  Font Awesome 4.2.0 by @davegandy - http://fontawesome.io - @fontawesome
 *  License - http://fontawesome.io/license (Font: SIL OFL 1.1, CSS: MIT License)
 */
/* FONT PATH
 * -------------------------- */
@font-face {
  font-family: 'FontAwesome';
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?v=4.2.0');
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?#iefix&v=4.2.0') format('embedded-opentype'), url('../components/font-awesome/fonts/fontawesome-webfont.woff?v=4.2.0') format('woff'), url('../components/font-awesome/fonts/fontawesome-webfont.ttf?v=4.2.0') format('truetype'), url('../components/font-awesome/fonts/fontawesome-webfont.svg?v=4.2.0#fontawesomeregular') format('svg');
  font-weight: normal;
  font-style: normal;
}
.fa {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
/* makes the font 33% larger relative to the icon container */
.fa-lg {
  font-size: 1.33333333em;
  line-height: 0.75em;
  vertical-align: -15%;
}
.fa-2x {
  font-size: 2em;
}
.fa-3x {
  font-size: 3em;
}
.fa-4x {
  font-size: 4em;
}
.fa-5x {
  font-size: 5em;
}
.fa-fw {
  width: 1.28571429em;
  text-align: center;
}
.fa-ul {
  padding-left: 0;
  margin-left: 2.14285714em;
  list-style-type: none;
}
.fa-ul > li {
  position: relative;
}
.fa-li {
  position: absolute;
  left: -2.14285714em;
  width: 2.14285714em;
  top: 0.14285714em;
  text-align: center;
}
.fa-li.fa-lg {
  left: -1.85714286em;
}
.fa-border {
  padding: .2em .25em .15em;
  border: solid 0.08em #eee;
  border-radius: .1em;
}
.pull-right {
  float: right;
}
.pull-left {
  float: left;
}
.fa.pull-left {
  margin-right: .3em;
}
.fa.pull-right {
  margin-left: .3em;
}
.fa-spin {
  -webkit-animation: fa-spin 2s infinite linear;
  animation: fa-spin 2s infinite linear;
}
@-webkit-keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
@keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
.fa-rotate-90 {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=1);
  -webkit-transform: rotate(90deg);
  -ms-transform: rotate(90deg);
  transform: rotate(90deg);
}
.fa-rotate-180 {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=2);
  -webkit-transform: rotate(180deg);
  -ms-transform: rotate(180deg);
  transform: rotate(180deg);
}
.fa-rotate-270 {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);
  -webkit-transform: rotate(270deg);
  -ms-transform: rotate(270deg);
  transform: rotate(270deg);
}
.fa-flip-horizontal {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=0, mirror=1);
  -webkit-transform: scale(-1, 1);
  -ms-transform: scale(-1, 1);
  transform: scale(-1, 1);
}
.fa-flip-vertical {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=2, mirror=1);
  -webkit-transform: scale(1, -1);
  -ms-transform: scale(1, -1);
  transform: scale(1, -1);
}
:root .fa-rotate-90,
:root .fa-rotate-180,
:root .fa-rotate-270,
:root .fa-flip-horizontal,
:root .fa-flip-vertical {
  filter: none;
}
.fa-stack {
  position: relative;
  display: inline-block;
  width: 2em;
  height: 2em;
  line-height: 2em;
  vertical-align: middle;
}
.fa-stack-1x,
.fa-stack-2x {
  position: absolute;
  left: 0;
  width: 100%;
  text-align: center;
}
.fa-stack-1x {
  line-height: inherit;
}
.fa-stack-2x {
  font-size: 2em;
}
.fa-inverse {
  color: #fff;
}
/* Font Awesome uses the Unicode Private Use Area (PUA) to ensure screen
   readers do not read off random characters that represent icons */
.fa-glass:before {
  content: "\f000";
}
.fa-music:before {
  content: "\f001";
}
.fa-search:before {
  content: "\f002";
}
.fa-envelope-o:before {
  content: "\f003";
}
.fa-heart:before {
  content: "\f004";
}
.fa-star:before {
  content: "\f005";
}
.fa-star-o:before {
  content: "\f006";
}
.fa-user:before {
  content: "\f007";
}
.fa-film:before {
  content: "\f008";
}
.fa-th-large:before {
  content: "\f009";
}
.fa-th:before {
  content: "\f00a";
}
.fa-th-list:before {
  content: "\f00b";
}
.fa-check:before {
  content: "\f00c";
}
.fa-remove:before,
.fa-close:before,
.fa-times:before {
  content: "\f00d";
}
.fa-search-plus:before {
  content: "\f00e";
}
.fa-search-minus:before {
  content: "\f010";
}
.fa-power-off:before {
  content: "\f011";
}
.fa-signal:before {
  content: "\f012";
}
.fa-gear:before,
.fa-cog:before {
  content: "\f013";
}
.fa-trash-o:before {
  content: "\f014";
}
.fa-home:before {
  content: "\f015";
}
.fa-file-o:before {
  content: "\f016";
}
.fa-clock-o:before {
  content: "\f017";
}
.fa-road:before {
  content: "\f018";
}
.fa-download:before {
  content: "\f019";
}
.fa-arrow-circle-o-down:before {
  content: "\f01a";
}
.fa-arrow-circle-o-up:before {
  content: "\f01b";
}
.fa-inbox:before {
  content: "\f01c";
}
.fa-play-circle-o:before {
  content: "\f01d";
}
.fa-rotate-right:before,
.fa-repeat:before {
  content: "\f01e";
}
.fa-refresh:before {
  content: "\f021";
}
.fa-list-alt:before {
  content: "\f022";
}
.fa-lock:before {
  content: "\f023";
}
.fa-flag:before {
  content: "\f024";
}
.fa-headphones:before {
  content: "\f025";
}
.fa-volume-off:before {
  content: "\f026";
}
.fa-volume-down:before {
  content: "\f027";
}
.fa-volume-up:before {
  content: "\f028";
}
.fa-qrcode:before {
  content: "\f029";
}
.fa-barcode:before {
  content: "\f02a";
}
.fa-tag:before {
  content: "\f02b";
}
.fa-tags:before {
  content: "\f02c";
}
.fa-book:before {
  content: "\f02d";
}
.fa-bookmark:before {
  content: "\f02e";
}
.fa-print:before {
  content: "\f02f";
}
.fa-camera:before {
  content: "\f030";
}
.fa-font:before {
  content: "\f031";
}
.fa-bold:before {
  content: "\f032";
}
.fa-italic:before {
  content: "\f033";
}
.fa-text-height:before {
  content: "\f034";
}
.fa-text-width:before {
  content: "\f035";
}
.fa-align-left:before {
  content: "\f036";
}
.fa-align-center:before {
  content: "\f037";
}
.fa-align-right:before {
  content: "\f038";
}
.fa-align-justify:before {
  content: "\f039";
}
.fa-list:before {
  content: "\f03a";
}
.fa-dedent:before,
.fa-outdent:before {
  content: "\f03b";
}
.fa-indent:before {
  content: "\f03c";
}
.fa-video-camera:before {
  content: "\f03d";
}
.fa-photo:before,
.fa-image:before,
.fa-picture-o:before {
  content: "\f03e";
}
.fa-pencil:before {
  content: "\f040";
}
.fa-map-marker:before {
  content: "\f041";
}
.fa-adjust:before {
  content: "\f042";
}
.fa-tint:before {
  content: "\f043";
}
.fa-edit:before,
.fa-pencil-square-o:before {
  content: "\f044";
}
.fa-share-square-o:before {
  content: "\f045";
}
.fa-check-square-o:before {
  content: "\f046";
}
.fa-arrows:before {
  content: "\f047";
}
.fa-step-backward:before {
  content: "\f048";
}
.fa-fast-backward:before {
  content: "\f049";
}
.fa-backward:before {
  content: "\f04a";
}
.fa-play:before {
  content: "\f04b";
}
.fa-pause:before {
  content: "\f04c";
}
.fa-stop:before {
  content: "\f04d";
}
.fa-forward:before {
  content: "\f04e";
}
.fa-fast-forward:before {
  content: "\f050";
}
.fa-step-forward:before {
  content: "\f051";
}
.fa-eject:before {
  content: "\f052";
}
.fa-chevron-left:before {
  content: "\f053";
}
.fa-chevron-right:before {
  content: "\f054";
}
.fa-plus-circle:before {
  content: "\f055";
}
.fa-minus-circle:before {
  content: "\f056";
}
.fa-times-circle:before {
  content: "\f057";
}
.fa-check-circle:before {
  content: "\f058";
}
.fa-question-circle:before {
  content: "\f059";
}
.fa-info-circle:before {
  content: "\f05a";
}
.fa-crosshairs:before {
  content: "\f05b";
}
.fa-times-circle-o:before {
  content: "\f05c";
}
.fa-check-circle-o:before {
  content: "\f05d";
}
.fa-ban:before {
  content: "\f05e";
}
.fa-arrow-left:before {
  content: "\f060";
}
.fa-arrow-right:before {
  content: "\f061";
}
.fa-arrow-up:before {
  content: "\f062";
}
.fa-arrow-down:before {
  content: "\f063";
}
.fa-mail-forward:before,
.fa-share:before {
  content: "\f064";
}
.fa-expand:before {
  content: "\f065";
}
.fa-compress:before {
  content: "\f066";
}
.fa-plus:before {
  content: "\f067";
}
.fa-minus:before {
  content: "\f068";
}
.fa-asterisk:before {
  content: "\f069";
}
.fa-exclamation-circle:before {
  content: "\f06a";
}
.fa-gift:before {
  content: "\f06b";
}
.fa-leaf:before {
  content: "\f06c";
}
.fa-fire:before {
  content: "\f06d";
}
.fa-eye:before {
  content: "\f06e";
}
.fa-eye-slash:before {
  content: "\f070";
}
.fa-warning:before,
.fa-exclamation-triangle:before {
  content: "\f071";
}
.fa-plane:before {
  content: "\f072";
}
.fa-calendar:before {
  content: "\f073";
}
.fa-random:before {
  content: "\f074";
}
.fa-comment:before {
  content: "\f075";
}
.fa-magnet:before {
  content: "\f076";
}
.fa-chevron-up:before {
  content: "\f077";
}
.fa-chevron-down:before {
  content: "\f078";
}
.fa-retweet:before {
  content: "\f079";
}
.fa-shopping-cart:before {
  content: "\f07a";
}
.fa-folder:before {
  content: "\f07b";
}
.fa-folder-open:before {
  content: "\f07c";
}
.fa-arrows-v:before {
  content: "\f07d";
}
.fa-arrows-h:before {
  content: "\f07e";
}
.fa-bar-chart-o:before,
.fa-bar-chart:before {
  content: "\f080";
}
.fa-twitter-square:before {
  content: "\f081";
}
.fa-facebook-square:before {
  content: "\f082";
}
.fa-camera-retro:before {
  content: "\f083";
}
.fa-key:before {
  content: "\f084";
}
.fa-gears:before,
.fa-cogs:before {
  content: "\f085";
}
.fa-comments:before {
  content: "\f086";
}
.fa-thumbs-o-up:before {
  content: "\f087";
}
.fa-thumbs-o-down:before {
  content: "\f088";
}
.fa-star-half:before {
  content: "\f089";
}
.fa-heart-o:before {
  content: "\f08a";
}
.fa-sign-out:before {
  content: "\f08b";
}
.fa-linkedin-square:before {
  content: "\f08c";
}
.fa-thumb-tack:before {
  content: "\f08d";
}
.fa-external-link:before {
  content: "\f08e";
}
.fa-sign-in:before {
  content: "\f090";
}
.fa-trophy:before {
  content: "\f091";
}
.fa-github-square:before {
  content: "\f092";
}
.fa-upload:before {
  content: "\f093";
}
.fa-lemon-o:before {
  content: "\f094";
}
.fa-phone:before {
  content: "\f095";
}
.fa-square-o:before {
  content: "\f096";
}
.fa-bookmark-o:before {
  content: "\f097";
}
.fa-phone-square:before {
  content: "\f098";
}
.fa-twitter:before {
  content: "\f099";
}
.fa-facebook:before {
  content: "\f09a";
}
.fa-github:before {
  content: "\f09b";
}
.fa-unlock:before {
  content: "\f09c";
}
.fa-credit-card:before {
  content: "\f09d";
}
.fa-rss:before {
  content: "\f09e";
}
.fa-hdd-o:before {
  content: "\f0a0";
}
.fa-bullhorn:before {
  content: "\f0a1";
}
.fa-bell:before {
  content: "\f0f3";
}
.fa-certificate:before {
  content: "\f0a3";
}
.fa-hand-o-right:before {
  content: "\f0a4";
}
.fa-hand-o-left:before {
  content: "\f0a5";
}
.fa-hand-o-up:before {
  content: "\f0a6";
}
.fa-hand-o-down:before {
  content: "\f0a7";
}
.fa-arrow-circle-left:before {
  content: "\f0a8";
}
.fa-arrow-circle-right:before {
  content: "\f0a9";
}
.fa-arrow-circle-up:before {
  content: "\f0aa";
}
.fa-arrow-circle-down:before {
  content: "\f0ab";
}
.fa-globe:before {
  content: "\f0ac";
}
.fa-wrench:before {
  content: "\f0ad";
}
.fa-tasks:before {
  content: "\f0ae";
}
.fa-filter:before {
  content: "\f0b0";
}
.fa-briefcase:before {
  content: "\f0b1";
}
.fa-arrows-alt:before {
  content: "\f0b2";
}
.fa-group:before,
.fa-users:before {
  content: "\f0c0";
}
.fa-chain:before,
.fa-link:before {
  content: "\f0c1";
}
.fa-cloud:before {
  content: "\f0c2";
}
.fa-flask:before {
  content: "\f0c3";
}
.fa-cut:before,
.fa-scissors:before {
  content: "\f0c4";
}
.fa-copy:before,
.fa-files-o:before {
  content: "\f0c5";
}
.fa-paperclip:before {
  content: "\f0c6";
}
.fa-save:before,
.fa-floppy-o:before {
  content: "\f0c7";
}
.fa-square:before {
  content: "\f0c8";
}
.fa-navicon:before,
.fa-reorder:before,
.fa-bars:before {
  content: "\f0c9";
}
.fa-list-ul:before {
  content: "\f0ca";
}
.fa-list-ol:before {
  content: "\f0cb";
}
.fa-strikethrough:before {
  content: "\f0cc";
}
.fa-underline:before {
  content: "\f0cd";
}
.fa-table:before {
  content: "\f0ce";
}
.fa-magic:before {
  content: "\f0d0";
}
.fa-truck:before {
  content: "\f0d1";
}
.fa-pinterest:before {
  content: "\f0d2";
}
.fa-pinterest-square:before {
  content: "\f0d3";
}
.fa-google-plus-square:before {
  content: "\f0d4";
}
.fa-google-plus:before {
  content: "\f0d5";
}
.fa-money:before {
  content: "\f0d6";
}
.fa-caret-down:before {
  content: "\f0d7";
}
.fa-caret-up:before {
  content: "\f0d8";
}
.fa-caret-left:before {
  content: "\f0d9";
}
.fa-caret-right:before {
  content: "\f0da";
}
.fa-columns:before {
  content: "\f0db";
}
.fa-unsorted:before,
.fa-sort:before {
  content: "\f0dc";
}
.fa-sort-down:before,
.fa-sort-desc:before {
  content: "\f0dd";
}
.fa-sort-up:before,
.fa-sort-asc:before {
  content: "\f0de";
}
.fa-envelope:before {
  content: "\f0e0";
}
.fa-linkedin:before {
  content: "\f0e1";
}
.fa-rotate-left:before,
.fa-undo:before {
  content: "\f0e2";
}
.fa-legal:before,
.fa-gavel:before {
  content: "\f0e3";
}
.fa-dashboard:before,
.fa-tachometer:before {
  content: "\f0e4";
}
.fa-comment-o:before {
  content: "\f0e5";
}
.fa-comments-o:before {
  content: "\f0e6";
}
.fa-flash:before,
.fa-bolt:before {
  content: "\f0e7";
}
.fa-sitemap:before {
  content: "\f0e8";
}
.fa-umbrella:before {
  content: "\f0e9";
}
.fa-paste:before,
.fa-clipboard:before {
  content: "\f0ea";
}
.fa-lightbulb-o:before {
  content: "\f0eb";
}
.fa-exchange:before {
  content: "\f0ec";
}
.fa-cloud-download:before {
  content: "\f0ed";
}
.fa-cloud-upload:before {
  content: "\f0ee";
}
.fa-user-md:before {
  content: "\f0f0";
}
.fa-stethoscope:before {
  content: "\f0f1";
}
.fa-suitcase:before {
  content: "\f0f2";
}
.fa-bell-o:before {
  content: "\f0a2";
}
.fa-coffee:before {
  content: "\f0f4";
}
.fa-cutlery:before {
  content: "\f0f5";
}
.fa-file-text-o:before {
  content: "\f0f6";
}
.fa-building-o:before {
  content: "\f0f7";
}
.fa-hospital-o:before {
  content: "\f0f8";
}
.fa-ambulance:before {
  content: "\f0f9";
}
.fa-medkit:before {
  content: "\f0fa";
}
.fa-fighter-jet:before {
  content: "\f0fb";
}
.fa-beer:before {
  content: "\f0fc";
}
.fa-h-square:before {
  content: "\f0fd";
}
.fa-plus-square:before {
  content: "\f0fe";
}
.fa-angle-double-left:before {
  content: "\f100";
}
.fa-angle-double-right:before {
  content: "\f101";
}
.fa-angle-double-up:before {
  content: "\f102";
}
.fa-angle-double-down:before {
  content: "\f103";
}
.fa-angle-left:before {
  content: "\f104";
}
.fa-angle-right:before {
  content: "\f105";
}
.fa-angle-up:before {
  content: "\f106";
}
.fa-angle-down:before {
  content: "\f107";
}
.fa-desktop:before {
  content: "\f108";
}
.fa-laptop:before {
  content: "\f109";
}
.fa-tablet:before {
  content: "\f10a";
}
.fa-mobile-phone:before,
.fa-mobile:before {
  content: "\f10b";
}
.fa-circle-o:before {
  content: "\f10c";
}
.fa-quote-left:before {
  content: "\f10d";
}
.fa-quote-right:before {
  content: "\f10e";
}
.fa-spinner:before {
  content: "\f110";
}
.fa-circle:before {
  content: "\f111";
}
.fa-mail-reply:before,
.fa-reply:before {
  content: "\f112";
}
.fa-github-alt:before {
  content: "\f113";
}
.fa-folder-o:before {
  content: "\f114";
}
.fa-folder-open-o:before {
  content: "\f115";
}
.fa-smile-o:before {
  content: "\f118";
}
.fa-frown-o:before {
  content: "\f119";
}
.fa-meh-o:before {
  content: "\f11a";
}
.fa-gamepad:before {
  content: "\f11b";
}
.fa-keyboard-o:before {
  content: "\f11c";
}
.fa-flag-o:before {
  content: "\f11d";
}
.fa-flag-checkered:before {
  content: "\f11e";
}
.fa-terminal:before {
  content: "\f120";
}
.fa-code:before {
  content: "\f121";
}
.fa-mail-reply-all:before,
.fa-reply-all:before {
  content: "\f122";
}
.fa-star-half-empty:before,
.fa-star-half-full:before,
.fa-star-half-o:before {
  content: "\f123";
}
.fa-location-arrow:before {
  content: "\f124";
}
.fa-crop:before {
  content: "\f125";
}
.fa-code-fork:before {
  content: "\f126";
}
.fa-unlink:before,
.fa-chain-broken:before {
  content: "\f127";
}
.fa-question:before {
  content: "\f128";
}
.fa-info:before {
  content: "\f129";
}
.fa-exclamation:before {
  content: "\f12a";
}
.fa-superscript:before {
  content: "\f12b";
}
.fa-subscript:before {
  content: "\f12c";
}
.fa-eraser:before {
  content: "\f12d";
}
.fa-puzzle-piece:before {
  content: "\f12e";
}
.fa-microphone:before {
  content: "\f130";
}
.fa-microphone-slash:before {
  content: "\f131";
}
.fa-shield:before {
  content: "\f132";
}
.fa-calendar-o:before {
  content: "\f133";
}
.fa-fire-extinguisher:before {
  content: "\f134";
}
.fa-rocket:before {
  content: "\f135";
}
.fa-maxcdn:before {
  content: "\f136";
}
.fa-chevron-circle-left:before {
  content: "\f137";
}
.fa-chevron-circle-right:before {
  content: "\f138";
}
.fa-chevron-circle-up:before {
  content: "\f139";
}
.fa-chevron-circle-down:before {
  content: "\f13a";
}
.fa-html5:before {
  content: "\f13b";
}
.fa-css3:before {
  content: "\f13c";
}
.fa-anchor:before {
  content: "\f13d";
}
.fa-unlock-alt:before {
  content: "\f13e";
}
.fa-bullseye:before {
  content: "\f140";
}
.fa-ellipsis-h:before {
  content: "\f141";
}
.fa-ellipsis-v:before {
  content: "\f142";
}
.fa-rss-square:before {
  content: "\f143";
}
.fa-play-circle:before {
  content: "\f144";
}
.fa-ticket:before {
  content: "\f145";
}
.fa-minus-square:before {
  content: "\f146";
}
.fa-minus-square-o:before {
  content: "\f147";
}
.fa-level-up:before {
  content: "\f148";
}
.fa-level-down:before {
  content: "\f149";
}
.fa-check-square:before {
  content: "\f14a";
}
.fa-pencil-square:before {
  content: "\f14b";
}
.fa-external-link-square:before {
  content: "\f14c";
}
.fa-share-square:before {
  content: "\f14d";
}
.fa-compass:before {
  content: "\f14e";
}
.fa-toggle-down:before,
.fa-caret-square-o-down:before {
  content: "\f150";
}
.fa-toggle-up:before,
.fa-caret-square-o-up:before {
  content: "\f151";
}
.fa-toggle-right:before,
.fa-caret-square-o-right:before {
  content: "\f152";
}
.fa-euro:before,
.fa-eur:before {
  content: "\f153";
}
.fa-gbp:before {
  content: "\f154";
}
.fa-dollar:before,
.fa-usd:before {
  content: "\f155";
}
.fa-rupee:before,
.fa-inr:before {
  content: "\f156";
}
.fa-cny:before,
.fa-rmb:before,
.fa-yen:before,
.fa-jpy:before {
  content: "\f157";
}
.fa-ruble:before,
.fa-rouble:before,
.fa-rub:before {
  content: "\f158";
}
.fa-won:before,
.fa-krw:before {
  content: "\f159";
}
.fa-bitcoin:before,
.fa-btc:before {
  content: "\f15a";
}
.fa-file:before {
  content: "\f15b";
}
.fa-file-text:before {
  content: "\f15c";
}
.fa-sort-alpha-asc:before {
  content: "\f15d";
}
.fa-sort-alpha-desc:before {
  content: "\f15e";
}
.fa-sort-amount-asc:before {
  content: "\f160";
}
.fa-sort-amount-desc:before {
  content: "\f161";
}
.fa-sort-numeric-asc:before {
  content: "\f162";
}
.fa-sort-numeric-desc:before {
  content: "\f163";
}
.fa-thumbs-up:before {
  content: "\f164";
}
.fa-thumbs-down:before {
  content: "\f165";
}
.fa-youtube-square:before {
  content: "\f166";
}
.fa-youtube:before {
  content: "\f167";
}
.fa-xing:before {
  content: "\f168";
}
.fa-xing-square:before {
  content: "\f169";
}
.fa-youtube-play:before {
  content: "\f16a";
}
.fa-dropbox:before {
  content: "\f16b";
}
.fa-stack-overflow:before {
  content: "\f16c";
}
.fa-instagram:before {
  content: "\f16d";
}
.fa-flickr:before {
  content: "\f16e";
}
.fa-adn:before {
  content: "\f170";
}
.fa-bitbucket:before {
  content: "\f171";
}
.fa-bitbucket-square:before {
  content: "\f172";
}
.fa-tumblr:before {
  content: "\f173";
}
.fa-tumblr-square:before {
  content: "\f174";
}
.fa-long-arrow-down:before {
  content: "\f175";
}
.fa-long-arrow-up:before {
  content: "\f176";
}
.fa-long-arrow-left:before {
  content: "\f177";
}
.fa-long-arrow-right:before {
  content: "\f178";
}
.fa-apple:before {
  content: "\f179";
}
.fa-windows:before {
  content: "\f17a";
}
.fa-android:before {
  content: "\f17b";
}
.fa-linux:before {
  content: "\f17c";
}
.fa-dribbble:before {
  content: "\f17d";
}
.fa-skype:before {
  content: "\f17e";
}
.fa-foursquare:before {
  content: "\f180";
}
.fa-trello:before {
  content: "\f181";
}
.fa-female:before {
  content: "\f182";
}
.fa-male:before {
  content: "\f183";
}
.fa-gittip:before {
  content: "\f184";
}
.fa-sun-o:before {
  content: "\f185";
}
.fa-moon-o:before {
  content: "\f186";
}
.fa-archive:before {
  content: "\f187";
}
.fa-bug:before {
  content: "\f188";
}
.fa-vk:before {
  content: "\f189";
}
.fa-weibo:before {
  content: "\f18a";
}
.fa-renren:before {
  content: "\f18b";
}
.fa-pagelines:before {
  content: "\f18c";
}
.fa-stack-exchange:before {
  content: "\f18d";
}
.fa-arrow-circle-o-right:before {
  content: "\f18e";
}
.fa-arrow-circle-o-left:before {
  content: "\f190";
}
.fa-toggle-left:before,
.fa-caret-square-o-left:before {
  content: "\f191";
}
.fa-dot-circle-o:before {
  content: "\f192";
}
.fa-wheelchair:before {
  content: "\f193";
}
.fa-vimeo-square:before {
  content: "\f194";
}
.fa-turkish-lira:before,
.fa-try:before {
  content: "\f195";
}
.fa-plus-square-o:before {
  content: "\f196";
}
.fa-space-shuttle:before {
  content: "\f197";
}
.fa-slack:before {
  content: "\f198";
}
.fa-envelope-square:before {
  content: "\f199";
}
.fa-wordpress:before {
  content: "\f19a";
}
.fa-openid:before {
  content: "\f19b";
}
.fa-institution:before,
.fa-bank:before,
.fa-university:before {
  content: "\f19c";
}
.fa-mortar-board:before,
.fa-graduation-cap:before {
  content: "\f19d";
}
.fa-yahoo:before {
  content: "\f19e";
}
.fa-google:before {
  content: "\f1a0";
}
.fa-reddit:before {
  content: "\f1a1";
}
.fa-reddit-square:before {
  content: "\f1a2";
}
.fa-stumbleupon-circle:before {
  content: "\f1a3";
}
.fa-stumbleupon:before {
  content: "\f1a4";
}
.fa-delicious:before {
  content: "\f1a5";
}
.fa-digg:before {
  content: "\f1a6";
}
.fa-pied-piper:before {
  content: "\f1a7";
}
.fa-pied-piper-alt:before {
  content: "\f1a8";
}
.fa-drupal:before {
  content: "\f1a9";
}
.fa-joomla:before {
  content: "\f1aa";
}
.fa-language:before {
  content: "\f1ab";
}
.fa-fax:before {
  content: "\f1ac";
}
.fa-building:before {
  content: "\f1ad";
}
.fa-child:before {
  content: "\f1ae";
}
.fa-paw:before {
  content: "\f1b0";
}
.fa-spoon:before {
  content: "\f1b1";
}
.fa-cube:before {
  content: "\f1b2";
}
.fa-cubes:before {
  content: "\f1b3";
}
.fa-behance:before {
  content: "\f1b4";
}
.fa-behance-square:before {
  content: "\f1b5";
}
.fa-steam:before {
  content: "\f1b6";
}
.fa-steam-square:before {
  content: "\f1b7";
}
.fa-recycle:before {
  content: "\f1b8";
}
.fa-automobile:before,
.fa-car:before {
  content: "\f1b9";
}
.fa-cab:before,
.fa-taxi:before {
  content: "\f1ba";
}
.fa-tree:before {
  content: "\f1bb";
}
.fa-spotify:before {
  content: "\f1bc";
}
.fa-deviantart:before {
  content: "\f1bd";
}
.fa-soundcloud:before {
  content: "\f1be";
}
.fa-database:before {
  content: "\f1c0";
}
.fa-file-pdf-o:before {
  content: "\f1c1";
}
.fa-file-word-o:before {
  content: "\f1c2";
}
.fa-file-excel-o:before {
  content: "\f1c3";
}
.fa-file-powerpoint-o:before {
  content: "\f1c4";
}
.fa-file-photo-o:before,
.fa-file-picture-o:before,
.fa-file-image-o:before {
  content: "\f1c5";
}
.fa-file-zip-o:before,
.fa-file-archive-o:before {
  content: "\f1c6";
}
.fa-file-sound-o:before,
.fa-file-audio-o:before {
  content: "\f1c7";
}
.fa-file-movie-o:before,
.fa-file-video-o:before {
  content: "\f1c8";
}
.fa-file-code-o:before {
  content: "\f1c9";
}
.fa-vine:before {
  content: "\f1ca";
}
.fa-codepen:before {
  content: "\f1cb";
}
.fa-jsfiddle:before {
  content: "\f1cc";
}
.fa-life-bouy:before,
.fa-life-buoy:before,
.fa-life-saver:before,
.fa-support:before,
.fa-life-ring:before {
  content: "\f1cd";
}
.fa-circle-o-notch:before {
  content: "\f1ce";
}
.fa-ra:before,
.fa-rebel:before {
  content: "\f1d0";
}
.fa-ge:before,
.fa-empire:before {
  content: "\f1d1";
}
.fa-git-square:before {
  content: "\f1d2";
}
.fa-git:before {
  content: "\f1d3";
}
.fa-hacker-news:before {
  content: "\f1d4";
}
.fa-tencent-weibo:before {
  content: "\f1d5";
}
.fa-qq:before {
  content: "\f1d6";
}
.fa-wechat:before,
.fa-weixin:before {
  content: "\f1d7";
}
.fa-send:before,
.fa-paper-plane:before {
  content: "\f1d8";
}
.fa-send-o:before,
.fa-paper-plane-o:before {
  content: "\f1d9";
}
.fa-history:before {
  content: "\f1da";
}
.fa-circle-thin:before {
  content: "\f1db";
}
.fa-header:before {
  content: "\f1dc";
}
.fa-paragraph:before {
  content: "\f1dd";
}
.fa-sliders:before {
  content: "\f1de";
}
.fa-share-alt:before {
  content: "\f1e0";
}
.fa-share-alt-square:before {
  content: "\f1e1";
}
.fa-bomb:before {
  content: "\f1e2";
}
.fa-soccer-ball-o:before,
.fa-futbol-o:before {
  content: "\f1e3";
}
.fa-tty:before {
  content: "\f1e4";
}
.fa-binoculars:before {
  content: "\f1e5";
}
.fa-plug:before {
  content: "\f1e6";
}
.fa-slideshare:before {
  content: "\f1e7";
}
.fa-twitch:before {
  content: "\f1e8";
}
.fa-yelp:before {
  content: "\f1e9";
}
.fa-newspaper-o:before {
  content: "\f1ea";
}
.fa-wifi:before {
  content: "\f1eb";
}
.fa-calculator:before {
  content: "\f1ec";
}
.fa-paypal:before {
  content: "\f1ed";
}
.fa-google-wallet:before {
  content: "\f1ee";
}
.fa-cc-visa:before {
  content: "\f1f0";
}
.fa-cc-mastercard:before {
  content: "\f1f1";
}
.fa-cc-discover:before {
  content: "\f1f2";
}
.fa-cc-amex:before {
  content: "\f1f3";
}
.fa-cc-paypal:before {
  content: "\f1f4";
}
.fa-cc-stripe:before {
  content: "\f1f5";
}
.fa-bell-slash:before {
  content: "\f1f6";
}
.fa-bell-slash-o:before {
  content: "\f1f7";
}
.fa-trash:before {
  content: "\f1f8";
}
.fa-copyright:before {
  content: "\f1f9";
}
.fa-at:before {
  content: "\f1fa";
}
.fa-eyedropper:before {
  content: "\f1fb";
}
.fa-paint-brush:before {
  content: "\f1fc";
}
.fa-birthday-cake:before {
  content: "\f1fd";
}
.fa-area-chart:before {
  content: "\f1fe";
}
.fa-pie-chart:before {
  content: "\f200";
}
.fa-line-chart:before {
  content: "\f201";
}
.fa-lastfm:before {
  content: "\f202";
}
.fa-lastfm-square:before {
  content: "\f203";
}
.fa-toggle-off:before {
  content: "\f204";
}
.fa-toggle-on:before {
  content: "\f205";
}
.fa-bicycle:before {
  content: "\f206";
}
.fa-bus:before {
  content: "\f207";
}
.fa-ioxhost:before {
  content: "\f208";
}
.fa-angellist:before {
  content: "\f209";
}
.fa-cc:before {
  content: "\f20a";
}
.fa-shekel:before,
.fa-sheqel:before,
.fa-ils:before {
  content: "\f20b";
}
.fa-meanpath:before {
  content: "\f20c";
}
/*!
*
* IPython base
*
*/
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
code {
  color: #000;
}
pre {
  font-size: inherit;
  line-height: inherit;
}
label {
  font-weight: normal;
}
/* Make the page background atleast 100% the height of the view port */
/* Make the page itself atleast 70% the height of the view port */
.border-box-sizing {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.corner-all {
  border-radius: 2px;
}
.no-padding {
  padding: 0px;
}
/* Flexible box model classes */
/* Taken from Alex Russell http://infrequently.org/2009/08/css-3-progress/ */
/* This file is a compatability layer.  It allows the usage of flexible box 
model layouts accross multiple browsers, including older browsers.  The newest,
universal implementation of the flexible box model is used when available (see
`Modern browsers` comments below).  Browsers that are known to implement this 
new spec completely include:

    Firefox 28.0+
    Chrome 29.0+
    Internet Explorer 11+ 
    Opera 17.0+

Browsers not listed, including Safari, are supported via the styling under the
`Old browsers` comments below.
*/
.hbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
.hbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.vbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
.vbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.hbox.reverse,
.vbox.reverse,
.reverse {
  /* Old browsers */
  -webkit-box-direction: reverse;
  -moz-box-direction: reverse;
  box-direction: reverse;
  /* Modern browsers */
  flex-direction: row-reverse;
}
.hbox.box-flex0,
.vbox.box-flex0,
.box-flex0 {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
  width: auto;
}
.hbox.box-flex1,
.vbox.box-flex1,
.box-flex1 {
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex,
.vbox.box-flex,
.box-flex {
  /* Old browsers */
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex2,
.vbox.box-flex2,
.box-flex2 {
  /* Old browsers */
  -webkit-box-flex: 2;
  -moz-box-flex: 2;
  box-flex: 2;
  /* Modern browsers */
  flex: 2;
}
.box-group1 {
  /*  Deprecated */
  -webkit-box-flex-group: 1;
  -moz-box-flex-group: 1;
  box-flex-group: 1;
}
.box-group2 {
  /* Deprecated */
  -webkit-box-flex-group: 2;
  -moz-box-flex-group: 2;
  box-flex-group: 2;
}
.hbox.start,
.vbox.start,
.start {
  /* Old browsers */
  -webkit-box-pack: start;
  -moz-box-pack: start;
  box-pack: start;
  /* Modern browsers */
  justify-content: flex-start;
}
.hbox.end,
.vbox.end,
.end {
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
}
.hbox.center,
.vbox.center,
.center {
  /* Old browsers */
  -webkit-box-pack: center;
  -moz-box-pack: center;
  box-pack: center;
  /* Modern browsers */
  justify-content: center;
}
.hbox.baseline,
.vbox.baseline,
.baseline {
  /* Old browsers */
  -webkit-box-pack: baseline;
  -moz-box-pack: baseline;
  box-pack: baseline;
  /* Modern browsers */
  justify-content: baseline;
}
.hbox.stretch,
.vbox.stretch,
.stretch {
  /* Old browsers */
  -webkit-box-pack: stretch;
  -moz-box-pack: stretch;
  box-pack: stretch;
  /* Modern browsers */
  justify-content: stretch;
}
.hbox.align-start,
.vbox.align-start,
.align-start {
  /* Old browsers */
  -webkit-box-align: start;
  -moz-box-align: start;
  box-align: start;
  /* Modern browsers */
  align-items: flex-start;
}
.hbox.align-end,
.vbox.align-end,
.align-end {
  /* Old browsers */
  -webkit-box-align: end;
  -moz-box-align: end;
  box-align: end;
  /* Modern browsers */
  align-items: flex-end;
}
.hbox.align-center,
.vbox.align-center,
.align-center {
  /* Old browsers */
  -webkit-box-align: center;
  -moz-box-align: center;
  box-align: center;
  /* Modern browsers */
  align-items: center;
}
.hbox.align-baseline,
.vbox.align-baseline,
.align-baseline {
  /* Old browsers */
  -webkit-box-align: baseline;
  -moz-box-align: baseline;
  box-align: baseline;
  /* Modern browsers */
  align-items: baseline;
}
.hbox.align-stretch,
.vbox.align-stretch,
.align-stretch {
  /* Old browsers */
  -webkit-box-align: stretch;
  -moz-box-align: stretch;
  box-align: stretch;
  /* Modern browsers */
  align-items: stretch;
}
div.error {
  margin: 2em;
  text-align: center;
}
div.error > h1 {
  font-size: 500%;
  line-height: normal;
}
div.error > p {
  font-size: 200%;
  line-height: normal;
}
div.traceback-wrapper {
  text-align: left;
  max-width: 800px;
  margin: auto;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
body {
  background-color: #fff;
  /* This makes sure that the body covers the entire window and needs to
       be in a different element than the display: box in wrapper below */
  position: absolute;
  left: 0px;
  right: 0px;
  top: 0px;
  bottom: 0px;
  overflow: visible;
}
body > #header {
  /* Initially hidden to prevent FLOUC */
  display: none;
  background-color: #fff;
  /* Display over codemirror */
  position: relative;
  z-index: 100;
}
body > #header #header-container {
  padding-bottom: 5px;
  padding-top: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
body > #header .header-bar {
  width: 100%;
  height: 1px;
  background: #e7e7e7;
  margin-bottom: -1px;
}
@media print {
  body > #header {
    display: none !important;
  }
}
#header-spacer {
  width: 100%;
  visibility: hidden;
}
@media print {
  #header-spacer {
    display: none;
  }
}
#ipython_notebook {
  padding-left: 0px;
  padding-top: 1px;
  padding-bottom: 1px;
}
@media (max-width: 991px) {
  #ipython_notebook {
    margin-left: 10px;
  }
}
#noscript {
  width: auto;
  padding-top: 16px;
  padding-bottom: 16px;
  text-align: center;
  font-size: 22px;
  color: red;
  font-weight: bold;
}
#ipython_notebook img {
  height: 28px;
}
#site {
  width: 100%;
  display: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  overflow: auto;
}
@media print {
  #site {
    height: auto !important;
  }
}
/* Smaller buttons */
.ui-button .ui-button-text {
  padding: 0.2em 0.8em;
  font-size: 77%;
}
input.ui-button {
  padding: 0.3em 0.9em;
}
span#login_widget {
  float: right;
}
span#login_widget > .button,
#logout {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button:focus,
#logout:focus,
span#login_widget > .button.focus,
#logout.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
span#login_widget > .button:hover,
#logout:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active:hover,
#logout:active:hover,
span#login_widget > .button.active:hover,
#logout.active:hover,
.open > .dropdown-togglespan#login_widget > .button:hover,
.open > .dropdown-toggle#logout:hover,
span#login_widget > .button:active:focus,
#logout:active:focus,
span#login_widget > .button.active:focus,
#logout.active:focus,
.open > .dropdown-togglespan#login_widget > .button:focus,
.open > .dropdown-toggle#logout:focus,
span#login_widget > .button:active.focus,
#logout:active.focus,
span#login_widget > .button.active.focus,
#logout.active.focus,
.open > .dropdown-togglespan#login_widget > .button.focus,
.open > .dropdown-toggle#logout.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  background-image: none;
}
span#login_widget > .button.disabled:hover,
#logout.disabled:hover,
span#login_widget > .button[disabled]:hover,
#logout[disabled]:hover,
fieldset[disabled] span#login_widget > .button:hover,
fieldset[disabled] #logout:hover,
span#login_widget > .button.disabled:focus,
#logout.disabled:focus,
span#login_widget > .button[disabled]:focus,
#logout[disabled]:focus,
fieldset[disabled] span#login_widget > .button:focus,
fieldset[disabled] #logout:focus,
span#login_widget > .button.disabled.focus,
#logout.disabled.focus,
span#login_widget > .button[disabled].focus,
#logout[disabled].focus,
fieldset[disabled] span#login_widget > .button.focus,
fieldset[disabled] #logout.focus {
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button .badge,
#logout .badge {
  color: #fff;
  background-color: #333;
}
.nav-header {
  text-transform: none;
}
#header > span {
  margin-top: 10px;
}
.modal_stretch .modal-dialog {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  min-height: 80vh;
}
.modal_stretch .modal-dialog .modal-body {
  max-height: calc(100vh - 200px);
  overflow: auto;
  flex: 1;
}
@media (min-width: 768px) {
  .modal .modal-dialog {
    width: 700px;
  }
}
@media (min-width: 768px) {
  select.form-control {
    margin-left: 12px;
    margin-right: 12px;
  }
}
/*!
*
* IPython auth
*
*/
.center-nav {
  display: inline-block;
  margin-bottom: -4px;
}
/*!
*
* IPython tree view
*
*/
/* We need an invisible input field on top of the sentense*/
/* "Drag file onto the list ..." */
.alternate_upload {
  background-color: none;
  display: inline;
}
.alternate_upload.form {
  padding: 0;
  margin: 0;
}
.alternate_upload input.fileinput {
  text-align: center;
  vertical-align: middle;
  display: inline;
  opacity: 0;
  z-index: 2;
  width: 12ex;
  margin-right: -12ex;
}
.alternate_upload .btn-upload {
  height: 22px;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
ul#tabs {
  margin-bottom: 4px;
}
ul#tabs a {
  padding-top: 6px;
  padding-bottom: 4px;
}
ul.breadcrumb a:focus,
ul.breadcrumb a:hover {
  text-decoration: none;
}
ul.breadcrumb i.icon-home {
  font-size: 16px;
  margin-right: 4px;
}
ul.breadcrumb span {
  color: #5e5e5e;
}
.list_toolbar {
  padding: 4px 0 4px 0;
  vertical-align: middle;
}
.list_toolbar .tree-buttons {
  padding-top: 1px;
}
.dynamic-buttons {
  padding-top: 3px;
  display: inline-block;
}
.list_toolbar [class*="span"] {
  min-height: 24px;
}
.list_header {
  font-weight: bold;
  background-color: #EEE;
}
.list_placeholder {
  font-weight: bold;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
}
.list_container {
  margin-top: 4px;
  margin-bottom: 20px;
  border: 1px solid #ddd;
  border-radius: 2px;
}
.list_container > div {
  border-bottom: 1px solid #ddd;
}
.list_container > div:hover .list-item {
  background-color: red;
}
.list_container > div:last-child {
  border: none;
}
.list_item:hover .list_item {
  background-color: #ddd;
}
.list_item a {
  text-decoration: none;
}
.list_item:hover {
  background-color: #fafafa;
}
.list_header > div,
.list_item > div {
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
.list_header > div input,
.list_item > div input {
  margin-right: 7px;
  margin-left: 14px;
  vertical-align: baseline;
  line-height: 22px;
  position: relative;
  top: -1px;
}
.list_header > div .item_link,
.list_item > div .item_link {
  margin-left: -1px;
  vertical-align: baseline;
  line-height: 22px;
}
.new-file input[type=checkbox] {
  visibility: hidden;
}
.item_name {
  line-height: 22px;
  height: 24px;
}
.item_icon {
  font-size: 14px;
  color: #5e5e5e;
  margin-right: 7px;
  margin-left: 7px;
  line-height: 22px;
  vertical-align: baseline;
}
.item_buttons {
  line-height: 1em;
  margin-left: -5px;
}
.item_buttons .btn,
.item_buttons .btn-group,
.item_buttons .input-group {
  float: left;
}
.item_buttons > .btn,
.item_buttons > .btn-group,
.item_buttons > .input-group {
  margin-left: 5px;
}
.item_buttons .btn {
  min-width: 13ex;
}
.item_buttons .running-indicator {
  padding-top: 4px;
  color: #5cb85c;
}
.item_buttons .kernel-name {
  padding-top: 4px;
  color: #5bc0de;
  margin-right: 7px;
  float: left;
}
.toolbar_info {
  height: 24px;
  line-height: 24px;
}
.list_item input:not([type=checkbox]) {
  padding-top: 3px;
  padding-bottom: 3px;
  height: 22px;
  line-height: 14px;
  margin: 0px;
}
.highlight_text {
  color: blue;
}
#project_name {
  display: inline-block;
  padding-left: 7px;
  margin-left: -2px;
}
#project_name > .breadcrumb {
  padding: 0px;
  margin-bottom: 0px;
  background-color: transparent;
  font-weight: bold;
}
#tree-selector {
  padding-right: 0px;
}
#button-select-all {
  min-width: 50px;
}
#select-all {
  margin-left: 7px;
  margin-right: 2px;
}
.menu_icon {
  margin-right: 2px;
}
.tab-content .row {
  margin-left: 0px;
  margin-right: 0px;
}
.folder_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f114";
}
.folder_icon:before.pull-left {
  margin-right: .3em;
}
.folder_icon:before.pull-right {
  margin-left: .3em;
}
.notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
}
.notebook_icon:before.pull-left {
  margin-right: .3em;
}
.notebook_icon:before.pull-right {
  margin-left: .3em;
}
.running_notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
  color: #5cb85c;
}
.running_notebook_icon:before.pull-left {
  margin-right: .3em;
}
.running_notebook_icon:before.pull-right {
  margin-left: .3em;
}
.file_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f016";
  position: relative;
  top: -2px;
}
.file_icon:before.pull-left {
  margin-right: .3em;
}
.file_icon:before.pull-right {
  margin-left: .3em;
}
#notebook_toolbar .pull-right {
  padding-top: 0px;
  margin-right: -1px;
}
ul#new-menu {
  left: auto;
  right: 0;
}
.kernel-menu-icon {
  padding-right: 12px;
  width: 24px;
  content: "\f096";
}
.kernel-menu-icon:before {
  content: "\f096";
}
.kernel-menu-icon-current:before {
  content: "\f00c";
}
#tab_content {
  padding-top: 20px;
}
#running .panel-group .panel {
  margin-top: 3px;
  margin-bottom: 1em;
}
#running .panel-group .panel .panel-heading {
  background-color: #EEE;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
#running .panel-group .panel .panel-heading a:focus,
#running .panel-group .panel .panel-heading a:hover {
  text-decoration: none;
}
#running .panel-group .panel .panel-body {
  padding: 0px;
}
#running .panel-group .panel .panel-body .list_container {
  margin-top: 0px;
  margin-bottom: 0px;
  border: 0px;
  border-radius: 0px;
}
#running .panel-group .panel .panel-body .list_container .list_item {
  border-bottom: 1px solid #ddd;
}
#running .panel-group .panel .panel-body .list_container .list_item:last-child {
  border-bottom: 0px;
}
.delete-button {
  display: none;
}
.duplicate-button {
  display: none;
}
.rename-button {
  display: none;
}
.shutdown-button {
  display: none;
}
.dynamic-instructions {
  display: inline-block;
  padding-top: 4px;
}
/*!
*
* IPython text editor webapp
*
*/
.selected-keymap i.fa {
  padding: 0px 5px;
}
.selected-keymap i.fa:before {
  content: "\f00c";
}
#mode-menu {
  overflow: auto;
  max-height: 20em;
}
.edit_app #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.edit_app #menubar .navbar {
  /* Use a negative 1 bottom margin, so the border overlaps the border of the
    header */
  margin-bottom: -1px;
}
.dirty-indicator {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator.pull-left {
  margin-right: .3em;
}
.dirty-indicator.pull-right {
  margin-left: .3em;
}
.dirty-indicator-dirty {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-dirty.pull-left {
  margin-right: .3em;
}
.dirty-indicator-dirty.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-clean.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f00c";
}
.dirty-indicator-clean:before.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean:before.pull-right {
  margin-left: .3em;
}
#filename {
  font-size: 16pt;
  display: table;
  padding: 0px 5px;
}
#current-mode {
  padding-left: 5px;
  padding-right: 5px;
}
#texteditor-backdrop {
  padding-top: 20px;
  padding-bottom: 20px;
}
@media not print {
  #texteditor-backdrop {
    background-color: #EEE;
  }
}
@media print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container {
    padding: 0px;
    background-color: #fff;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
/*!
*
* IPython notebook
*
*/
/* CSS font colors for translated ANSI colors. */
.ansibold {
  font-weight: bold;
}
/* use dark versions for foreground, to improve visibility */
.ansiblack {
  color: black;
}
.ansired {
  color: darkred;
}
.ansigreen {
  color: darkgreen;
}
.ansiyellow {
  color: #c4a000;
}
.ansiblue {
  color: darkblue;
}
.ansipurple {
  color: darkviolet;
}
.ansicyan {
  color: steelblue;
}
.ansigray {
  color: gray;
}
/* and light for background, for the same reason */
.ansibgblack {
  background-color: black;
}
.ansibgred {
  background-color: red;
}
.ansibggreen {
  background-color: green;
}
.ansibgyellow {
  background-color: yellow;
}
.ansibgblue {
  background-color: blue;
}
.ansibgpurple {
  background-color: magenta;
}
.ansibgcyan {
  background-color: cyan;
}
.ansibggray {
  background-color: gray;
}
div.cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  border-radius: 2px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  border-width: 1px;
  border-style: solid;
  border-color: transparent;
  width: 100%;
  padding: 5px;
  /* This acts as a spacer between cells, that is outside the border */
  margin: 0px;
  outline: none;
  border-left-width: 1px;
  padding-left: 5px;
  background: linear-gradient(to right, transparent -40px, transparent 1px, transparent 1px, transparent 100%);
}
div.cell.jupyter-soft-selected {
  border-left-color: #90CAF9;
  border-left-color: #E3F2FD;
  border-left-width: 1px;
  padding-left: 5px;
  border-right-color: #E3F2FD;
  border-right-width: 1px;
  background: #E3F2FD;
}
@media print {
  div.cell.jupyter-soft-selected {
    border-color: transparent;
  }
}
div.cell.selected {
  border-color: #ababab;
  border-left-width: 0px;
  padding-left: 6px;
  background: linear-gradient(to right, #42A5F5 -40px, #42A5F5 5px, transparent 5px, transparent 100%);
}
@media print {
  div.cell.selected {
    border-color: transparent;
  }
}
div.cell.selected.jupyter-soft-selected {
  border-left-width: 0;
  padding-left: 6px;
  background: linear-gradient(to right, #42A5F5 -40px, #42A5F5 7px, #E3F2FD 7px, #E3F2FD 100%);
}
.edit_mode div.cell.selected {
  border-color: #66BB6A;
  border-left-width: 0px;
  padding-left: 6px;
  background: linear-gradient(to right, #66BB6A -40px, #66BB6A 5px, transparent 5px, transparent 100%);
}
@media print {
  .edit_mode div.cell.selected {
    border-color: transparent;
  }
}
.prompt {
  /* This needs to be wide enough for 3 digit prompt numbers: In[100]: */
  min-width: 14ex;
  /* This padding is tuned to match the padding on the CodeMirror editor. */
  padding: 0.4em;
  margin: 0px;
  font-family: monospace;
  text-align: right;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
  /* Don't highlight prompt number selection */
  -webkit-touch-callout: none;
  -webkit-user-select: none;
  -khtml-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
  /* Use default cursor */
  cursor: default;
}
@media (max-width: 540px) {
  .prompt {
    text-align: left;
  }
}
div.inner_cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
@-moz-document url-prefix() {
  div.inner_cell {
    overflow-x: hidden;
  }
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_area {
  border: 1px solid #cfcfcf;
  border-radius: 2px;
  background: #f7f7f7;
  line-height: 1.21429em;
}
/* This is needed so that empty prompt areas can collapse to zero height when there
   is no content in the output_subarea and the prompt. The main purpose of this is
   to make sure that empty JavaScript output_subareas have no height. */
div.prompt:empty {
  padding-top: 0;
  padding-bottom: 0;
}
div.unrecognized_cell {
  padding: 5px 5px 5px 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.unrecognized_cell .inner_cell {
  border-radius: 2px;
  padding: 5px;
  font-weight: bold;
  color: red;
  border: 1px solid #cfcfcf;
  background: #eaeaea;
}
div.unrecognized_cell .inner_cell a {
  color: inherit;
  text-decoration: none;
}
div.unrecognized_cell .inner_cell a:hover {
  color: inherit;
  text-decoration: none;
}
@media (max-width: 540px) {
  div.unrecognized_cell > div.prompt {
    display: none;
  }
}
div.code_cell {
  /* avoid page breaking on code cells when printing */
}
@media print {
  div.code_cell {
    page-break-inside: avoid;
  }
}
/* any special styling for code cells that are currently running goes here */
div.input {
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.input {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_prompt {
  color: #303F9F;
  border-top: 1px solid transparent;
}
div.input_area > div.highlight {
  margin: 0.4em;
  border: none;
  padding: 0px;
  background-color: transparent;
}
div.input_area > div.highlight > pre {
  margin: 0px;
  border: none;
  padding: 0px;
  background-color: transparent;
}
/* The following gets added to the <head> if it is detected that the user has a
 * monospace font with inconsistent normal/bold/italic height.  See
 * notebookmain.js.  Such fonts will have keywords vertically offset with
 * respect to the rest of the text.  The user should select a better font.
 * See: https://github.com/ipython/ipython/issues/1503
 *
 * .CodeMirror span {
 *      vertical-align: bottom;
 * }
 */
.CodeMirror {
  line-height: 1.21429em;
  /* Changed from 1em to our global default */
  font-size: 14px;
  height: auto;
  /* Changed to auto to autogrow */
  background: none;
  /* Changed from white to allow our bg to show through */
}
.CodeMirror-scroll {
  /*  The CodeMirror docs are a bit fuzzy on if overflow-y should be hidden or visible.*/
  /*  We have found that if it is visible, vertical scrollbars appear with font size changes.*/
  overflow-y: hidden;
  overflow-x: auto;
}
.CodeMirror-lines {
  /* In CM2, this used to be 0.4em, but in CM3 it went to 4px. We need the em value because */
  /* we have set a different line-height and want this to scale with that. */
  padding: 0.4em;
}
.CodeMirror-linenumber {
  padding: 0 8px 0 4px;
}
.CodeMirror-gutters {
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.CodeMirror pre {
  /* In CM3 this went to 4px from 0 in CM2. We need the 0 value because of how we size */
  /* .CodeMirror-lines */
  padding: 0;
  border: 0;
  border-radius: 0;
}
/*

Original style from softwaremaniacs.org (c) Ivan Sagalaev <Maniac@SoftwareManiacs.Org>
Adapted from GitHub theme

*/
.highlight-base {
  color: #000;
}
.highlight-variable {
  color: #000;
}
.highlight-variable-2 {
  color: #1a1a1a;
}
.highlight-variable-3 {
  color: #333333;
}
.highlight-string {
  color: #BA2121;
}
.highlight-comment {
  color: #408080;
  font-style: italic;
}
.highlight-number {
  color: #080;
}
.highlight-atom {
  color: #88F;
}
.highlight-keyword {
  color: #008000;
  font-weight: bold;
}
.highlight-builtin {
  color: #008000;
}
.highlight-error {
  color: #f00;
}
.highlight-operator {
  color: #AA22FF;
  font-weight: bold;
}
.highlight-meta {
  color: #AA22FF;
}
/* previously not defined, copying from default codemirror */
.highlight-def {
  color: #00f;
}
.highlight-string-2 {
  color: #f50;
}
.highlight-qualifier {
  color: #555;
}
.highlight-bracket {
  color: #997;
}
.highlight-tag {
  color: #170;
}
.highlight-attribute {
  color: #00c;
}
.highlight-header {
  color: blue;
}
.highlight-quote {
  color: #090;
}
.highlight-link {
  color: #00c;
}
/* apply the same style to codemirror */
.cm-s-ipython span.cm-keyword {
  color: #008000;
  font-weight: bold;
}
.cm-s-ipython span.cm-atom {
  color: #88F;
}
.cm-s-ipython span.cm-number {
  color: #080;
}
.cm-s-ipython span.cm-def {
  color: #00f;
}
.cm-s-ipython span.cm-variable {
  color: #000;
}
.cm-s-ipython span.cm-operator {
  color: #AA22FF;
  font-weight: bold;
}
.cm-s-ipython span.cm-variable-2 {
  color: #1a1a1a;
}
.cm-s-ipython span.cm-variable-3 {
  color: #333333;
}
.cm-s-ipython span.cm-comment {
  color: #408080;
  font-style: italic;
}
.cm-s-ipython span.cm-string {
  color: #BA2121;
}
.cm-s-ipython span.cm-string-2 {
  color: #f50;
}
.cm-s-ipython span.cm-meta {
  color: #AA22FF;
}
.cm-s-ipython span.cm-qualifier {
  color: #555;
}
.cm-s-ipython span.cm-builtin {
  color: #008000;
}
.cm-s-ipython span.cm-bracket {
  color: #997;
}
.cm-s-ipython span.cm-tag {
  color: #170;
}
.cm-s-ipython span.cm-attribute {
  color: #00c;
}
.cm-s-ipython span.cm-header {
  color: blue;
}
.cm-s-ipython span.cm-quote {
  color: #090;
}
.cm-s-ipython span.cm-link {
  color: #00c;
}
.cm-s-ipython span.cm-error {
  color: #f00;
}
.cm-s-ipython span.cm-tab {
  background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAMCAYAAAAkuj5RAAAAAXNSR0IArs4c6QAAAGFJREFUSMft1LsRQFAQheHPowAKoACx3IgEKtaEHujDjORSgWTH/ZOdnZOcM/sgk/kFFWY0qV8foQwS4MKBCS3qR6ixBJvElOobYAtivseIE120FaowJPN75GMu8j/LfMwNjh4HUpwg4LUAAAAASUVORK5CYII=);
  background-position: right;
  background-repeat: no-repeat;
}
div.output_wrapper {
  /* this position must be relative to enable descendents to be absolute within it */
  position: relative;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  z-index: 1;
}
/* class for the output area when it should be height-limited */
div.output_scroll {
  /* ideally, this would be max-height, but FF barfs all over that */
  height: 24em;
  /* FF needs this *and the wrapper* to specify full width, or it will shrinkwrap */
  width: 100%;
  overflow: auto;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  display: block;
}
/* output div while it is collapsed */
div.output_collapsed {
  margin: 0px;
  padding: 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
div.out_prompt_overlay {
  height: 100%;
  padding: 0px 0.4em;
  position: absolute;
  border-radius: 2px;
}
div.out_prompt_overlay:hover {
  /* use inner shadow to get border that is computed the same on WebKit/FF */
  -webkit-box-shadow: inset 0 0 1px #000;
  box-shadow: inset 0 0 1px #000;
  background: rgba(240, 240, 240, 0.5);
}
div.output_prompt {
  color: #D84315;
}
/* This class is the outer container of all output sections. */
div.output_area {
  padding: 0px;
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.output_area .MathJax_Display {
  text-align: left !important;
}
div.output_area .rendered_html table {
  margin-left: 0;
  margin-right: 0;
}
div.output_area .rendered_html img {
  margin-left: 0;
  margin-right: 0;
}
div.output_area img,
div.output_area svg {
  max-width: 100%;
  height: auto;
}
div.output_area img.unconfined,
div.output_area svg.unconfined {
  max-width: none;
}
/* This is needed to protect the pre formating from global settings such
   as that of bootstrap */
.output {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.output_area {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
div.output_area pre {
  margin: 0;
  padding: 0;
  border: 0;
  vertical-align: baseline;
  color: black;
  background-color: transparent;
  border-radius: 0;
}
/* This class is for the output subarea inside the output_area and after
   the prompt div. */
div.output_subarea {
  overflow-x: auto;
  padding: 0.4em;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
  max-width: calc(100% - 14ex);
}
div.output_scroll div.output_subarea {
  overflow-x: visible;
}
/* The rest of the output_* classes are for special styling of the different
   output types */
/* all text output has this class: */
div.output_text {
  text-align: left;
  color: #000;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
}
/* stdout/stderr are 'text' as well as 'stream', but execute_result/error are *not* streams */
div.output_stderr {
  background: #fdd;
  /* very light red background for stderr */
}
div.output_latex {
  text-align: left;
}
/* Empty output_javascript divs should have no height */
div.output_javascript:empty {
  padding: 0;
}
.js-error {
  color: darkred;
}
/* raw_input styles */
div.raw_input_container {
  line-height: 1.21429em;
  padding-top: 5px;
}
pre.raw_input_prompt {
  /* nothing needed here. */
}
input.raw_input {
  font-family: monospace;
  font-size: inherit;
  color: inherit;
  width: auto;
  /* make sure input baseline aligns with prompt */
  vertical-align: baseline;
  /* padding + margin = 0.5em between prompt and cursor */
  padding: 0em 0.25em;
  margin: 0em 0.25em;
}
input.raw_input:focus {
  box-shadow: none;
}
p.p-space {
  margin-bottom: 10px;
}
div.output_unrecognized {
  padding: 5px;
  font-weight: bold;
  color: red;
}
div.output_unrecognized a {
  color: inherit;
  text-decoration: none;
}
div.output_unrecognized a:hover {
  color: inherit;
  text-decoration: none;
}
.rendered_html {
  color: #000;
  /* any extras will just be numbers: */
}
.rendered_html em {
  font-style: italic;
}
.rendered_html strong {
  font-weight: bold;
}
.rendered_html u {
  text-decoration: underline;
}
.rendered_html :link {
  text-decoration: underline;
}
.rendered_html :visited {
  text-decoration: underline;
}
.rendered_html h1 {
  font-size: 185.7%;
  margin: 1.08em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h2 {
  font-size: 157.1%;
  margin: 1.27em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h3 {
  font-size: 128.6%;
  margin: 1.55em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h4 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h5 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h6 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h1:first-child {
  margin-top: 0.538em;
}
.rendered_html h2:first-child {
  margin-top: 0.636em;
}
.rendered_html h3:first-child {
  margin-top: 0.777em;
}
.rendered_html h4:first-child {
  margin-top: 1em;
}
.rendered_html h5:first-child {
  margin-top: 1em;
}
.rendered_html h6:first-child {
  margin-top: 1em;
}
.rendered_html ul {
  list-style: disc;
  margin: 0em 2em;
  padding-left: 0px;
}
.rendered_html ul ul {
  list-style: square;
  margin: 0em 2em;
}
.rendered_html ul ul ul {
  list-style: circle;
  margin: 0em 2em;
}
.rendered_html ol {
  list-style: decimal;
  margin: 0em 2em;
  padding-left: 0px;
}
.rendered_html ol ol {
  list-style: upper-alpha;
  margin: 0em 2em;
}
.rendered_html ol ol ol {
  list-style: lower-alpha;
  margin: 0em 2em;
}
.rendered_html ol ol ol ol {
  list-style: lower-roman;
  margin: 0em 2em;
}
.rendered_html ol ol ol ol ol {
  list-style: decimal;
  margin: 0em 2em;
}
.rendered_html * + ul {
  margin-top: 1em;
}
.rendered_html * + ol {
  margin-top: 1em;
}
.rendered_html hr {
  color: black;
  background-color: black;
}
.rendered_html pre {
  margin: 1em 2em;
}
.rendered_html pre,
.rendered_html code {
  border: 0;
  background-color: #fff;
  color: #000;
  font-size: 100%;
  padding: 0px;
}
.rendered_html blockquote {
  margin: 1em 2em;
}
.rendered_html table {
  margin-left: auto;
  margin-right: auto;
  border: 1px solid black;
  border-collapse: collapse;
}
.rendered_html tr,
.rendered_html th,
.rendered_html td {
  border: 1px solid black;
  border-collapse: collapse;
  margin: 1em 2em;
}
.rendered_html td,
.rendered_html th {
  text-align: left;
  vertical-align: middle;
  padding: 4px;
}
.rendered_html th {
  font-weight: bold;
}
.rendered_html * + table {
  margin-top: 1em;
}
.rendered_html p {
  text-align: left;
}
.rendered_html * + p {
  margin-top: 1em;
}
.rendered_html img {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.rendered_html * + img {
  margin-top: 1em;
}
.rendered_html img,
.rendered_html svg {
  max-width: 100%;
  height: auto;
}
.rendered_html img.unconfined,
.rendered_html svg.unconfined {
  max-width: none;
}
div.text_cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.text_cell > div.prompt {
    display: none;
  }
}
div.text_cell_render {
  /*font-family: "Helvetica Neue", Arial, Helvetica, Geneva, sans-serif;*/
  outline: none;
  resize: none;
  width: inherit;
  border-style: none;
  padding: 0.5em 0.5em 0.5em 0.4em;
  color: #000;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
a.anchor-link:link {
  text-decoration: none;
  padding: 0px 20px;
  visibility: hidden;
}
h1:hover .anchor-link,
h2:hover .anchor-link,
h3:hover .anchor-link,
h4:hover .anchor-link,
h5:hover .anchor-link,
h6:hover .anchor-link {
  visibility: visible;
}
.text_cell.rendered .input_area {
  display: none;
}
.text_cell.rendered .rendered_html {
  overflow-x: auto;
  overflow-y: hidden;
}
.text_cell.unrendered .text_cell_render {
  display: none;
}
.cm-header-1,
.cm-header-2,
.cm-header-3,
.cm-header-4,
.cm-header-5,
.cm-header-6 {
  font-weight: bold;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
}
.cm-header-1 {
  font-size: 185.7%;
}
.cm-header-2 {
  font-size: 157.1%;
}
.cm-header-3 {
  font-size: 128.6%;
}
.cm-header-4 {
  font-size: 110%;
}
.cm-header-5 {
  font-size: 100%;
  font-style: italic;
}
.cm-header-6 {
  font-size: 100%;
  font-style: italic;
}
/*!
*
* IPython notebook webapp
*
*/
@media (max-width: 767px) {
  .notebook_app {
    padding-left: 0px;
    padding-right: 0px;
  }
}
#ipython-main-app {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook_panel {
  margin: 0px;
  padding: 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook {
  font-size: 14px;
  line-height: 20px;
  overflow-y: hidden;
  overflow-x: auto;
  width: 100%;
  /* This spaces the page away from the edge of the notebook area */
  padding-top: 20px;
  margin: 0px;
  outline: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  min-height: 100%;
}
@media not print {
  #notebook-container {
    padding: 15px;
    background-color: #fff;
    min-height: 0;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
@media print {
  #notebook-container {
    width: 100%;
  }
}
div.ui-widget-content {
  border: 1px solid #ababab;
  outline: none;
}
pre.dialog {
  background-color: #f7f7f7;
  border: 1px solid #ddd;
  border-radius: 2px;
  padding: 0.4em;
  padding-left: 2em;
}
p.dialog {
  padding: 0.2em;
}
/* Word-wrap output correctly.  This is the CSS3 spelling, though Firefox seems
   to not honor it correctly.  Webkit browsers (Chrome, rekonq, Safari) do.
 */
pre,
code,
kbd,
samp {
  white-space: pre-wrap;
}
#fonttest {
  font-family: monospace;
}
p {
  margin-bottom: 0;
}
.end_space {
  min-height: 100px;
  transition: height .2s ease;
}
.notebook_app > #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
@media not print {
  .notebook_app {
    background-color: #EEE;
  }
}
kbd {
  border-style: solid;
  border-width: 1px;
  box-shadow: none;
  margin: 2px;
  padding-left: 2px;
  padding-right: 2px;
  padding-top: 1px;
  padding-bottom: 1px;
}
/* CSS for the cell toolbar */
.celltoolbar {
  border: thin solid #CFCFCF;
  border-bottom: none;
  background: #EEE;
  border-radius: 2px 2px 0px 0px;
  width: 100%;
  height: 29px;
  padding-right: 4px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
  display: -webkit-flex;
}
@media print {
  .celltoolbar {
    display: none;
  }
}
.ctb_hideshow {
  display: none;
  vertical-align: bottom;
}
/* ctb_show is added to the ctb_hideshow div to show the cell toolbar.
   Cell toolbars are only shown when the ctb_global_show class is also set.
*/
.ctb_global_show .ctb_show.ctb_hideshow {
  display: block;
}
.ctb_global_show .ctb_show + .input_area,
.ctb_global_show .ctb_show + div.text_cell_input,
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border-top-right-radius: 0px;
  border-top-left-radius: 0px;
}
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border: 1px solid #cfcfcf;
}
.celltoolbar {
  font-size: 87%;
  padding-top: 3px;
}
.celltoolbar select {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
  width: inherit;
  font-size: inherit;
  height: 22px;
  padding: 0px;
  display: inline-block;
}
.celltoolbar select:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.celltoolbar select::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.celltoolbar select:-ms-input-placeholder {
  color: #999;
}
.celltoolbar select::-webkit-input-placeholder {
  color: #999;
}
.celltoolbar select::-ms-expand {
  border: 0;
  background-color: transparent;
}
.celltoolbar select[disabled],
.celltoolbar select[readonly],
fieldset[disabled] .celltoolbar select {
  background-color: #eeeeee;
  opacity: 1;
}
.celltoolbar select[disabled],
fieldset[disabled] .celltoolbar select {
  cursor: not-allowed;
}
textarea.celltoolbar select {
  height: auto;
}
select.celltoolbar select {
  height: 30px;
  line-height: 30px;
}
textarea.celltoolbar select,
select[multiple].celltoolbar select {
  height: auto;
}
.celltoolbar label {
  margin-left: 5px;
  margin-right: 5px;
}
.completions {
  position: absolute;
  z-index: 110;
  overflow: hidden;
  border: 1px solid #ababab;
  border-radius: 2px;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  line-height: 1;
}
.completions select {
  background: white;
  outline: none;
  border: none;
  padding: 0px;
  margin: 0px;
  overflow: auto;
  font-family: monospace;
  font-size: 110%;
  color: #000;
  width: auto;
}
.completions select option.context {
  color: #286090;
}
#kernel_logo_widget {
  float: right !important;
  float: right;
}
#kernel_logo_widget .current_kernel_logo {
  display: none;
  margin-top: -1px;
  margin-bottom: -1px;
  width: 32px;
  height: 32px;
}
#menubar {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  margin-top: 1px;
}
#menubar .navbar {
  border-top: 1px;
  border-radius: 0px 0px 2px 2px;
  margin-bottom: 0px;
}
#menubar .navbar-toggle {
  float: left;
  padding-top: 7px;
  padding-bottom: 7px;
  border: none;
}
#menubar .navbar-collapse {
  clear: left;
}
.nav-wrapper {
  border-bottom: 1px solid #e7e7e7;
}
i.menu-icon {
  padding-top: 4px;
}
ul#help_menu li a {
  overflow: hidden;
  padding-right: 2.2em;
}
ul#help_menu li a i {
  margin-right: -1.2em;
}
.dropdown-submenu {
  position: relative;
}
.dropdown-submenu > .dropdown-menu {
  top: 0;
  left: 100%;
  margin-top: -6px;
  margin-left: -1px;
}
.dropdown-submenu:hover > .dropdown-menu {
  display: block;
}
.dropdown-submenu > a:after {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  display: block;
  content: "\f0da";
  float: right;
  color: #333333;
  margin-top: 2px;
  margin-right: -10px;
}
.dropdown-submenu > a:after.pull-left {
  margin-right: .3em;
}
.dropdown-submenu > a:after.pull-right {
  margin-left: .3em;
}
.dropdown-submenu:hover > a:after {
  color: #262626;
}
.dropdown-submenu.pull-left {
  float: none;
}
.dropdown-submenu.pull-left > .dropdown-menu {
  left: -100%;
  margin-left: 10px;
}
#notification_area {
  float: right !important;
  float: right;
  z-index: 10;
}
.indicator_area {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
#kernel_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  border-left: 1px solid;
}
#kernel_indicator .kernel_indicator_name {
  padding-left: 5px;
  padding-right: 5px;
}
#modal_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
#readonly-indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  margin-top: 2px;
  margin-bottom: 0px;
  margin-left: 0px;
  margin-right: 0px;
  display: none;
}
.modal_indicator:before {
  width: 1.28571429em;
  text-align: center;
}
.edit_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f040";
}
.edit_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.edit_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.command_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: ' ';
}
.command_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.command_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.kernel_idle_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f10c";
}
.kernel_idle_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_idle_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_busy_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f111";
}
.kernel_busy_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_busy_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_dead_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f1e2";
}
.kernel_dead_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_dead_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_disconnected_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f127";
}
.kernel_disconnected_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_disconnected_icon:before.pull-right {
  margin-left: .3em;
}
.notification_widget {
  color: #777;
  z-index: 10;
  background: rgba(240, 240, 240, 0.5);
  margin-right: 4px;
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget:focus,
.notification_widget.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.notification_widget:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active:hover,
.notification_widget.active:hover,
.open > .dropdown-toggle.notification_widget:hover,
.notification_widget:active:focus,
.notification_widget.active:focus,
.open > .dropdown-toggle.notification_widget:focus,
.notification_widget:active.focus,
.notification_widget.active.focus,
.open > .dropdown-toggle.notification_widget.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  background-image: none;
}
.notification_widget.disabled:hover,
.notification_widget[disabled]:hover,
fieldset[disabled] .notification_widget:hover,
.notification_widget.disabled:focus,
.notification_widget[disabled]:focus,
fieldset[disabled] .notification_widget:focus,
.notification_widget.disabled.focus,
.notification_widget[disabled].focus,
fieldset[disabled] .notification_widget.focus {
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget .badge {
  color: #fff;
  background-color: #333;
}
.notification_widget.warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning:focus,
.notification_widget.warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.notification_widget.warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active:hover,
.notification_widget.warning.active:hover,
.open > .dropdown-toggle.notification_widget.warning:hover,
.notification_widget.warning:active:focus,
.notification_widget.warning.active:focus,
.open > .dropdown-toggle.notification_widget.warning:focus,
.notification_widget.warning:active.focus,
.notification_widget.warning.active.focus,
.open > .dropdown-toggle.notification_widget.warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  background-image: none;
}
.notification_widget.warning.disabled:hover,
.notification_widget.warning[disabled]:hover,
fieldset[disabled] .notification_widget.warning:hover,
.notification_widget.warning.disabled:focus,
.notification_widget.warning[disabled]:focus,
fieldset[disabled] .notification_widget.warning:focus,
.notification_widget.warning.disabled.focus,
.notification_widget.warning[disabled].focus,
fieldset[disabled] .notification_widget.warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.notification_widget.success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success:focus,
.notification_widget.success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.notification_widget.success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active:hover,
.notification_widget.success.active:hover,
.open > .dropdown-toggle.notification_widget.success:hover,
.notification_widget.success:active:focus,
.notification_widget.success.active:focus,
.open > .dropdown-toggle.notification_widget.success:focus,
.notification_widget.success:active.focus,
.notification_widget.success.active.focus,
.open > .dropdown-toggle.notification_widget.success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  background-image: none;
}
.notification_widget.success.disabled:hover,
.notification_widget.success[disabled]:hover,
fieldset[disabled] .notification_widget.success:hover,
.notification_widget.success.disabled:focus,
.notification_widget.success[disabled]:focus,
fieldset[disabled] .notification_widget.success:focus,
.notification_widget.success.disabled.focus,
.notification_widget.success[disabled].focus,
fieldset[disabled] .notification_widget.success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.notification_widget.info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info:focus,
.notification_widget.info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.notification_widget.info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active:hover,
.notification_widget.info.active:hover,
.open > .dropdown-toggle.notification_widget.info:hover,
.notification_widget.info:active:focus,
.notification_widget.info.active:focus,
.open > .dropdown-toggle.notification_widget.info:focus,
.notification_widget.info:active.focus,
.notification_widget.info.active.focus,
.open > .dropdown-toggle.notification_widget.info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  background-image: none;
}
.notification_widget.info.disabled:hover,
.notification_widget.info[disabled]:hover,
fieldset[disabled] .notification_widget.info:hover,
.notification_widget.info.disabled:focus,
.notification_widget.info[disabled]:focus,
fieldset[disabled] .notification_widget.info:focus,
.notification_widget.info.disabled.focus,
.notification_widget.info[disabled].focus,
fieldset[disabled] .notification_widget.info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.notification_widget.danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger:focus,
.notification_widget.danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.notification_widget.danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active:hover,
.notification_widget.danger.active:hover,
.open > .dropdown-toggle.notification_widget.danger:hover,
.notification_widget.danger:active:focus,
.notification_widget.danger.active:focus,
.open > .dropdown-toggle.notification_widget.danger:focus,
.notification_widget.danger:active.focus,
.notification_widget.danger.active.focus,
.open > .dropdown-toggle.notification_widget.danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  background-image: none;
}
.notification_widget.danger.disabled:hover,
.notification_widget.danger[disabled]:hover,
fieldset[disabled] .notification_widget.danger:hover,
.notification_widget.danger.disabled:focus,
.notification_widget.danger[disabled]:focus,
fieldset[disabled] .notification_widget.danger:focus,
.notification_widget.danger.disabled.focus,
.notification_widget.danger[disabled].focus,
fieldset[disabled] .notification_widget.danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger .badge {
  color: #d9534f;
  background-color: #fff;
}
div#pager {
  background-color: #fff;
  font-size: 14px;
  line-height: 20px;
  overflow: hidden;
  display: none;
  position: fixed;
  bottom: 0px;
  width: 100%;
  max-height: 50%;
  padding-top: 8px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  /* Display over codemirror */
  z-index: 100;
  /* Hack which prevents jquery ui resizable from changing top. */
  top: auto !important;
}
div#pager pre {
  line-height: 1.21429em;
  color: #000;
  background-color: #f7f7f7;
  padding: 0.4em;
}
div#pager #pager-button-area {
  position: absolute;
  top: 8px;
  right: 20px;
}
div#pager #pager-contents {
  position: relative;
  overflow: auto;
  width: 100%;
  height: 100%;
}
div#pager #pager-contents #pager-container {
  position: relative;
  padding: 15px 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
div#pager .ui-resizable-handle {
  top: 0px;
  height: 8px;
  background: #f7f7f7;
  border-top: 1px solid #cfcfcf;
  border-bottom: 1px solid #cfcfcf;
  /* This injects handle bars (a short, wide = symbol) for 
        the resize handle. */
}
div#pager .ui-resizable-handle::after {
  content: '';
  top: 2px;
  left: 50%;
  height: 3px;
  width: 30px;
  margin-left: -15px;
  position: absolute;
  border-top: 1px solid #cfcfcf;
}
.quickhelp {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  line-height: 1.8em;
}
.shortcut_key {
  display: inline-block;
  width: 20ex;
  text-align: right;
  font-family: monospace;
}
.shortcut_descr {
  display: inline-block;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
span.save_widget {
  margin-top: 6px;
}
span.save_widget span.filename {
  height: 1em;
  line-height: 1em;
  padding: 3px;
  margin-left: 16px;
  border: none;
  font-size: 146.5%;
  border-radius: 2px;
}
span.save_widget span.filename:hover {
  background-color: #e6e6e6;
}
span.checkpoint_status,
span.autosave_status {
  font-size: small;
}
@media (max-width: 767px) {
  span.save_widget {
    font-size: small;
  }
  span.checkpoint_status,
  span.autosave_status {
    display: none;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  span.checkpoint_status {
    display: none;
  }
  span.autosave_status {
    font-size: x-small;
  }
}
.toolbar {
  padding: 0px;
  margin-left: -5px;
  margin-top: 2px;
  margin-bottom: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.toolbar select,
.toolbar label {
  width: auto;
  vertical-align: middle;
  margin-right: 2px;
  margin-bottom: 0px;
  display: inline;
  font-size: 92%;
  margin-left: 0.3em;
  margin-right: 0.3em;
  padding: 0px;
  padding-top: 3px;
}
.toolbar .btn {
  padding: 2px 8px;
}
.toolbar .btn-group {
  margin-top: 0px;
  margin-left: 5px;
}
#maintoolbar {
  margin-bottom: -3px;
  margin-top: -8px;
  border: 0px;
  min-height: 27px;
  margin-left: 0px;
  padding-top: 11px;
  padding-bottom: 3px;
}
#maintoolbar .navbar-text {
  float: none;
  vertical-align: middle;
  text-align: right;
  margin-left: 5px;
  margin-right: 0px;
  margin-top: 0px;
}
.select-xs {
  height: 24px;
}
.pulse,
.dropdown-menu > li > a.pulse,
li.pulse > a.dropdown-toggle,
li.pulse.open > a.dropdown-toggle {
  background-color: #F37626;
  color: white;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
/** WARNING IF YOU ARE EDITTING THIS FILE, if this is a .css file, It has a lot
 * of chance of beeing generated from the ../less/[samename].less file, you can
 * try to get back the less file by reverting somme commit in history
 **/
/*
 * We'll try to get something pretty, so we
 * have some strange css to have the scroll bar on
 * the left with fix button on the top right of the tooltip
 */
@-moz-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-webkit-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-moz-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
@-webkit-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
/*properties of tooltip after "expand"*/
.bigtooltip {
  overflow: auto;
  height: 200px;
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
}
/*properties of tooltip before "expand"*/
.smalltooltip {
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
  text-overflow: ellipsis;
  overflow: hidden;
  height: 80px;
}
.tooltipbuttons {
  position: absolute;
  padding-right: 15px;
  top: 0px;
  right: 0px;
}
.tooltiptext {
  /*avoid the button to overlap on some docstring*/
  padding-right: 30px;
}
.ipython_tooltip {
  max-width: 700px;
  /*fade-in animation when inserted*/
  -webkit-animation: fadeOut 400ms;
  -moz-animation: fadeOut 400ms;
  animation: fadeOut 400ms;
  -webkit-animation: fadeIn 400ms;
  -moz-animation: fadeIn 400ms;
  animation: fadeIn 400ms;
  vertical-align: middle;
  background-color: #f7f7f7;
  overflow: visible;
  border: #ababab 1px solid;
  outline: none;
  padding: 3px;
  margin: 0px;
  padding-left: 7px;
  font-family: monospace;
  min-height: 50px;
  -moz-box-shadow: 0px 6px 10px -1px #adadad;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  border-radius: 2px;
  position: absolute;
  z-index: 1000;
}
.ipython_tooltip a {
  float: right;
}
.ipython_tooltip .tooltiptext pre {
  border: 0;
  border-radius: 0;
  font-size: 100%;
  background-color: #f7f7f7;
}
.pretooltiparrow {
  left: 0px;
  margin: 0px;
  top: -16px;
  width: 40px;
  height: 16px;
  overflow: hidden;
  position: absolute;
}
.pretooltiparrow:before {
  background-color: #f7f7f7;
  border: 1px #ababab solid;
  z-index: 11;
  content: "";
  position: absolute;
  left: 15px;
  top: 10px;
  width: 25px;
  height: 25px;
  -webkit-transform: rotate(45deg);
  -moz-transform: rotate(45deg);
  -ms-transform: rotate(45deg);
  -o-transform: rotate(45deg);
}
ul.typeahead-list i {
  margin-left: -10px;
  width: 18px;
}
ul.typeahead-list {
  max-height: 80vh;
  overflow: auto;
}
ul.typeahead-list > li > a {
  /** Firefox bug **/
  /* see https://github.com/jupyter/notebook/issues/559 */
  white-space: normal;
}
.cmd-palette .modal-body {
  padding: 7px;
}
.cmd-palette form {
  background: white;
}
.cmd-palette input {
  outline: none;
}
.no-shortcut {
  display: none;
}
.command-shortcut:before {
  content: "(command)";
  padding-right: 3px;
  color: #777777;
}
.edit-shortcut:before {
  content: "(edit)";
  padding-right: 3px;
  color: #777777;
}
#find-and-replace #replace-preview .match,
#find-and-replace #replace-preview .insert {
  background-color: #BBDEFB;
  border-color: #90CAF9;
  border-style: solid;
  border-width: 1px;
  border-radius: 0px;
}
#find-and-replace #replace-preview .replace .match {
  background-color: #FFCDD2;
  border-color: #EF9A9A;
  border-radius: 0px;
}
#find-and-replace #replace-preview .replace .insert {
  background-color: #C8E6C9;
  border-color: #A5D6A7;
  border-radius: 0px;
}
#find-and-replace #replace-preview {
  max-height: 60vh;
  overflow: auto;
}
#find-and-replace #replace-preview pre {
  padding: 5px 10px;
}
.terminal-app {
  background: #EEE;
}
.terminal-app #header {
  background: #fff;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.terminal-app .terminal {
  float: left;
  font-family: monospace;
  color: white;
  background: black;
  padding: 0.4em;
  border-radius: 2px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
}
.terminal-app .terminal,
.terminal-app .terminal dummy-screen {
  line-height: 1em;
  font-size: 14px;
}
.terminal-app .terminal-cursor {
  color: black;
  background: white;
}
.terminal-app #terminado-container {
  margin-top: 20px;
}
/*# sourceMappingURL=style.min.css.map */
    </style>
<style type="text/css">
    .highlight .hll { background-color: #ffffcc }
.highlight  { background: #f8f8f8; }
.highlight .c { color: #408080; font-style: italic } /* Comment */
.highlight .err { border: 1px solid #FF0000 } /* Error */
.highlight .k { color: #008000; font-weight: bold } /* Keyword */
.highlight .o { color: #666666 } /* Operator */
.highlight .ch { color: #408080; font-style: italic } /* Comment.Hashbang */
.highlight .cm { color: #408080; font-style: italic } /* Comment.Multiline */
.highlight .cp { color: #BC7A00 } /* Comment.Preproc */
.highlight .cpf { color: #408080; font-style: italic } /* Comment.PreprocFile */
.highlight .c1 { color: #408080; font-style: italic } /* Comment.Single */
.highlight .cs { color: #408080; font-style: italic } /* Comment.Special */
.highlight .gd { color: #A00000 } /* Generic.Deleted */
.highlight .ge { font-style: italic } /* Generic.Emph */
.highlight .gr { color: #FF0000 } /* Generic.Error */
.highlight .gh { color: #000080; font-weight: bold } /* Generic.Heading */
.highlight .gi { color: #00A000 } /* Generic.Inserted */
.highlight .go { color: #888888 } /* Generic.Output */
.highlight .gp { color: #000080; font-weight: bold } /* Generic.Prompt */
.highlight .gs { font-weight: bold } /* Generic.Strong */
.highlight .gu { color: #800080; font-weight: bold } /* Generic.Subheading */
.highlight .gt { color: #0044DD } /* Generic.Traceback */
.highlight .kc { color: #008000; font-weight: bold } /* Keyword.Constant */
.highlight .kd { color: #008000; font-weight: bold } /* Keyword.Declaration */
.highlight .kn { color: #008000; font-weight: bold } /* Keyword.Namespace */
.highlight .kp { color: #008000 } /* Keyword.Pseudo */
.highlight .kr { color: #008000; font-weight: bold } /* Keyword.Reserved */
.highlight .kt { color: #B00040 } /* Keyword.Type */
.highlight .m { color: #666666 } /* Literal.Number */
.highlight .s { color: #BA2121 } /* Literal.String */
.highlight .na { color: #7D9029 } /* Name.Attribute */
.highlight .nb { color: #008000 } /* Name.Builtin */
.highlight .nc { color: #0000FF; font-weight: bold } /* Name.Class */
.highlight .no { color: #880000 } /* Name.Constant */
.highlight .nd { color: #AA22FF } /* Name.Decorator */
.highlight .ni { color: #999999; font-weight: bold } /* Name.Entity */
.highlight .ne { color: #D2413A; font-weight: bold } /* Name.Exception */
.highlight .nf { color: #0000FF } /* Name.Function */
.highlight .nl { color: #A0A000 } /* Name.Label */
.highlight .nn { color: #0000FF; font-weight: bold } /* Name.Namespace */
.highlight .nt { color: #008000; font-weight: bold } /* Name.Tag */
.highlight .nv { color: #19177C } /* Name.Variable */
.highlight .ow { color: #AA22FF; font-weight: bold } /* Operator.Word */
.highlight .w { color: #bbbbbb } /* Text.Whitespace */
.highlight .mb { color: #666666 } /* Literal.Number.Bin */
.highlight .mf { color: #666666 } /* Literal.Number.Float */
.highlight .mh { color: #666666 } /* Literal.Number.Hex */
.highlight .mi { color: #666666 } /* Literal.Number.Integer */
.highlight .mo { color: #666666 } /* Literal.Number.Oct */
.highlight .sb { color: #BA2121 } /* Literal.String.Backtick */
.highlight .sc { color: #BA2121 } /* Literal.String.Char */
.highlight .sd { color: #BA2121; font-style: italic } /* Literal.String.Doc */
.highlight .s2 { color: #BA2121 } /* Literal.String.Double */
.highlight .se { color: #BB6622; font-weight: bold } /* Literal.String.Escape */
.highlight .sh { color: #BA2121 } /* Literal.String.Heredoc */
.highlight .si { color: #BB6688; font-weight: bold } /* Literal.String.Interpol */
.highlight .sx { color: #008000 } /* Literal.String.Other */
.highlight .sr { color: #BB6688 } /* Literal.String.Regex */
.highlight .s1 { color: #BA2121 } /* Literal.String.Single */
.highlight .ss { color: #19177C } /* Literal.String.Symbol */
.highlight .bp { color: #008000 } /* Name.Builtin.Pseudo */
.highlight .vc { color: #19177C } /* Name.Variable.Class */
.highlight .vg { color: #19177C } /* Name.Variable.Global */
.highlight .vi { color: #19177C } /* Name.Variable.Instance */
.highlight .il { color: #666666 } /* Literal.Number.Integer.Long */
    </style>
<style type="text/css">
    
/* Temporary definitions which will become obsolete with Notebook release 5.0 */
.ansi-black-fg { color: #3E424D; }
.ansi-black-bg { background-color: #3E424D; }
.ansi-black-intense-fg { color: #282C36; }
.ansi-black-intense-bg { background-color: #282C36; }
.ansi-red-fg { color: #E75C58; }
.ansi-red-bg { background-color: #E75C58; }
.ansi-red-intense-fg { color: #B22B31; }
.ansi-red-intense-bg { background-color: #B22B31; }
.ansi-green-fg { color: #00A250; }
.ansi-green-bg { background-color: #00A250; }
.ansi-green-intense-fg { color: #007427; }
.ansi-green-intense-bg { background-color: #007427; }
.ansi-yellow-fg { color: #DDB62B; }
.ansi-yellow-bg { background-color: #DDB62B; }
.ansi-yellow-intense-fg { color: #B27D12; }
.ansi-yellow-intense-bg { background-color: #B27D12; }
.ansi-blue-fg { color: #208FFB; }
.ansi-blue-bg { background-color: #208FFB; }
.ansi-blue-intense-fg { color: #0065CA; }
.ansi-blue-intense-bg { background-color: #0065CA; }
.ansi-magenta-fg { color: #D160C4; }
.ansi-magenta-bg { background-color: #D160C4; }
.ansi-magenta-intense-fg { color: #A03196; }
.ansi-magenta-intense-bg { background-color: #A03196; }
.ansi-cyan-fg { color: #60C6C8; }
.ansi-cyan-bg { background-color: #60C6C8; }
.ansi-cyan-intense-fg { color: #258F8F; }
.ansi-cyan-intense-bg { background-color: #258F8F; }
.ansi-white-fg { color: #C5C1B4; }
.ansi-white-bg { background-color: #C5C1B4; }
.ansi-white-intense-fg { color: #A1A6B2; }
.ansi-white-intense-bg { background-color: #A1A6B2; }

.ansi-bold { font-weight: bold; }

    </style>


<style type="text/css">
/* Overrides of notebook CSS for static HTML export */
body {
  overflow: visible;
  padding: 8px;
}

div#notebook {
  overflow: visible;
  border-top: none;
}

@media print {
  div.cell {
    display: block;
    page-break-inside: avoid;
  } 
  div.output_wrapper { 
    display: block;
    page-break-inside: avoid; 
  }
  div.output { 
    display: block;
    page-break-inside: avoid; 
  }
}
</style>

<!-- Custom stylesheet, it must be in the same directory as the html file -->
<link rel="stylesheet" href="custom.css">

<!-- Loading mathjax macro -->
<!-- Load mathjax -->
    <script src="https://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS_HTML"></script>
    <!-- MathJax configuration -->
    <script type="text/x-mathjax-config">
    MathJax.Hub.Config({
        tex2jax: {
            inlineMath: [ ['$','$'], ["\\(","\\)"] ],
            displayMath: [ ['$$','$$'], ["\\[","\\]"] ],
            processEscapes: true,
            processEnvironments: true
        },
        // Center justify equations in code and markdown cells. Elsewhere
        // we use CSS to left justify single line equations in code cells.
        displayAlign: 'center',
        "HTML-CSS": {
            styles: {'.MathJax_Display': {"margin": 0}},
            linebreaks: { automatic: true }
        }
    });
    </script>
    <!-- End of mathjax configuration --></head>
<body>
  <div tabindex="-1" id="notebook" class="border-box-sizing">
    <div class="container" id="notebook-container">

<div class="cell border-box-sizing text_cell rendered">
<div class="prompt input_prompt">
</div>
<div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h1 id="BAGEL-v2-tutorial">BAGEL v2 tutorial<a class="anchor-link" href="#BAGEL-v2-tutorial">&#182;</a></h1>
</div>
</div>
</div>This Python notebook walks through all the steps involved in Bagel v2 execution and QC.
A Python notebook is not required to run Bagel; where noted, command line execution is
an option.BAGEL software is available at https://github.com/hart-lab/bagel
the CEGv2.txt (core essentials) and NEGv1.txt (nonessentials) training sets
will be added to github...eventually.
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[1]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="o">%</span><span class="k">pylab</span> inline
<span class="kn">import</span> <span class="nn">pandas</span> <span class="kn">as</span> <span class="nn">pd</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>Populating the interactive namespace from numpy and matplotlib
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[2]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># from the command line</span>
<span class="c1">#</span>
<span class="o">!</span>./BAGEL.py
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>
BAGEL.py
  from the Bayesian Analysis of Gene EssentiaLity (BAGEL) suite
  Version 2.0 Build 109

Calculate fold changes from readcount data
  BAGEL.py fc -i [read count file] -o [output label] -c [control column]

Calculate Bayes Factors from foldchange data
  BAGEL.py bf -i [fold change file] -o [output file] -e [reference essentials] -n [reference nonessentials] -c [columns to test]

Calculate precision-recall from Bayes Factors
  BAGEL.py pr -i [Bayes Factor file] -o [output file] -e [reference essentials] -n [reference nonessentials]


</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[3]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># what are the columns in my read count file?</span>
<span class="c1">#</span>
<span class="o">!</span>head -n <span class="m">2</span> reads_hap1.txt
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>SEQUENCE	GENE	HAP1_T0	HAP1_T18A	HAP1_T18B	HAP1_T18C
ACTGGCGCCATCGAGAGCCA	A1BG	239.0	245.0	230.0	62.0
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[4]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># from the command line: use BAGEL to calculate fold changes from raw read counts</span>
<span class="c1">#</span>
<span class="o">!</span>./BAGEL.py <span class="nb">fc</span> 
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>
BAGEL.py fc -i [read count file] -o [output label] -c [control column]

  from the Bayesian Analysis of Gene EssentiaLity (BAGEL) suite
  Version 2.0

  required options:
     -i  [read count file]          Tab-delmited file of reagents and fold changes.  See documentation for format.
     -o  [output label]             Label for all output files
     -c  [control column]           Control (T0 or plasmid) column

  other options:
     --minreads=N                   Discard gRNA with T0 counts &lt; N (default 0)
     --pseudo=N	                    Add a pseudocount of N to every readcount (default 5)
     -h, --help                     Show this help text

  Example:
  BAGEL.py fc -i readcount_file -o experiment_name -c 1

  Filters readcount_file for reagents with at least 30 reads in the control sample,
  calculates fold change, and writes [output label].foldchange and [output label].normalized_reads


</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[5]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="o">!</span>./BAGEL.py <span class="nb">fc</span> -i reads_hap1.txt -o hap1-t18 -c <span class="m">1</span>
<span class="c1">#</span>
<span class="c1"># note: &quot;SEQUENCE&quot; column is the row label, &quot;GENE&quot; column (required!!!) is 0, and first data column is 1</span>
<span class="c1">#</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span> 
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[6]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1"># outputs are hap1-t18.foldchange and hap1-t18.normed_readcount</span>
<span class="o">!</span>head hap1-t18.foldchange
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>REAGENT_ID	GENE	HAP1_T18A	HAP1_T18B	HAP1_T18C
ACTGGCGCCATCGAGAGCCA	A1BG	0.977	0.927	-0.768
CAAGAGAAAGACCACGAGCA	A1BG	-1.034	-1.396	-0.953
GCTCAGCTGGGTCCATCCTG	A1BG	-0.637	-0.937	-0.725
GTCGAGCTGATTCTGAGCGA	A1BG	-0.246	-0.583	-1.012
AGTTATGTTAGGTATACCCG	A1CF	0.360	1.274	1.394
ATGACTCTCATACTCCACGA	A1CF	0.273	0.774	-0.040
GGTGCAGCATCCCAACCAGG	A1CF	0.974	-0.095	0.389
TGCGCTGGACCAGTGCGCGG	A1CF	-0.492	-1.828	-1.831
AAGGTTCTAATTCAGAGGCA	A2ML1	0.499	0.756	1.127
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[7]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># calculate Bayes Factors using BAGEL</span>
<span class="c1">#</span>
<span class="o">!</span>./BAGEL.py bf
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>
BAGEL.py bf -i [fold change file] -o [output file] -e [reference essentials] -n [reference nonessentials] -c [columns to test]

  from the Bayesian Analysis of Gene EssentiaLity (BAGEL) suite
  Version 2.0 Build 109

  required options:
     -i  [fold change file]         Tab-delmited file of reagents and fold changes.  See documentation for format.
     -o  [output file]              Output filename
     -e  [reference essentials]     Training set of essential genes (text file)
     -n  [reference nonessentials]  Training set of nonessential genes (text file)
     -c  [columns to test]          comma-delimited list of columns in input file to include in analyisis

  network options
     -w  [network file]				Enable Network boosting. Tab-delmited file of edges. [GeneA (\t) GeneB]
  other options:
     -b, --bootstrapping            Use bootstrapping instead of cross-validation (Slow)
     --numcv=N                      Number of sections for cross validation (default 10)
     --numiter=N                    Number of bootstrap iterations (default 1000)
     -h, --help                     Show this help text

  Example:
  BAGEL.py bf -i foldchange_file -o experiment.bf -e essentials_training_set -n nonessentials_training_set -c 1,2,3

  Calculates a log2 Bayes Factor for each gene; positive BFs indicate confidence that the gene is essential.
  writes to [output file]: gene name, mean Bayes Factor across all iterations, std deviation of BFs, and number of iterations
  in which the gene was part of the test set (and a BF was calculated[output file]


</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[8]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># use foldchange file as input for bagel</span>
<span class="c1"># specify CEGv2 as positive controls, NEGv1 as negative controls</span>
<span class="c1"># combine columns 1,2,3 (replicates of same timepoint) into one BF calculation</span>
<span class="c1"># (we&#39;ll ingore the network boost option for now)</span>
<span class="c1">#</span>
<span class="o">!</span>./BAGEL.py bf -i hap1-t18.foldchange -o hap1-t18.bf -e CEGv2.txt -n NEGv1.txt -c 1,2,3
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>Using column:  HAP1_T18A
Using column:  HAP1_T18B
Using column:  HAP1_T18C
Number of unique genes:  18056
Number of reference essentials: 684
Number of reference nonessentials: 927
Iter TrainEss TrainNon TestSet
0 607 728 1806
1 602 731 1806
2 601 725 1806
3 605 705 1806
4 596 717 1806
5 614 736 1806
6 593 715 1805
7 606 730 1805
8 594 733 1805
9 612 725 1805
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[9]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># calculate precision-recall plot with BAGEL</span>
<span class="c1">#</span>
<span class="o">!</span>./BAGEL.py pr
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>
BAGEL.py pr -i [Bayes factors] -o [output file] -e [reference essentials] -n [reference nonessentials]

  from the Bayesian Analysis of Gene EssentiaLity (BAGEL) suite
  Version 2.0
  required options:
     -i  [Bayes factors]            BAGEL output file.
     -o  [output file]              Output filename
     -e  [reference essentials]     File with list of training set of essential genes
     -n  [reference nonessentials]  File with list of training set of nonessential genes

  Example:
  BAGEL.py pr -i input.bf -o output.PR -e ref_essentials -n ref_nonessentials


</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[10]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># we will use the same set of reference genes as controls</span>
<span class="c1">#</span>
<span class="o">!</span>./BAGEL.py pr -i hap1-t18.bf -o hap1-t18.pr -e CEGv2.txt -n NEGv1.txt
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[11]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># output is a ranked gene list with precision/recall calculated at each point for easy plotting</span>
<span class="c1">#</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[12]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="n">pr_data</span> <span class="o">=</span> <span class="n">pd</span><span class="o">.</span><span class="n">read_table</span><span class="p">(</span><span class="s1">&#39;hap1-t18.pr&#39;</span><span class="p">,</span> <span class="n">index_col</span><span class="o">=</span><span class="mi">0</span><span class="p">)</span>
<span class="n">pr_data</span><span class="o">.</span><span class="n">info</span><span class="p">()</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>&lt;class &#39;pandas.core.frame.DataFrame&#39;&gt;
Index: 18056 entries, POLR2L to LacZ
Data columns (total 3 columns):
BF           18056 non-null float64
Recall       18056 non-null float64
Precision    18056 non-null float64
dtypes: float64(3)
memory usage: 564.2+ KB
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[13]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="n">figure</span><span class="p">(</span><span class="n">figsize</span><span class="p">(</span><span class="mi">4</span><span class="p">,</span><span class="mi">4</span><span class="p">))</span>
<span class="n">plot</span><span class="p">(</span> <span class="n">pr_data</span><span class="o">.</span><span class="n">Recall</span><span class="p">,</span> <span class="n">pr_data</span><span class="o">.</span><span class="n">Precision</span><span class="p">,</span> <span class="n">linewidth</span><span class="o">=</span><span class="mi">2</span><span class="p">)</span>
<span class="n">xlim</span><span class="p">(</span><span class="mi">0</span><span class="p">,</span><span class="mf">1.01</span><span class="p">)</span>
<span class="n">ylim</span><span class="p">(</span><span class="mi">0</span><span class="p">,</span><span class="mf">1.02</span><span class="p">)</span>
<span class="n">xlabel</span><span class="p">(</span><span class="s1">&#39;Recall&#39;</span><span class="p">)</span>
<span class="n">ylabel</span><span class="p">(</span><span class="s1">&#39;Precision (1-FDR)&#39;</span><span class="p">)</span>
<span class="n">title</span><span class="p">(</span><span class="s1">&#39;Precision-Recall Plot&#39;</span><span class="p">)</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt output_prompt">Out[13]:</div>


<div class="output_text output_subarea output_execute_result">
<pre>&lt;matplotlib.text.Text at 0x10f549a90&gt;</pre>
</div>

</div>

<div class="output_area"><div class="prompt"></div>


<div class="output_png output_subarea ">
<img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAYIAAAGHCAYAAAC9N1U6AAAABHNCSVQICAgIfAhkiAAAAAlwSFlz
AAAPYQAAD2EBqD+naQAAIABJREFUeJzt3XmYHWWd9vHvnQAJCRARMMAYICA7CqRxQYSRQQjRFxRB
oAFZXCGo2OoIM7wK+g6iIqvCsBMyQg8gDoMLi2zisI10k4gSkC0gS0JYDEsSAsnv/eOpJieHczp9
TtdZuuv+XFdf6fPUcn5Pd7ruU1VPVSkiMDOz4hrR6gLMzKy1HARmZgXnIDAzKzgHgZlZwTkIzMwK
zkFgZlZwDgIzs4JzEJiZFZyDwMys4BwE1tYkLZX03RqXmSbp8UbVNNRJOjz7uW5Q0nabpFtyfI9c
12eN5SCwt0g6LNtA9H0tlPSQpJ9KeleLyorsq9ZlljaglhWSdELZz3CxpMclnSlpXCtqqqDSz3RA
P2NJs8v6N1fS7ZI+Vc/6Kqx/1exnuEs9y1t9Vmp1AdZ2AvgOMBsYDXwEOAqYImmbiFjU5HpWBd6s
cZkv0NoPOQEcCbwGjAV2A74KbA8M9Q1cAPcBPwEErA98GfilpCMj4vxBrn8McEL2PrcPcl02QA4C
q+T6iOjNvr9Y0otAF/BJ4IpKC0gaExEL8i4kIhbXscwSYEnetdTo6oh4Mfv+AkkB7C9ph4i4t5WF
5eDpiOjueyHpP4BHSP9HBhsEGuTyVgcfGrKBuIX0BzoRljvGvIukcyTNBf7WN7Ok9SVdLGmOpEWS
/izpiPKVShol6cTs8NNCSc9IulrSxJJ5ljtHIGk1SWdkh1sWZYcmbpS0Xck8bztHIGmMpFMlPZkt
96Ckb1aoaamksyR9UtL9JfVPHuTP8A/Zv5tUeM9DJN0raYGkFyR1S3p3hfk+KOm3kl6U9KqkmZK+
VjL9vZIukfRo9vN8VtJFkt45yNr7FRFzgVlk/z+qkbROVs+crL4Zkg4tmb4h8Bxpb+DEksNPNZ0j
stp5j8AG4j3Zvy9k//Yd/z2H9If7PdIhELJzCfeQPpGfBTwPTAEukrR6RJyVzTcC+A2wK9ANnAGs
DuwObANUO9l7HvBp4Kekjc9apMNXWwIzSuorP0b9K+AfgQuBmcBk4BRJ60dEeSDsnL3HOcArwNeA
X0jaICJeqvZDWoG+jeRyy0s6Hvg+8J/ABcA62fv9XtL2EfFyNt/uWR+eIf2s5mR9/gTp5wzpZzcR
uDibvjXpsM1WwI511r1CklYCJrDs/0eleUYDvwc2Jv3uZgOfAaZJGhcRPwXmkQ6pnQv8MvsC+FOj
ardMRPjLX0QEwGGkDfiupA3sPwAHkP5AXwXWK5lvKXAboLJ1XAg8BbyjrP1y4EVgVPb6iGwdX1tB
TUuB75a8fgk4awXLXAI8VvL6k9l6jiub70rS+YeJZe+3ENiopO29WfvUAfwMT8h+hptmP8MNsr6+
BjwLjC6ZdwPgDeDYsnVsBSzuq5e05/4Y8Ciwej/vPapC2wFZPTtV+D1vUNJ2K3DLAPr3OHBd1re1
gPeRgnwJcHq19QHHZPMcWNI2ErgDmA+MzdrWKv+d+6vxXz40ZOUE3Eza+P+NtAF/GfhURDxbMl8A
F0T211vi06RPriMlrdX3BdwIvAOYVDLfPOBnNdb3d+CDktarYZkppA3+T8vaTyVtZKeUtf8uImb3
vYiI+0k/g40H+H4CHiL1bzZwEfAwMCWWP9m+bzbvVWU/q+ey+XfN5psEbAScERGvVHvTiHj9rQLS
Ybe1SHtnYtnPPQ+TSX2bR9oL2xeYDhzXzzJTgDkR8Z8l9fbtNa5G2luzFvGhISsXwFTShuhNYG5E
PFRl3tmlLyStQ9rYf4l0SKLSuvuGoW4CPBQRtQ7z/DYwDfibpB7gt8D0iOjvuoENgWci4rWy9lkl
00v9jbd7CVgTQNLKQPlx9+dKQjFIQfcKyw71TATKR1y9hxREj1R4vyDtFUAKoAD+UmG+t0haEziR
tBdQOtw3gDyHrt4NHJ99vwCYFdkhrH5sSPo/VW4WKajKfwfWRA4Cq+SPsWzUUH8Wlr3u28P8OXBp
lWUGdbw3Iq6SdDuwD7AH8C3gWEn7RMQNg1l3iWojjvpGtHyYdOgjsrYgbeifLJn3D5GNGpL0a+B+
4DKgo2SeEaTDIHtS+bqHV2us+yrgQ8CPSedBXs3e4wbyHRjyfETcmuP6rMUcBJaneaRPwSMjYkVX
lT4KfEDSyOwQwYBFGqVyLnCupLVJ49qPJ23wKnkC2E3S2LK9gi1LptdiJvCxsrY5/dT7mqTvkYbi
7h8RV2aTHiUFyeyIqLRXQNl825BGcL2NpHcA/wR8JyJOKml/T6X5W+AJ0rmWcuW/Az9EvQV8jsBy
kx3muRrYV9LW5dOzjXafq0mHTb4y0PVLGiFpjbL3fJ40kmZUP4v+lvShp/y9ukifxK8baA3Ze/49
Im4p+1rR9Q6XAU8Dx5a0/TJ7/xMqLVAy7LOXdJL266p+dXJfmJb/TXfRHhvX3wLrSjqgr0HSSNKF
dq+QRhRBOtQE6RCjNYn3CKzcQC/oqTbfccBHgXskXQA8QDqe3kH6xNoXBtOBQ4HTJH2QNM5+NdJV
uGdHxK8qrHt14ClJv2DZoY/dgR2Ab/RT669Ih3JOyq5R6Bs+uhdppEvD70sUEW9KOpM0ZHWPiLgx
Ih6T9H+BH2R1XUPaKG4MfIo0VPa0iAhJRwHXAjMkXUIagbQFsFVETImIV7JDZt+WtAopdPYgnWRu
h4u0ziedN5omaQeWDR/dETimb08tIhZJegA4QNLDpJFmf46Ifs+P2OA4CKzcQD89VpwvIp6T9AHg
u6Tj+EeRxpf/hXSit2++pZKmkA7pHEQ6ufoCKRDuL3ufvvdaAJxN2sDtw7ITrUfF229t8FZ92YZ0
L9J4/QOAw0kbom9FxOkVlqvUt3rueVTufFJ/jyONoiIifiTpIdIn974Lp/4GXE/a8Pf14UZJu5L2
Hr5B6vujLH8lbydpZNRU0sb/BtJonWcGWPtA56n5/0i2gf9H4IekDwBrkEZWHR4R/1G23OdJ/TgN
WIV0nYqDoIH09tF/ZmZWJD5HYGZWcA4CM7OCcxCYmRWcg8DMrOAcBGZmBVeY4aPZDbgmk4YNNvsp
W2ZmjTCadK3IDRFR9TbgK9Tq259mw1d3Jo2Zfpp0peXeA1jmo0APaaP+V+CwFcx/EMvGQPvLX/7y
13D6Omgw2+B22SMYS7qd7UUsexhFVZI2An5NenDIQaT7vlwo6ZmI+F2VxWYD/PznP2fLLbesMsvw
09XVxemnl18zNbwVsc9QzH4Xsc+wrN+zZs3ikEMOgbI7AdeqLYIgIq4nXUmJpIFcDn8U6cEjfVeq
PiTpI6SrM6sFwSKALbfckkmT8rw1e3sbN25cofoLxewzFLPfRewzVOz3oA53D9WTxR8Cbipru4EG
Po7PzGy4aos9gjqsC8wta5sLrCFpVOmTmsp1dsKYMQ2tra089hhsv32rq2iuIvYZitnvodjnCJgw
Aa69FgZ0/KMJhmoQ1O2vf211Bc03Y8aK5xluithnKGa/h2KfZ86EzTaDhys9s60FhmoQzAHGl7WN
B17ub28AQOqi/JbuI0Z0MnJkZ74VtoklSzoZObLVVTRXEfsMxez3UOvz6yVbp0ceSXsE48fDfffB
eit4Cnd3dzfd3d0APP300+y9997Mnz8/l7ra7u6jkpaSHpR+bT/z/JD0IPBtS9ouB94RER+vsswk
oKenp6eQJ5fMrPUWL4ZRVR6hNH582kNYffWBr6+3t5eOjg6AjgE+XraitjhZLGmspG0lbZc1bZy9
npBNP1lS6TNwz83m+ZGkzSVNBfYj3b/czKwtrbJKOpS1wQZvnzZ3LqyxBlx2WfPraosgID1h6j7S
BWIBnEp6PN/3sunrAhP6Zo6I2cAnSNcPzCANG/18RJSPJDIzayvbbgtPPJH2Dk466e3TDzkEvvzl
dFK5Wdru0FCj+NCQmbWjN9+Ez3wGrrnm7dOWLu1/ZNGwOjRkZlZUK60E//VfcPvtb5/2wAPNqcFB
YGbWBnbeOV0XUWrx4ua8t4PAzKxNTJwIRx217HWzjtw7CMzM2lQ6/N94DgIzszay5prLv77zzsa/
p4PAzKyN/Nu/Lf96zz0b/54OAjOzNiLBpSWXz77yChx/fGPf00FgZtZmOstuffaznzX2/RwEZmZt
ZuWVYdasZa9ffnn513lzEJiZtaEttlj+jqRTpjTuvRwEZmZt6itfac77OAjMzNrUv/5rc56o6CAw
M2tja6yR/n3iicZdaewgMDNrY3PmLPu+UY+2dBCYmbWx0ofYLFzYmPdwEJiZtbFGjhbq4yAwMys4
B4GZWcE5CMzMCs5BYGZWcA4CM7OCcxCYmRWcg8DMrOAcBGZmBecgMDMrOAeBmVnBOQjMzArOQWBm
VnAOAjOzgnMQmJkVnIPAzKzgHARmZgXnIDAzGyJOOqkx63UQmJm1sU02Wfa9n1lsZlZAU6cu+37k
yMa8h4PAzKyNjR0LK62Uvn/ggca8h4PAzGyIWLgQTjkl//U6CMzM2lzpIaGbb85//Q4CM7M2d8YZ
jV2/g8DMrM0deGBj1+8gMDMrOAeBmVnBOQjMzArOQWBmVnAOAjOzgnMQmJkVnIPAzKzgHARmZgXn
IDAzKzgHgZlZwbVNEEg6WtLjkhZKulvS+1cw/8GSZkh6TdIzki6S9M5m1WtmNly0RRBIOgA4FTgB
2B6YCdwgae0q8+8EXApcAGwF7Ad8ADi/KQWbmQ0jbREEQBdwXkRMj4gHgSOBBcDnqsz/IeDxiDg7
Ip6IiDuB80hhYGZmNWh5EEhaGegA3rrLdkQEcBOwY5XF7gImSJqSrWM88BngN42t1sxs+Gl5EABr
AyOBuWXtc4F1Ky2Q7QEcAlwhaTHwLPAS8JUG1mlmNiyt1OoC6iFpK+BM4ETgRmA94Cekw0Nf6G/Z
rq4uxo0bt1xbZ2cnnZ2dDanVzCwf3UA3vb2w996pZf78+bmsWekoTOtkh4YWAPtGxLUl7dOAcRGx
T4VlpgOjI2L/kradgD8A60VE+d4FkiYBPT09PUyaNCn/jpiZNcjf/w5rrpm+nzwZrr8+fd/b20tH
RwdAR0T01rv+lh8aiog3gB5gt742Scpe31llsTHAm2VtS4EA1IAyzcyGrZYHQeY04IuSDpW0BXAu
aWM/DUDSyZIuLZn/V8C+ko6UNDHbGzgTuCci5jS5djOzIa0tzhFExJXZNQPfB8YDM4DJETEvm2Vd
YELJ/JdKWg04mnRu4O+kUUfHNbVwM7NhoC2CACAizgHOqTLtiAptZwNnN7ouM7N28uqr+a+zXQ4N
mZnZANxxR/7rdBCYmbW5VVdd/vXixfmu30FgZtbmRo1q7PodBGZmQ8AuuzRu3Q4CM7OCcxCYmRWc
g8DMrOAcBGZmBecgMDMrOAeBmVnBOQjMzIaYpUvzXZ+DwMxsCCh9dMypp+a7bgeBmdkQUHqzuQce
yHfdDgIzsyHgpJOWfT8i5y23g8DMbAjYdNPGrdtBYGZWcA4CM7OCcxCYmRWcg8DMrOAcBGZmBecg
MDMrOAeBmVnBOQjMzArOQWBmVnAOAjOzglupnoUkTQR2BjYExgDzgPuAuyJiUX7lmZlZo9UUBJIO
Bo4BdgDmAs8AC4F3ApsAiyRdBvwoIp7IuVYzM2uAAQeBpPuAxcA0YN+I+FvZ9FHAjsCBwL2SpkbE
VTnWamZmDVDLHsFxEXFDtYkR8TpwG3CbpOOBjQZXmpmZNcOAg6C/EKgw7wvAC3VVZGZmTZXrqCFJ
kyT9Os91mplZY9UcBJImS/qJpB9I2jhr20LSNcAf61mnmZm1Tk0bbUmfB64DDgOOBe6WdAhwFzAH
2CYiPp57lWZm9pZf/jLf9dX66f0Y4NiIWAfYH1gbmAq8NyKOjIhZ+ZZnZmblFizId321BsEmQN+Q
0F8CbwL/HBFP5VqVmZktZ+LExq271iBYFVgAEBEBvA48m3dRZma2vJEjYeON0/err57vuuu5xcQX
JL1asvzhkp4vnSEizhp0ZWZmtpzRoxuz3lqD4EngiyWv5wCfLZsnAAeBmdkQUVMQRMRGDarDzMxa
xGP+zcwKruZzBJJGAIcDnybdTyiAx4FfAP+RnUQ2M7MhotYLygRcC1wI/ANwP/AX0nMJpgH/lXN9
ZmbWYLXuERwO7ALsFhG3lk6Q9E/ANZIOjYjpOdVnZmYNVus5gk7gB+UhABARtwA/BA7OozAzM2uO
WoPgfcD1/Uy/Dti2/nLMzKzZag2Cd5IeUVnNXGDN+ssxM7NmqzUIRpLuL1TNEuq7WtnMzFqk1o22
gGmSXq8yfdQg6zEzsyarNQimk64bWNE8ZmY2RNR6i4nDG1SHmZm1SK0XlG2cXVSWO0lHS3pc0kJJ
d0t6/wrmX0XSSZJmS1ok6TFJhzeiNjOz4azWk8UPA+v0vZB0haTxgy1C0gHAqcAJwPbATOAGSWv3
s9hVwK7AEcBmpGscHhpsLWZmRVNrEJTvDXwcGJtDHV3AeRExPSIeBI4kPQDncxWLkPYEdgY+HhG3
RsSTEXFPRNyVQy1mZoXS8ruPSloZ6ABu7mvLblx3E7BjlcX2Au4FjpX0lKSHJJ0iqUGPbTAzG75q
HTUUvH3U0GDvNro26fqE8gvV5gKbV1lmY9IewSLgU9k6/p10wdvnB1mPmVmhDPY6gtHAuZJeK50p
Ij6dR3H9GAEsBQ6KiFcBJH0DuErS1Iiodp0DXV1djBs3brm2zs5OOjs7G1mvmdmgdHd38+ST3QAs
WAB77w3z58/PZd2q5fEBki4ZyHwRcUQN61yZdD5g34i4tqR9GjAuIvapsMw04MMRsVlJ2xakW2Jv
FhGPVlhmEtDT09PDpEmTBlqemVnb2HpreOCB9PD6l1+G3t5eOjo6ADoiorfe9dZ6HcGAN/A1rPMN
ST3AbqRnHfQ992A3qj/7+A5gP0ljImJB1rY5aS/hqbxrNDMbzgZ9slhSp6TBjhw6DfiipEOzT/bn
AmNID7tB0smSLi2Z/3LgBeASSVtK2gX4MXBRf4eFzMzs7fK4Qdx5wD3AY/WuICKuzK4Z+D4wHpgB
TI6Iedks6wITSuZ/TdLuwE+BP5JC4QrgO/XWYGZWVHkEQS5XGkfEOcA5Vaa97ZBURPwVmJzHe5uZ
FVnLryMwM7PWyiMIpgBP57AeMzNrgUEfGoqI/8mjEDMza41cDw1lI3jqPmlsZmbNl/c5glWADXNe
p5mZNVBNh4YknbaCWdZZwXQzM2sztZ4jOIY0xv/lKtNXG1w5ZmbWbLUGwSPA6RHx80oTJW0H9Ay6
KjMza5pazxHcS3p2QDVBTheYmZlZc9S6R/BNYFS1iRExE1+kZmY2pNR699E5jSrEzMxaY8Cf3rNb
Q5uZ2TBTy2Gcv0g6UNIq/c0kaVNJ/y7puEHWZmZmTVDLoaGvAj8CzpH0O9KJ42dIzw1eE9gK+Aiw
NfAz0jOEzcyszQ04CCLiZmAHSR8BDgAOJl1FvCrwPHAfMB24LCJeakCtZmbWADXfdC67yZxvNGdm
Nkx4qKeZWcE5CMzMCs5BYGZWcA4CM7OCcxCYmRVc3Y+qlDQCeA/wLsoCJSJuH2RdZmbWJHUFgaQP
AZeTriMov/VEACMHWZeZmTVJvXsE55KuLP4E8Cxp429mZkNQvUGwKbBfRDySZzFmZtZ89Z4svod0
fsDMzIa4evcIfgqcKmld4H7gjdKJEfGnwRZmZmbNUW8QXJ39e3FJW99jKn2y2MxsCKk3CCbmWoWZ
mbVMXUEQEU/kXYiZmbXGYC4o2wT4OrBl1vQAcGZEPJpHYWZm1hx1jRqSNJm04f8A8Kfs64Okx1nu
nl95ZmbWaPXuEfwQOD0ilnsusaQfkh5n+bvBFmZmZs1R73UEWwIXVWi/mPTsYjMzGyLqDYJ5wHYV
2rcDnqu/HDMza7Z6Dw1dAJwvaWPgzqxtJ+BY4LQ8CjMzs+aoNwj+H/AK8E3g5KztGeBE4KzBl2Vm
Zs1S73UEAZwOnC5p9aztlTwLMzOz5qj7OoI+DgAzs6FtwEEgqRfYLSJeknQf/TyDICIm5VGcmZkt
s9Za8K53wWqr5bveWvYI/ht4Pfv+mnzLMDOzFbm9QQ8BHnAQRMT3Kn1vZmZDW723mJgg6d0lrz8g
6QxJX8qvNDMza4Z6Lyi7HNgVIHs4zU2k+w6dJOm7OdVmZmZNUG8QbAP8b/b9/sD9EfFh4GDg8Bzq
MjOzJqk3CFZm2YnjjwHXZt8/CKw32KLMzKx56g2CvwBHStoZ2B24PmtfH3ghj8LMzKw56g2CY4Ev
A7cB3RExM2vfm2WHjMzMbAio9xYTt0laG1gjIl4qmXQ+sCCXyszMrCnq3SMgIpaUhQARMTsi6roN
taSjJT0uaaGkuyW9f4DL7STpjezKZzMzq1Fb3GJC0gHAqcCXSIeWuoAbJG0WEc/3s9w44FLS8NXx
tbynmZkl7XKLiS7gvIiYDiDpSOATwOeAH/ez3LnAZcBS4JM512RmVggtv8WEpJWBDuAHJesPSTcB
O/az3BHARNK1C9/Jqx4zs6Kp62Rxdvx+RETcU9b+QWBJRNxbw+rWBkYCc8va5wKbV3n/TUnB8ZGI
WCqphrczM7NS9Z4sPpt0zUC5f8imNYykEaTDQSdExKN9zY18TzOz4azeB9NsBcyo0H5fNq0WzwNL
ePvJ3vHAnArzrw7sAGwnqS90RgCStBjYIyJuq/ZmXV1djBs3brm2zs5OOjs7ayzbzKx5uru76e7u
Xq5t/vz5uaxb6amTNS4kvQD8n4i4q6z9w8BvImLNGtd3N3BPRByTvRbwJHBWRJxSNq+ALctWcTTp
Jnj7ArMjYmGF95gE9PT09DBpkp+bY2ZDX29vLx0dHQAdEVH3EPp69whuBE6W9MmImA8g6R2k4/a/
q2N9pwHTJPWwbPjoGGBatu6TgfUj4rDseckPlC4s6TlgUUTMqrM/ZmaFVW8QfAu4HXgiu6YAYDvS
Cd7P1rqyiLgyu1L5+6RDQjOAyRExL5tlXWBCnbWamVk/6r3FxNOS3kcaurktsBC4hHTfoTfqXOc5
wDlVph2xgmW/B/ipaWZmdah3j4CIeI10byEzMxvC6r7XkKTPSvofSc9I2jBr65LkK3zNzIaQep9Z
fBTpBO91wJqkC8IAXgK+nk9pZmbWDPXuEXwV+GJEnAS8WdJ+L/DeQVdlZmZNU28QTCRdPFbudWBs
/eWYmVmz1RsEj5OGi5bbE/BYfjOzIaTeUUOnAWdLGk26z88HJHUC/wJ8Ia/izMys8eq9juBCSQuB
fyNdAXw58AxwTET8Z471mZlZg9UcBNm9fiYAV0fEZZLGAKvV+4hKMzNrrXrOEQh4hOyWDxGxwCFg
ZjZ01RwEEbEUeBhYK/9yzMys2eodNXQccIqkbfIsxszMmq/eUUPTSSeJZ2YPg1nu/v8R8c7BFmZm
Zs1RbxB0AbU/0cbMzNpOvcNHp+Vch5mZtUhN5wgkjZD0bUl3SPqjpB9KWrVRxZmZWePVerL4eNLj
KF8BngaOAc7udwkzM2trtQbBocDUiNgzIj4F7AUcLKnu5xqYmVlr1boB34D0DAIAIuIm0knj9fMs
yszMmqfWIFgJWFTW9gawcj7lmJlZs9U6akjANEmvl7SNBs6V9FpfQ0R8Oo/izMys8WoNgksrtP08
j0LMzKw1agqCiDiiUYWYmVlreLSPmVnBOQjMzArOQWBmVnAOAjOzgnMQmJkVnIPAzKzgHARmZgXn
IDAzKzgHgZlZwTkIzMwKzkFgZlZwDgIzs4JzEJiZFZyDwMys4BwEZmYF5yAwMys4B4GZWcE5CMzM
Cs5BYGZWcA4CM7OCcxCYmRWcg8DMrOAcBGZmBecgMDMrOAeBmVnBOQjMzArOQWBmVnBtEwSSjpb0
uKSFku6W9P5+5t1H0o2SnpM0X9KdkvZoZr1mZsNFWwSBpAOAU4ETgO2BmcANktaussguwI3AFGAS
cCvwK0nbNqFcM7NhpS2CAOgCzouI6RHxIHAksAD4XKWZI6IrIn4SET0R8WhEHA88DOzVvJLNzIaH
lgeBpJWBDuDmvraICOAmYMcBrkPA6sCLjajRzGw4a3kQAGsDI4G5Ze1zgXUHuI5/BsYCV+ZYl5lZ
IazU6gIGS9JBwHeAvSPi+VbXY2Y21LRDEDwPLAHGl7WPB+b0t6CkA4Hzgf0i4taBvFlXVxfjxo1b
rq2zs5POzs4BF2xm1mzd3d10d3cv1zZ//vxc1q10OL61JN0N3BMRx2SvBTwJnBURp1RZphO4EDgg
In49gPeYBPT09PQwadKk/Io3M2uR3t5eOjo6ADoiorfe9bTDHgHAacA0ST3A/5JGEY0BpgFIOhlY
PyIOy14flE37GvBHSX17Ewsj4uXmlm5mNrS1RRBExJXZNQPfJx0SmgFMjoh52SzrAhNKFvki6QTz
2dlXn0upMuTUzMwqa4sgAIiIc4Bzqkw7ouz1rk0pysysANph+KiZmbWQg8DMrOAcBGZmBecgMDMr
OAeBmVnBOQjMzArOQWBmVnAOAjOzgnMQmJkVnIPAzKzgHARmZgXnIDAzKzgHgZlZwTkIzMwKzkFg
ZlZwDgIzs4JzEJiZFZyDwMys4BwEZmYF5yAwMys4B4GZWcE5CMzMCs5BYGZWcA4CM7OCcxCYmRWc
g8DMrOAcBGZmBecgMDMrOAeBmVnBOQjMzArOQWBmVnAOAjOzgnMQmJkVnIPAzKzgHARmZgXnIDAz
KzgHgZlZwTkIzMwKzkFgZlZwDgIzs4JzEJiZFZyDwMys4BwEZmYF5yAwMys4B4GZWcE5CMzMCs5B
YGZWcA4CM7OCcxCYmRWcg8DMrODaJggkHS3pcUkLJd0t6f0rmP+jknokLZL0V0mHNavWoaS7u7vV
JTRdEfsMxex3EfsM+fe7LYJA0gHAqcAJwPbATOAGSWtXmX8j4NfAzcC2wJnAhZJ2b0a9Q0kR/1CK
2GcoZr+L2GcYpkEAdAHnRcT0iHgQOBJYAHyuyvxHAY9FxLcj4qGIOBv4RbYeMzOrQcuDQNLKQAfp
0z0AERG7+oSLAAAHxElEQVTATcCOVRb7UDa91A39zG9mZlW0PAiAtYGRwNyy9rnAulWWWbfK/GtI
GpVveWZmw9tKrS6giUYDzJo1q9V1NNX8+fPp7e1tdRlNVcQ+QzH7XcQ+w7J+l2zPRg9mfUpHYVon
OzS0ANg3Iq4taZ8GjIuIfSos83ugJyK+UdJ2OHB6RKxZ5X0OAi7Lt3ozs7ZwcERcXu/CLd8jiIg3
JPUAuwHXAkhS9vqsKovdBUwpa9sja6/mBuBgYDawaBAlm5m1i9HARqTtW91avkcAIGl/YBpptND/
kkb/7AdsERHzJJ0MrB8Rh2XzbwTcD5wDXEwKjTOAj0dE+UlkMzPrR8v3CAAi4srsmoHvA+OBGcDk
iJiXzbIuMKFk/tmSPgGcDnwNeAr4vEPAzKx2bbFHYGZmrdMOw0fNzKyFHARmZgU3bIKgqDetq6Xf
kvaRdKOk5yTNl3SnpD2aWW8eav1dlyy3k6Q3JA3Jged1/B9fRdJJkmZn/88fy4ZZDxl19PlgSTMk
vSbpGUkXSXpns+odLEk7S7pW0tOSlkraewDLDH5bFhFD/gs4gDQk9FBgC+A84EVg7SrzbwS8CvwY
2Bw4GngD2L3VfWlwv08HvkW6pccmwEnA68C2re5Lo/pcstw44BHgOqC31f1oRr+B/wbuBHYFNgA+
COzY6r40qs/ATsCb2d/zhsCHSaMLf9HqvtTQ5z1Jg2Y+CSwB9l7B/Llsy1re8Zx+eHcDZ5a8Fmkk
0berzP8j4E9lbd3Ab1vdl0b2u8o6/gz831b3pdF9zn6/3yPd4XYoBkGt/8f3zDaa72h17U3s8zeB
h8vavgI82eq+1Nn/pQMIgly2ZUP+0FBRb1pXZ7/L1yFgddIGo+3V22dJRwATSUEw5NTZ772Ae4Fj
JT0l6SFJp0ga1K0ImqXOPt8FTJA0JVvHeOAzwG8aW21L5bItG/JBQHFvWldPv8v9MzAWuDLHuhqp
5j5L2hT4AekS/KWNLa9h6vldbwzsDGwNfAo4hnSR5tkNqjFvNfc5Iu4EDgGukLQYeBZ4ibRXMFzl
si0bDkFgdcjuvfQd4DMR8Xyr62kESSNI95c6ISIe7WtuYUnNNIJ0aOGgiLg3Iq4HvgEcNoQ+7NRE
0lakh1SdCEwCJpP2BM9rYVlDQltcWTxIz5NOqowvax8PzKmyzJwq878cEa/nW17D1NNvACQdCJwP
7BcRtzamvIaotc+rAzsA20nq+yQ8gnRUbDGwR0Tc1qBa81TP7/pZ4OmIeLWkbRYpCN8NPFpxqfZR
T5+PA+6IiNOy13+WNBX4g6TjI6L8k/NwkMu2bMjvEUTEG0DfTeuA5W5ad2eVxe4qnT+zopvWtZU6
+42kTuAi4MDsU+KQUUefXwa2AbYjPdJ0W+Bc4MHs+3saXHIu6vxd3wGsL2lMSdvmpL2EpxpUam7q
7PMY0qihUkuBYPjuCeazLWv1mfGczq7vT7qVdekwsxeAdbLpJwOXlsy/EfAK6Yz75sBUYDHwsVb3
pcH9Pijr55GkTw19X2u0ui+N6nOF5YfqqKFaf9djgSeAK4AtgV2Ah4BzW92XBvb5MNJw6CNJh4R2
It3E8s5W96WGPo8lfUjZjhRiX89eT6jS51y2ZS3veI4/wKmkW0wvJKXhDiXTLgFuKZt/F9InjoXA
w8BnW92HRvcbuJW0u13+dXGr+9HI33XZskMyCOrpN7AZaQTJq1ko/BgY1ep+NLjPR5OuHXiVtOdz
KbBeq/tRQ3//MQuAin+jjdqW+aZzZmYFN+TPEZiZ2eA4CMzMCs5BYGZWcA4CM7OCcxCYmRWcg8DM
rOAcBGZmBecgMDMrOAeBWZuQdJikl0penyDpvlbWZMXgIDADJF2SPSN2iaTF2fN9f9SCWzaXX+rv
S/+t4YbDbajN8nIdcDiwCunpWNNJ9335lxbWZNZw3iMwW+b1iJgXEU9HxLXA74Dd+yZKerekKyS9
JOkFSddI2rB0BZI+J+nPkhZJelrSWSXTuiT9SdKrkp6UdLaksc3rnlllDgKzCiRtQ7qN8eLs9Uqk
O3nOz9o/TLr97/XZNCQdBfyM9MyDrYFPAH8tWe0S4KvAVqRbK+9Kun2wWUv50JDZMntJeoX0dzGK
tOGemk07EFBEfKlvZkmfJz0T96OkB4gfD5wSET8rWeeMvm8i4qyS9iclfQf4d4b3M3VtCHAQmC1z
C+mhJqsBXcCbEXFNNu19wKZZUJQaBWwiaSawfraOiiR9jPQ4xS2ANcgCR9LoiFiUa0/MauAgMFvm
tYh4HN76tD9T0hERcQkpHO4lPeWt/LGH81jB6J7sXMKvgLOBfwVeBHYGLiSdnHYQWMs4CMwqiIiQ
9APgNEmXA72kRyfOi+UfCP8WSbNJz4/9fYXJHaRDS98qmf/A3As3q4NPFptVdxXpPMHRwGWk5+X+
t6SPSNpI0kclnSlp/Wz+E4FvSvqqpPdImiSp7/j/I8DKkr4maaKkzwJfbnJ/zCpyEJhVERFLSKOA
vp017Qw8CVwNPABcQDpH8HI2/3TSw8aPAv4MXAu8J5v2J+Ab2bruBzpJ5wvMWs7PLDYzKzjvEZiZ
FZyDwMys4BwEZmYF5yAwMys4B4GZWcE5CMzMCs5BYGZWcA4CM7OCcxCYmRWcg8DMrOAcBGZmBecg
MDMruP8PDrkd+15tVOAAAAAASUVORK5CYII=
"
>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[14]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># this sample screen is as close to perfect as you can get.</span>
<span class="c1">#</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[15]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span><span class="c1">#</span>
<span class="c1"># this is what an ideal distribution of Bayes Factors looks like</span>
<span class="c1"># BF&gt;3 to 5 are minimum-confidence essentials; &gt;10 are high-confidence.</span>
<span class="c1">#</span>
<span class="n">figure</span><span class="p">(</span><span class="n">figsize</span><span class="p">(</span><span class="mi">4</span><span class="p">,</span><span class="mi">4</span><span class="p">))</span>
<span class="n">pr_data</span><span class="o">.</span><span class="n">hist</span><span class="p">(</span><span class="s1">&#39;BF&#39;</span><span class="p">,</span> <span class="n">bins</span><span class="o">=</span><span class="mi">50</span><span class="p">,</span> <span class="nb">range</span><span class="o">=</span><span class="p">(</span><span class="o">-</span><span class="mi">100</span><span class="p">,</span><span class="mi">100</span><span class="p">))</span>
<span class="n">xlabel</span><span class="p">(</span><span class="s1">&#39;Bayes Factor&#39;</span><span class="p">)</span>
<span class="n">ylabel</span><span class="p">(</span><span class="s1">&#39;Number of Genes&#39;</span><span class="p">)</span>
<span class="n">show</span><span class="p">()</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>


<div class="output_text output_subarea ">
<pre>&lt;matplotlib.figure.Figure at 0x1128c4c90&gt;</pre>
</div>

</div>

<div class="output_area"><div class="prompt"></div>


<div class="output_png output_subarea ">
<img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZUAAAGHCAYAAAB4Rc+rAAAABHNCSVQICAgIfAhkiAAAAAlwSFlz
AAAPYQAAD2EBqD+naQAAIABJREFUeJzt3X+cHWV59/HPBUJisPzQlASRKIqGrRVl0UDKj1KxQQOe
glRjNFUSq1WTaPNIArZqEnlaSXwENAl9KEQsjWzgAY0WkaBo1VA17S60CJugFlwREjhCILJsgOR6
/rjnlNmzZ3+c2ZmdmT3f9+s1r+TM3GfOda49e66due+5x9wdERGRNOyXdwAiIjJ+qKiIiEhqVFRE
RCQ1KioiIpIaFRUREUmNioqIiKRGRUVERFKjoiIiIqlRURERkdSoqIiISGpUVETGgJm938z21S07
zex7ZvbWurb17WrLQ3nFLzJSL8g7AJEW4sCngQcAA6YA5wO3mNnZ7n5LrO1twLV1z396DGIUGRUV
FZGxdau7d9UemNmXgZ3AXCBeVO5z9+vGOjiR0dLpL5EcufsuwhHIc3nHIpIGHamIjK1DzOwlhNNf
hwMfAw4C/rmu3cSoXdxud39mDGIUScx0PxWR7JnZ+4FrGmzqA/7K3f851nYfof/FYu0cmO/u9f0s
IoWiIxWRsePAR4GfR4+nAPOA9Wa22903xdp+A1hb9/x7sg9RZHRUVETG1r/XddRvBO4E1prZze5e
61t50N2/l0uEIqOgjnqRHHk4//x94Ajg1TmHIzJqKioi+audMXhRrlGIpEBFRSRHZvYC4EzgGaA7
53BERk19KiJjx4DZZtYWPT4ceC/wKuBz7v673CITSYmKisjYcWBl7HEfsA34sLtfVddOY/2llHSd
ioiIpCb3PhUz+6SZbTWzJ6NZW79uZq+pa3NNgxlbb6lrM8HM1plZ1cx2m9mNZnZ4XZvDzOyrZvaE
mT1uZleb2UFj8T5FRFpB7kUFOBVYA5wIvAU4ALjNzF5Y1+7bhIvFpkbL3LrtlwNnAecBpwEvBW6q
a3Md0AacEbU9DbgyrTciItLqCnf6y8wmA48Ap7n7lmjdNcAh7v6OQZ5zMPAo8G53/3q0bjphNM1J
7r416hy9BzjB3e+M2pwJfAt4mbvvyPitiYiMe0U4Uql3KKGT8rG69adHp8e2mdkVZvbi2LYTCIMO
bq+tcPftQA8wM1p1EvB4raBEvhu91okpvwcRkZZUqNFfZmaE01hb3P3e2KZvE05l3U80/JJwY6OZ
0RXJU4Fn3P3Jul3ujLYR/ftIfKO77zWzx2JtRERkFApVVIArgD8ATo6vdPcbYg/vMbO7gV8CpxOm
uMhENPX4mYQ79fVl9ToiImNoIvAKYLO7/zbtnRemqJjZWmA2cKq7PzxUW3e/38yqwDGEorIDONDM
Dq47WpkSbSP6t3402P7Ai2Nt6p0JfLXZ9yIiUgLvJQxeSlUhikpUUP4M+GN37xlB+5cBLwFqxaeT
cOe8M4B4R/004MdRmx8Dh5rZ8bF+lTMIVzn/dJCXegBgw4YNtLW1DdJEGlmyZAmXXXZZ3mGUinKW
jPLWnO7ububNmwfR91vaci8qZnYFYXhwBXjKzKZEm55w977oOpLlhD6VHYSjk1XAfcBmAHd/0szW
A5ea2ePAbuBLwB3uvjVqs83MNgNXmdlHgAMJQ5k7hhj51QfQ1tZGe3t72m99XDvkkEOUsyYpZ8ko
b4llcko/96ICfJgwAutf69bPB64F9gLHAe8jjAx7iFBMPuPuz8baL4na3ghMAG4FFtbt8z2EGx99
F9gXtf14em9Fanbs0AjtZilnyShvxZJ7UXH3IYc1u3sf8NYR7GcPsDhaBmuzi3CnPcnYb37zm7xD
KB3lLBnlrViKeJ2KjAMnnHBC3iGUjnKWjPJWLCoqkom5c+tn0ZHhKGfJKG/FoqIimdAvevOUs2SU
t2JRURERkdSoqEgm5s+fn3cIpaOcJaO8FYuKimRi1qxZeYdQOspZMspbsaioSCZ0nrt5ylkyylux
qKiIiEhqVFRERCQ1KiqSiS1btuQdQukoZ8kob8WioiKZWL16dd4hlI5ylozyViwqKpKJjRs35h1C
6ShnyShvxZL7hJIyPk2aNGnMXqunp4dqtdpw2+TJk5k2bdqYxTIaY5mz8UR5KxYVFSm1np4epk9v
o6+vt+H2iRMnsX17d2kKi0jZqahIqVWr1aigbADq787ZTV/fPKrVqoqKyBhRn4pkYunSpWP8im1A
e91SrltAj33OxgflrVhUVCQTOjJonnKWjPJWLDr9JZlYvHjQG3COue7u7gHritiBX6SclYnyViwq
KjKOPQzsx7x5A+8grQ58kWzo9JeMY7uAfYRO/M7YsoG+vt5BhyGLSHIqKpKJbdu25R1CTH0nfjE7
8IuVs/JQ3opFRUUysWzZsrxDKB3lLBnlrVhUVCQTa9euzTuE0lHOklHeikVFRTKhDvDmKWfJKG/F
oqIiIiKpUVEREZHUqKhIJlatWpV3CKWjnCWjvBWLiopkore38azBMjjlLBnlrVhUVCQTK1euzDuE
0lHOklHeikVFRUREUqOiIiIiqVFRkUxoXq3mKWfJKG/FoqIimViwYEHeIZSOcpaM8lYsKiqSiRUr
VuQdQukoZ8kob8WioiKZaG9vzzuE0lHOklHeikVFRUREUqOiIiIiqVFRkUysX78+7xBKRzlLRnkr
FhUVyURXV1feIZSOcpaM8lYsKiqSiXXr1uUdQukoZ8kob8WioiIiIqlRURERkdSoqIiISGpUVCQT
lUol7xBKRzlLRnkrlhfkHYCMT4sWLUp9nz09PQMmD+zu7k79dfKSRc5agfJWLCoqkolZs2alur+e
nh6mT2+jr2/83uUv7Zy1CuWtWFRUpBSq1WpUUDYAbbEttwCfzicoERlARUVKpg2ITyA4fk5/iYwH
6qiXTGzatCnvEEpHOUtGeSsWFRXJREdHR94hlI5ylozyViwqKpKJ66+/Pu8QSkc5S0Z5K5bci4qZ
fdLMtprZk2a208y+bmavadDus2b2kJn1mtl3zOyYuu0TzGydmVXNbLeZ3Whmh9e1OczMvmpmT5jZ
42Z2tZkdlPV7FBFpFbkXFeBUYA1wIvAW4ADgNjN7Ya2BmV0ILAI+BMwAngI2m9mBsf1cDpwFnAec
BrwUuKnuta4j9PSeEbU9Dbgy/bckItKach/95e6z44/N7HzgEeAEYEu0+uPAxe5+c9TmfcBO4Bzg
BjM7GFgAvNvdfxC1mQ90m9kMd99qZm3AmcAJ7n5n1GYx8C0zu8Ddd2T8VkVExr0iHKnUOxRw4DEA
MzsamArcXmvg7k8CPwVmRqveSCiQ8TbbgZ5Ym5OAx2sFJfLd6LVOzOKNtLL58+fnHULpKGfJKG/F
UqiiYmZGOI21xd3vjVZPJXzx76xrvjPaBjAFeCYqNoO1mUo4Avof7r6XULymIqnSVc7NU86SUd6K
JffTX3WuAP4AODnvQGR05s6dm3cIpaOcJaO8FUthjlTMbC0wGzjd3R+ObdoBGOFoJG5KtK3W5sCo
b2WoNvWjwfYHXhxr09Ds2bOpVCr9lpkzZw646Oq2225rOGPqwoULB9xHu6uri0qlMmCCxOXLl7Nq
1ap+63p6eqhUKmzbtq3f+jVr1rB06dJ+63p7e6lUKmzZsqXf+o6OjoanCebMmVOq9wG3Ao1Od1wE
1F8Ed3eDdgCXDFijn4fex3h8Hx0dHVQqFY488khmzJhBpVJhyZIlA2JPlbvnvgBrgV8Drxxk+0PA
ktjjg4GngXfGHu8Bzo21mQ7sA2ZEj48F9gLHx9rMAp4Dpg7yuu2Ad3Z2uuSrs7PTAYdOB48tGwZZ
P9S2sC/9XKUVPf+7RLtn8H2e+5GKmV0BvBd4D/CUmU2JlomxZpcDnzKzt5vZ64BrgQeBb8D/dNyv
By41s9PN7ATgy8Ad7r41arMN2AxcZWZvMrOTCUOZO1wjv1I38AhDhqOcJaO8FUvuRQX4MOFI418J
RyS15V21Bu6+mlAAriSM+noh8DZ3fya2nyXAzcCNsX2dV/da7wG2EUZ93Qz8EPirlN+PAKtXr847
hNJRzpJR3ool9456dx9RYXP3FcCKIbbvARZHy2BtdgHzmotQkti4cWPeIZSOcpaM8lYsRThSkXFo
0qRJeYdQOspZMspbsaioiIhIalRUREQkNSoqkon6cfUyPOUsGeWtWFRUJBPTpk3LO4TSUc6SUd6K
RUVFMrF48aCD8GQQylkyyluxqKiIiEhqVFRERCQ1KiqSifpJ8WR4ylkyyluxqKhIJpYtW5Z3CKWj
nCWjvBWLiopkYu3atXmHUDrKWTLKW7GoqEgmNMyzecpZMspbsaioiIhIalRUREQkNSoqkon6W6XK
8JSzZJS3YlFRkUz09vbmHULpKGfJKG/FoqIimVi5cmXeIZSOcpaM8lYsud/5USQv3d3dA9ZNnjxZ
o4lERkFFRVrQw8B+zJs38M7SEydOYvv2bhUWkYR0+ksyUa1W8w5hCLuAfcAGoDO2bKCvrze32Iud
s+JS3opFRUUysWDBgrxDGIE2oD22tOUaTTlyVjzKW7GoqEgmVqxYkXcIpaOcJaO8FYuKimSivb09
7xBKRzlLRnkrFhUVERFJjYqKiIikRkVFMrF+/fq8Qygd5SwZ5a1YVFQkE11dXXmHUDrKWTLKW7Go
qEgm1q1bl3cIpaOcJaO8FYuKioiIpKbpomJm7zezs2KPV5vZLjP7NzN7ebrhiYhImSQ5Uvkb4GkA
M5sJLASWAVXgsvRCExGRsklSVI4CfhH9/xzgJnf/R+CTwKlpBSblVqlU8g6hdJSzZJS3YklSVH4H
vCT6/yzgO9H/+4AXphGUlN+iRYvyDqF0lLNklLdiSTL1/XeAq83sTuA1wC3R+tcCD6QUl5TcrFmz
8g6hdJSzZJS3YklSVBYC/5twGuw8d/9ttP4EoCOtwKR19fT0DJjOvNENtUSkeJouKu6+CxhwvOnu
y1OJSFpaT08P06e30den+46LlFGi61TM7FQz2xANIz4yWvcXZnZKuuFJWW3atCnR86rValRQ6m+g
dXF6wRVU0py1OuWtWJJcp3IesJkwrLgdmBBtOoQw3FiEjo7Rngmtv4HW0aOOqehGn7PWpLwVS5Ij
lU8BH3b3DwLPxtbfQfjtF+H666/PO4TSUc6SUd6KJUlRmQ78sMH6J4BDRxeOiIiUWZKisgM4psH6
U4D/Hl04IiJSZkmKylXAF83sRMCBl5rZe4H/A/xDmsGJiEi5JCkqlwDXAbcDLyKcCrsauNLd16QY
m5TY/Pnz8w6hdJSzZJS3YklynYoDf2dmnyecBnsRcK+7/y7t4KS8dJVz85SzZJS3YklyRT0A7v4M
cG+Kscg4Mnfu3LxDKB3lLBnlrViaLipmdhBwEXAGcDh1p9Dc/ZXphCYiImWT5EjlauCPgX8GHiZ0
1ouIiCQqKm8DznL3O9IORsaPLVu2cMopmrWnGcpZMspbsSQZ/fU48Fjagcj4snr16rxDKB3lLBnl
rViSFJVPA581s0lpByPjx8aNG/MOoXSUs2SUt2JJcvrrE8CrgJ1m9gD95//C3TX/lzBpkv7maJZy
lozyVixJikrq80yb2anAUsKNvo4AznH3b8a2XwO8v+5pt7r77FibCcClwBzCzMmbgY+6+yOxNocB
a4GzgX3ATcDH3f2ptN+TiEgrSnLx48oM4jgIuAtYD3xtkDbfBs4HLHq8p2775YRBBOcBTwLrCEXj
1Fib64AphOHQBwJfAa4E5o0yfhERIflNug41s780s8+Z2Yujde21G3Y1y91vdffPuPs3eL5o1Nvj
7o+6+yPR8kQsnoOBBcASd/+Bu98JzAdONrMZUZs24EzgA+7+H+7+b8Bi4N1mNjVJ3DK4pUuX5h1C
6ShnyShvxZLkJl3HAfcBFwIX8Px09+8APpdeaAOcbmY7zWybmV1RK2aREwhHXbfXVrj7dqAHmBmt
Ogl4PCo4Nd8lXGdzYoZxt6Rp06blHULpKGfJKG/FkuRI5VLgK+7+aqAvtv4W4LRUohro28D7gDcD
ywgXX95iZrWjmqnAM+7+ZN3zdkbbam0eiW90972E4dE6UknZ4sWL8w6hdJSzZJS3YknSUf8m4K8a
rP8NGX05u/sNsYf3mNndwC+B04HvZ/GaIiLSvCRHKnuAgxusfw3w6OjCGRl3vx+o8vzNwnYAB0Z9
K3FTom21NofHN5rZ/sCLY20amj17NpVKpd8yc+ZMNm3qPxDutttuo1KpDHj+woULWb9+fb91XV1d
VCoVqtVqv/XLly9n1apV/db19PRQqVTYtm1bv/Vr1qwZcD65t7eXSqXCli1b+q3v6OhoOEX4nDlz
Cvk+4GmgAmypW38robus3kUMHJh4d4N2EMZn1OsClgxYq5+H3keZ30dHRweVSoUjjzySGTNmUKlU
WLJk4Oc8Ve7e1EKY++vrwAHAbuBoYBrht/LyZvfXYP/7gMowbV4G7AXOjh4fTCh258baTI/2NSN6
fGz0nONjbWYBzwFTB3mddsA7OztdmtPd3Z3oeZ2dnQ44dDp4bNnQ5PokzwmvndfPO2nOWp3y1pzn
f8do91F+XzdakhypfIJwD5VHgBcCPwB+ERWYv02wP8zsIDN7vZm9IVr1yujxUdG21WZ2opm93MzO
IPxJeh/hWhQ89KWsBy41s9PN7ATgy8Ad7r41arMtan+Vmb3JzE4G1gAd7j7kkYo0b9myZXmHUDrK
WTLKW7EkuU7lCeBPzewU4DhCgely9++OIo43EvpGahX0C9H6fwI+Gr3O+wgjzR4iFIfPuHv8av4l
hCORGwkXP94KLKx7nfcQLn78LuEo5kbg46OIWwaxdu3avEMoHeUsGeWtWEZzk64tDDzhnXRfP2Do
/p23jmAfewjXnQw6FMTdd6ELHceEhnk2TzlLRnkrlhEXFTN7IXCGu98cPf4c4YigZi/waXfva/R8
EREZ/5o5Unk/cBZwc/R4EXAPYZgOhI7wh4DLUotORERKpZmO+vcC/1i37j3u/ifu/ieECSHflVpk
Umr1wyVleMpZMspbsTRTVI6h/8D/PkJnd81W4A/SCErKr7e3N+8QSkc5S0Z5K5ZmTn8dSqwPxd1/
v277fvTvY5EWtnJlFpNZj2/KWTLKW7E0c6TyIPCHQ2w/LmojIiItqpmicgvhNsIT6zdEI8OWA99K
KzARESmfZorK3xPmydpuZkvN7M+iZRmwHTgsaiMyYK4jGZ5ylozyViwjLiruvhP4I6AbuIQw/9fX
CfdQuRc4JWojwoIFC/IOoXSUs2SUt2Jp6op6D7MDvzW6QVZthuBfuPtjqUcmpbZixYq8Qygd5SwZ
5a1YEk3TEhWRrSnHIuNIe3t73iGUjnKWjPJWLInuUS8iItKIioqIiKRGRUUyUX8HPBmecpaM8lYs
IyoqZtZlZodF//+MmU3KNiwpu66urrxDKB3lLBnlrVhGeqTSBhwU/X854cZcIoNat25d3iGUjnKW
jPJWLCMd/XUXcI2ZbQEMuMDMfteoobt/Nq3gRESkXEZaVM4HVgJnE273+zbguQbtHFBRERFpUSMq
Ku6+HXg3gJntI9wB8pEsAxMRkfJpevSXu++ngiLDqVQqeYdQOspZMspbsSS6ot7MXgX8NaEDH8Lc
X19091+mFZiU26JFi/IOoXSUs2SUt2Jp+kjFzM4kFJEZwH9Fy4nAPWb2p+mGJ2U1a9asvEMoHeUs
GeWtWJIcqVwCXObuF8VXmtklwCrgO2kEJiIi5ZPkivo2oNElrF9G96gXEWlpSYrKo8AbGqx/A6AO
fAFg06ZNeYdQOspZMspbsSQpKlcB/2hmF5rZqdFyEXBltE2Ejo6OvEMoHeUsGeWtWJL0qVwM7AY+
QbjrI8BDwArgS+mEJWV3/fXX5x1C6ShnyShvxdJ0UXF3By4DLjOz34vW7U47MBERKZ9E16nUqJjI
eNTd3T1g3eTJk5k2bVoO0YiUy6iKisj48jCwH/PmzRuwZeLESWzf3q3CIjIM3aRLMjF//vy8Q0hg
F7AP2AB0xpYN9PX1Uq1WM331cuYsf8pbsehIRTJR7quc24D2MX/VcucsP8pbsTR1pGJmB5jZ7Wb2
6qwCkvFh7ty5eYdQOspZMspbsTRVVNz9WeC4jGIREZGSS9KnsgH4QNqBiIhI+SUpKi8APmJm/2Fm
V5rZpfEl7QClnLZs2ZJ3CKWjnCWjvBVLkqLyh0AX4ar61wDHx5ZGc4JJC1q9enXeIZSOcpaM8lYs
Sa6o/5MsApHxZePGjXmHUDrKWTLKW7Ekvk7FzI4xszPN7IXRY0svLCm7SZMm5R1C6ShnyShvxZLk
zo8vMbPbgfuAW4Ajok3rzewLaQYnIiLlkuRI5TLgWWAa0Btbfz3w1jSCEhGRckpSVGYBF7r7g3Xr
fw68fPQhyXiwdOnSvEMoHeUsGeWtWJIUlYPof4RS82Jgz+jCkfFCEy82TzlLRnkrliRF5UfA+2KP
3cz2A5YB308lKim9xYsX5x1C6ShnyShvxZJkQsllwO1m9kbgQGA18FrCkcrJKcYmIiIl0/SRirv/
jHDR4xbgG4TTYV8Djnf3X6YbnoiIlEmi61Tc/Ql3/zt3f5e7z3b3T7n7w2kHJ+W1bdu2vEMoHeUs
GeWtWBIVFTM7zMwuMLP10fIJM3tx2sFJeS1btizvEEpHOUtGeSuWJBc/ngY8AHwMOCxaPgbcH20T
Ye3atXmHUDrKWTLKW7Ek6ahfR7jQ8SPuvhfAzPYHroi2vS698KSsNMyzecpZMspbsSQ5/XUM8IVa
QQGI/n9ptE1ERFpUkqLSRbiJd7024D+TBGFmp5rZN83sN2a2z8wqDdp81sweMrNeM/uOmR1Tt32C
ma0zs6qZ7TazG83s8Lo2h5nZV83sCTN73MyuNrODksQsIiIDjaiomNlxtQX4EvDFqKP+lGi5gDAn
2GUJ4zgIuAv4KOANXv9CYBHwIWAG8BSw2cwOjDW7HDgLOA84DXgpcFPdrq4jFL8zoranAVcmjFmG
sGrVqmHb9PT00NXV1W/p7u4eg+iKaSQ5k4GUt2IZaZ/KXYQv+/j09o3ujHMdob+lKe5+K3ArDDqF
/seBi9395qjN+4CdwDnADWZ2MLAAeLe7/yBqMx/oNrMZ7r7VzNqAM4ET3P3OqM1i4FtmdoG772g2
bhlcb2+jmXye19PTw/TpbfT1Dd2ulQyXM2lMeSuWkRaVozONYghmdjQwFbi9ts7dnzSznwIzgRuA
NxLeS7zNdjPridpsBU4CHq8VlMh3CcXyRMKFnJKSlStXDrm9Wq1GBWUD/c+m3gJ8OsPIimu4nElj
yluxjKiouPuvsg5kCFMJX/w769bvjLYBTAGecfcnh2gzFXgkvtHd95rZY7E2MubagPbY49Y9/SUy
HiQZUoyZvRQ4BTicun4Zd/9SCnGJiEgJJbn48XzgfmA9cAGwJLb8dZrBRXYQ+nKm1K2fEm2rtTkw
6lsZqk39aLD9CRNhDtmfMnv2bCqVSr9l5syZbNq0qV+72267jUplwMA1Fi5cyPr16/ut6+rqolKp
UK1W+61fvnz5gI7Hnp4eKpXKgOko1qxZM+BeEr29vVQqFbZs2dJvfUdHB/Pnzx8Q25w5czJ5H0uX
Lh3x+4A1QP09MZ4GKoQp5uJuBQa+D7gI2FS37u4G7QC+0mBdF9DoxqXLB7TP6udRrVYz+3mMl89V
o/dx1113jYv3kcXPo6Ojg0qlwpFHHsmMGTOoVCosWbJkQOypcvemFuDXwN8C+zX73BHufx9QqVv3
ELAk9vhgwrfOO2OP9wDnxtpMj/Y1I3p8LLCXMPFlrc0s4Dlg6iCxtAPe2dnp0py3v/3tQ27v7Ox0
wKHTwWPLhpTWp7mvEGvWn4PhciaNKW/Nef53j3bP4Ds8yemvScBGd9+X4LkNRdeKHMPzo8teaWav
Bx5z918Thgt/ysx+QZgi5mLgQaLOdQ8d9+uBS83scWA3YejzHe6+NWqzzcw2A1eZ2UcI0/avATpc
I79St2LFirxDKB3lLBnlrViSFJX1wDuBS1KM442EG3zVKmjtPMQ/AQvcfbWZTSJcU3Io4UZhb3P3
Z2L7WEI4ErkRmEA4T7Kw7nXeA6wljPraF7X9eIrvQyLt7e3DN5J+lLNklLdiSVJUPgncbGZvJZy0
fja+0d3/V7M79HBtyZD9O+6+AlgxxPY9wOJoGazNLmBes/GJAA0vzJw8ebLmnhKJSVpUzgS2R4/j
V8APuBpepPweBvZj3ryBf49MnDiJ7du7VVhEIknm/voE4ZRUm7uf7u5/ElvenHaAUk71o2DKbRfh
bOkGoDO2bKCvr3fAyJ6kxlfOxo7yVixJisoe4I60A5HxpaurK+8QMlC7ULO2NJpXNbnxmbPsKW/F
kqSofJEh+i1EANatW5d3CKWjnCWjvBVLkj6VGcCbzexs4B4GdtS/I43ARESkfJIUlV3A19IORERE
yq/pouLujebIEBERSdSnIjKsRnMjydCUs2SUt2Jp+kjFzO5niOtR3P2Vo4pIxoVFixblHULpKGfJ
KG/FkqRP5fK6xwcAxwNvBT4/6ohkXJg1a1beIZSOcpaM8lYsSfpUvthovZktJMzhJSIiLSrNPpVv
A+eluD8RESmZNIvKnwOPpbg/KbH6GxvJ8JSzZJS3Ykly58c7zawrttxpZg8Dfx8tInR0dOQdQuko
Z8kob8WSpKO+/s+CfcCjwL+6e/19YqVFXX/99XmHUDrKWTLKW7Ek6ahfmUUgIiJSfrr4UUREUjPi
IxUz28fwN+Fyd09ySk1ERMaBZo5UzgXeMcjyecJ9Vp5LO0App/nzNUVcs5SzZJS3YhnxUYW7f6N+
nZlNBy4B3g58FfhMeqFJmekq5+YpZ8kob8WSqE/FzF5qZlcBdxMK0xvc/f3u/qtUo5PSmjt3bt4h
lI5ylozyVixNFRUzO8TMVgG/AF4LnOHub3f3n2USnYiIlEozHfXLgAuBHcDcRqfDRESktTVzpHIJ
MJFwlPJ+M/taoyWbMKVstmzZkncIpaOcJaO8FUszReVa4AbC/F5PDLGIsHr16rxDKB3lLBnlrVia
Gf11foaiYRScAAAU8ElEQVRxyDizcePGvEMoHeUsGeWtWHRFvWRi0qRJeYdQOspZMspbsaioiIhI
alRUREQkNSoqkomlS5fmHULpKGfJKG/FoqIimZg2bVreIZSOcpaM8lYsKiqSicWLF+cdQukoZ8ko
b8WioiIiIqlRURERkdSoqEgmtm3blncIpaOcJaO8FYuKimRi2bJleYdQOspZMspbsaioSCbWrl2b
dwilo5wlo7wVi4qKZELDPJunnCWjvBWLioqIiKRGRUVERFKjoiKZWLVqVd4hlI5ylozyViwqKpKJ
3t7evEMoHeUsGeWtWEZ8ky6RZqxcuTLvEMZMd3d3w/WTJ09uqhO5lXKWJuWtWFRUJHM9PT1Uq9V+
6wb7Ii6Xh4H9mDdvXsOtEydOYvv2bo1OkpaioiKZ6unpYfr0Nvr6xuMpil3APmAD0Fa3rZu+vnlU
q1UVFWkpKiqSiWq1yuTJk6lWq1FBqf/ivQX4dD7Bpa4NaB/1Xmo5k+Yob8WijnrJxIIFC+rW1L54
a8vRYx5T0Q3MmYyE8lYsKiqSiRUrVuQdQukoZ8kob8WioiKZaG8f/emgVqOcJaO8FYuKioiIpEZF
RUREUlOKomJmy81sX91yb12bz5rZQ2bWa2bfMbNj6rZPMLN1ZlY1s91mdqOZHT6276R1rF+/Pu8Q
Skc5S0Z5K5ZSFJXIz4ApwNRoOaW2wcwuBBYBHwJmAE8Bm83swNjzLwfOAs4DTgNeCtw0JpG3oK6u
rrxDKB3lLBnlrVjKdJ3Kc+7+6CDbPg5c7O43A5jZ+4CdwDnADWZ2MLAAeLe7/yBqMx/oNrMZ7r41
+/Bby7p16/IOoXSUs2SUt2Ip05HKq83sN2b2SzPbYGZHAZjZ0YQjl9trDd39SeCnwMxo1RsJBTTe
ZjvQE2sjIiKjVJai8hPgfOBM4MOEK+d+aGYHEQqKE45M4nZG2yCcNnsmKjaDtRERkVEqxekvd98c
e/gzM9sK/Ap4F7Atn6hERKReWY5U+nH3J4D7gGOAHYARjkbipkTbiP49MOpbGazNoGbPnk2lUum3
zJw5k02bNvVrd9ttt1GpVAY8f+HChQNGqHR1dVGpVAbM3rt8+fIBNx3q6emhUqmwbVv/+rlmzRqW
Ll3ab11vby+VSoUtW7b0W9/R0cH8+fMHxDZnzpxM3sf06dMb3DypB6gw8O+ANcDSunVPR2231K2/
FRj4PuAiYFPdursbtAP4SoN1XcAXGqxfDvxL3bra+3iobv3A9/H000+P+OdRqVQy+3mMl89Vo/fx
lre8ZVy8jyx+Hh0dHVQqFY488khmzJhBpVJhyZIlA2JPlbuXbgFeBDwGLIwePwQsiW0/mPCt9M7Y
4z3AubE20wlTzM4Y4nXaAe/s7HRpzubNm93dvbOz0wGHTgePLRsyXj8WrzHUa4f33cxnp5YzaY7y
1pznfydp9wy+n0tx+svMPk/4c/FXwJHASuBZYGPU5HLgU2b2C+AB4GLgQeAbEDruzWw9cKmZPQ7s
Br4E3OEa+ZWJWbNm5R1C6ShnyShvxVKKogK8DLgOeAnwKOGcyEnu/lsAd19tZpOAK4FDgR8Bb3P3
Z2L7WALsBW4EJhDOoywcs3cgItICSlFU3H3uCNqsAFYMsX0PsDhaREQkA6XsqJfiq+/clOEpZ8ko
b8WioiKZ6OjoyDuE0lHOklHeikVFRTJx/fXX5x1C6ShnyShvxaKiIiIiqSlFR71IWXV3dw9YN3ny
ZKZNm5ZDNCLZU1ERycTDwH7MmzdvwJaJEyexfXu3CouMSzr9JZloNOVFa9lFmLBhA9AZWzbQ19c7
YNoOUM6SUt6KRUcqkgld5VzTRpjtZ3jKWTLKW7HoSEUyMXfusNerSh3lLBnlrVhUVEREJDUqKiIi
khoVFclE/X0eZHjKWTLKW7GoqEgmVq9enXcIpaOcJaO8FYuKimRi48aNwzeSfpSzZJS3YtGQYklF
T09Pw2svGl1RLo1NmjQp7xBKSXkrFhUVGbWenh6mT2+jr68371BEJGcqKjJq1Wo1KigbCBf7xd0C
fHrsgxKRXKhPRVJUu3q8HeiI/j0614jKZOnSpXmHUErKW7GoqEhGNFliszTBZDLKW7GoqEhGFucd
QOksXqycJaG8FYuKioiIpEZFRUREUqOiIhnZlncApbNtm3KWhPJWLCoqkpFleQdQOsuWKWdJKG/F
oqIiGVmbdwCls3atcpaE8lYsuvhRMqJhnkNpNH3N5MmTc4ik/DSkuFhUVETG1MPAfsybN2/AlokT
J7F9e7e+JKXUdPpLZEztAvYRprTpjC0b6OvrbTgpp0iZqKhIRlblHUDBxae0aWfgnGkyUqtW6bNW
JCoqkhHNWCxjo7dXn7UiUVGRjKzMOwBpEStX6rNWJCoqIiKSGhUVERFJjYYUS0aqgK67aNZg169o
mPHgqtWqrvEpEBUVycgC4Jt5B1EiDwPo+pUEFixYwDe/qc9aUej0l2RkRd4BlMyu6F9dv9KsFStW
5B2CxOhIRTLSnncAJVW7fkVGqr1d+SoSFRVpSk9Pz4C/mhv1A0i61NciZaGiIiPW09PD9Olt9PXp
YrOxo7nCpFzUpyIjVq1Wo4JSf97/4gat149laOOY5gobzvr1+qwViY5UJIH68/6NTn91AR8Ym3Ba
QrH6WhqdBq0Z69NyXV1dfOAD+qwVhYqKZGRd3gG0hMH6swb7Yh+sGDRTCIY7DTrWp+XWrdNnrUhU
VERKafC+FoAJEyZy0003csQRRzz/jIcf5rzz3smePU+PqD3Anj17mDBhQr913d3dsdOg9bMrd9PX
N49qtTqgqKRR0KT4VFRESine11L/xf4j9uz5X5x99tmDPLf+OUO13x/YO8h+Bj8lV38ENVRB04CD
8UVFRaTUGn2xd9O44NwCfLrBc4ZrP9j6RoY+ghq4r3Bk86Mf/Yi2tv7FsdFREujIpuhUVKSh0V+P
UkHTtORtJAMqRtK+mf0MdgQ1WEEbqgg1PkqqP1W3ZMkSLrvsMkAFpwhUVGSAdK5HWZRaPFJGIy1E
wxWhkZ2qO+GEEwCdSisCFRUZoP/1KCM97VFvVupxyXjWzFHSYH1JzZ9Ka3a9joSGp6IiQ2j29InI
WGnUl9T8qbRm1w91JKTRbYGKioiME82eSmt2/dDDpQc7Zdxqp+RUVCQjm4Bz8g5CWkL9Z63ZAQcj
XR9tbTBgZfBrd1pvdFvLFRUzWwhcAEwF/hNY7O7/nm9U49EqVFRkbIzVZ2244dKQxei2mrIUm5Yq
KmY2B/gC8CFgK7AE2Gxmr3H3lpyZL7up7H8/hX2IjMRYfdaGuuB0sEEs6Yxug8GLDRTrqKeligqh
iFzp7tcCmNmHgbMI975dnWdgedBU9iJJDHbBaTPPaXZ023CzJDQ/sCArLVNUzOwA4ATg72vr3N3N
7LvAzNwCGyODHZGMfuiwiKSvmaHUQw8sqO/Pyfqmei1TVIDJhHK+s279TmD6UE9s9EM49thjmTRp
0oD1Q00JntZY+WbXDzXvUqChwyLlMNRRUjP9OdlppaKSxESg4Q9lzZo1HHbYYf3WVatVli69iGef
7Rtkd/sR/toY6/U1HwDi52PvBr5B+EsnXkjuiP4dzfo7gK+mtK8k68fiNfTaxXhtfdYGf84+Bv+9
D99vaTN3z2K/hROd/uoFznP3b8bWfwU4xN3PbfCc9xA+rSIi48173f26tHfaMkcq7v6smXUCZxDN
dGhmFj3+0iBP2wy8F3gAGOzwQ0SkTCYCryB8v6WuZY5UAMzsXcBXgA/z/JDiPweOdfdHcwxNRGRc
aJkjFQB3v8HMJgOfBaYAdwFnqqCIiKSjpY5UREQkW/vlHYCIiIwfKioiIpIaFRXAzP7GzO4ws6fM
7LFB2hxlZt+K2uwws9Vmtl9dm+PM7Idm9rSZ/crMlo7NOygGM3vAzPbFlr1mtqyuzbB5bDVmttDM
7o8+Nz8xszflHVORmNnyus/VPjO7t67NZ83sITPrNbPvmNkxecWbBzM71cy+aWa/ifJTadBmyByZ
2QQzW2dmVTPbbWY3mtnhzcbS0r/MMQcANwD/0Ghj9KV3C2Fgw0nA+4HzCR3+tTa/Rxiidz/hstal
wAoz+8ssAy8YBz5FGAQxlXDF1ZraxpHksdXEJjldDhxPmDl7czSgRJ73M57/XE0FTqltMLMLCfev
/hAwA3iKkMMDc4gzLwcRBh59lPB72M8Ic3Q5YS7E84DTgJcCNzUdibtriRbCl9xjDda/DXgWmBxb
91fA48ALoscfAaq1x9G6zwH35v2+xjB/9wMfG2L7sHlstQX4CfDF2GMDHgSW5R1bURZCwe0aYvtD
wJLY44OBp4F35R17TvnaB1SayVH0eA9wbqzN9GhfM5p5fR2pjMxJwN3ef3r8zcAhwGtjbX7o7s/V
tZluZoeMTZiFcFF0+NxlZheY2f6xbSPJY8uITXJ6e22dh9/mlpjktEmvjk7t/NLMNpjZUQBmdjTh
yCWewyeBn6IcAiPO0RsJZxDibbYDPTSZRxWVkZlK44koa9tG2ma8+yLwbuB04P8Cf0O4g1KNctTf
UJOctmI+BvMTwmnSMwkXLh8N/NDMDiLkyVEOhzKSHE0BnomKzWBtRmTcXvxoZp8DLhyiiQNt7n7f
GIVUSs3k0d0vj63/mZk9A1xpZp9092czDVTGLXePTyfyMzPbCvwKeBewLZ+oZDDjtqgA/we4Zpg2
/z3Cfe0A6kfkTIltq/07ZZg2ZTSaPG4lfMZeAfyckeWxlVQJd1Zq9LlpxXyMiLs/YWb3AccA/0ro
h5pC/7/EpwB3jn10hbSD4XO0AzjQzA6uO1pp+rM4bk9/uftvo7+eh1qeG35PAPwYeF3diJxZwBPA
vbE2p9X1IcwCtrv7E6N+QzkZZR6PJ3T0PRI9HkkeW0Z09Fab5BToN8npv+UVV9GZ2YsIBeUhd7+f
8KUXz+HBwIkohwCMMEedwHN1baYD0wi/t029YMsvwFHA64HPEL7gXh8tB0Xb9yMM9fw2cBzh3O5O
4OK60RQPAf8E/AEwB/gd8IG8398Y5fAk4ONRfo4mzO68E/hyrM2weWy1hXAKpxd4H3AscCXwW+D3
846tKAvwecIQ15cDfwR8J/rcvCTavizK2duB1wGbCEfGB+Yd+xjm6KDoO+sNhD/k/jp6fNRIcwRc
QRjBeTphAMkdwI+ajiXvZBRhIZze2dtgOS3W5ijg5qhQ7CR0QO9Xt58/BH4QfUn0ABfk/d7GMIfH
E/6ieYwwBv5n0Qf5gLp2w+ax1RbCtQUPEIZ4/hh4Y94xFWkBOgjDrJ+Ofq+uA46ua7Mi+qOulzCi
8Ji84x7jHP1xVEzqv8Pif9QNmSNgAuG6siqwG/h/wOHNxqIJJUVEJDXjtk9FRETGnoqKiIikRkVF
RERSo6IiIiKpUVEREZHUqKiIiEhqVFRERCQ1KioiIpIaFRUREUmNioqMW2Z2Td19zatm9m0ze13e
sQ3FzF7e4J7se83s2pT2v3+0z9lp7E8kTkVFxrtv8/y9zd9MmIn1X3KNaGScEG/tnuxHAAtT2rel
tB/MbDzfPkMSUFGR8W6Puz/q7o+4+38BlwBHmdlLag3M7BIz225mT0W3q/1s7RYG0VHDXjNrj+/U
zP7azB6IPf5DM7vFzHab2Q4zu7buNf7czP7LzHqjI6bbzOyFQ8RtwGNR3LVld7SvF5jZejO7P9rf
NjNbNGAHZh80s3vMrM/MHjSzy6JN9xOK1s3REct9secsjHLQZ2b3mtnc2LbaEc4HzexfzOx3hElD
Rf6Hioq0jOg+HH8B/Nzdfxvb9CRh6vk24GPAXwJLANz9V4Sp1ufX7e584MvRfg8h3Nu7E2gnTOl/
OHBDtH0qYWbdqwnT2/8x8DWSHzHsT7jz4TuimC8GLjGzc2LvdTFwObAOeC1hyvNfRJvfFL32ewlH
QSdFz3kn8AXgc4QZt78M/LOZnVz3+iuj9/ZaIJVTcjJ+aJZiGbfM7BpgHtAXrTqIMPX32e5+1xDP
+wQwx91nRI/fCfwDcIS7PxsdtWwlTL/+azP7W+AUd39bbB8vI0zT/hrg94D/AF7h7r8eQdwvJxxN
9BKOKIj+PdXd/3OQ5/wDcIi7vyd6/DBwhbtf3KDt/sCzUR5uia3/CfDv7r44tu4mwq0Jzo09b7W7
XzTc+5DWpCMVGe++R7gh2OsJf6FvBm41s6NqDcxsjpltMbOHzWw38L8Jd7yr2US4V8W50ePzge/H
CsTrgTdHp752R/voJhSCVxFuTPY9wv3VbzCzvzSzQ0cQ+7t4/oZxbyB2d0wzW2xm/2Fmj0avt6AW
s5kdQehH+t7IUvQ/2hh4t8Q7ovVxnU3uV1qIioqMd0+5+/3u/t/u3gl8kHDE8kEAM5sJbCDcOOws
wpf33wEH1nbg4ba/1wLzzewAYC6wPvYaLwK+yfPFq7a8Gvihu+9z9z8F3grcAywGtkVHJEN5MIq7
tjwbxTyP0Dd0JfCW6LWujcX8dJM5atZTGe9fSkwjN6QVOVDrJJ8JPODul9Q2mtkrGjznasLdLD9K
6NP4emxbF6F/41fuvm/QF3X/MfBjM7uY0CdyLqHfY7AYB/NHhGJ1VSzmY2Kvs8vMHiTcb/yOBnHs
NbO90fuI6wZOJtxpseZkYkdIIsNRUZHxboKZTYn+fxjhKGES4cgCwn26p5nZHODfgbOBc+p34u7b
oj6HVcDV7r4ntnkdoXN/o5mtJtxS+dXAHOADhNNuZwC3AY8QOsYnM/SX9VCd+D8H3m1mbyEUp/MJ
t3O+L9ZmBfAlM/st4ZTfIcBJ7r4u2t4DvMXMthJGyO0i3At+g5n9J/B9QtGrEO4PLzIyed9bWYuW
rBbgGvrfr3sX8BPgnLp2lxC+7J8gjNL6GGE4b/3+5kf7aW+w7VXAjcBvgd8RTnN9Idp2LOF6mR2E
zvdu4CNDxP3y6HWOG2T7BOArhOJVBb4UvYetde0+HL1WH+Ee71+IbasA24E9wH2x9R8ljBLrIxS9
ObFt+0dxzc77Z6uluItGf4mMkJl9GjjP3d+QdywiRaXTXyLDMLODgKMJV7T/Tc7hiBSaRn+JDG8t
ob/le4RTaiIyCJ3+EhGR1OhIRUREUqOiIiIiqVFRERGR1KioiIhIalRUREQkNSoqIiKSGhUVERFJ
jYqKiIikRkVFRERS8/8BJuBn9yxExcgAAAAASUVORK5CYII=
"
>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span> 
</pre></div>

</div>
</div>
</div>

</div>
    </div>
  </div>
</body>
</html>