Skip to content

Latest commit

 

History

History
412 lines (353 loc) · 8.11 KB

Changelog.md

File metadata and controls

412 lines (353 loc) · 8.11 KB
Raw

0.4.6-SNAPSHOT

  • new output element named traveler to save a 2D drawing as a traveler XML file. Width and height properties define the area on which the 2D is centered.
rnartist {
    traveler {
        path = "project/outputs/"
        width = 500.0
        height = 500.0
    }

    ss {
        vienna {
            file = "project/samples/rna.vienna"
        }
    }
}

0.4.0-SNAPSHOT

  • a new element named branch can be added to the layout. It defines the x-position (the parameter value) for the helix starting this branch (defined by the parameter location)
rnartist {
    layout {
        branch {
            location {
                9 to 10
                425 to 430
            }
            value = 0.0
        }
        junction {
            out_ids = "n"
            radius = 17.83
            location {
                14 to 16
                420 to 421
            }
        }
    }
}

0.3.9-SNAPSHOT

  • for the element data, the absolute positions have to be precised without quotes (like the location elements). No changes if the values are describes in a linked text file.
rnartist {
    png {
        path = "media/"
    }
    ss {
        vienna {
            file = "project/samples/rna.vienna"
        }
    }
    data {
        1 to 200.7
        2 to 192.3
        3 to 143.6
        4 to 34.8
    }
    theme {
        details {
            value = 4
        }
    }
}

0.3.4-SNAPSHOT

  • scheme and details level are now elements. That was necessary to be able to define a step parameter (used for the undo/redo feature).
rnartist {
    theme {
        details {
            value = 4
        }
        scheme {
            value = "Persian Carolina"
        }
    }
}

0.3.3-SNAPSHOT

  • scheme and details level are now properties of the element theme
rnartist {
    theme {
        details = 4
        scheme = "Persian Carolina"
    }
}

0.3.0-SNAPSHOT

  • any location (file inputs/outputs) can be described as an absolute or relative path. If relative, the RNArtistCore engine prepends the path of its own jar.

0.2.22-SNAPSHOT

  • the element color can contain an attribute named scheme to use predefined color schemes.
rnartist {
    theme {
        color {
            scheme = "Persian Carolina"
        }
    }
}

0.2.21-SNAPSHOT

  • to avoid to mix the description of a 2D with other elements, details for a 2D are inside an element named parts
//before
rnartist {
    ss {
        rna {
            seq =
                "ACAUAGCGUUCGCGCGUGUUCCUGUAGUUAAACUUAGAGUAUCUGUACUUAGAAUUAAUGUUGGAGGCCCAACAAUGGGUGUGGAUCAAUCGUAGUUAUUU"
            name = "my RNA"
        }
        helix {
            name = "H1"
            location {
                1 to 3
                17 to 19
            }
        }
    }
}

//now
rnartist {
    ss {
        parts {
            rna {
                seq =
                    "ACAUAGCGUUCGCGCGUGUUCCUGUAGUUAAACUUAGAGUAUCUGUACUUAGAAUUAAUGUUGGAGGCCCAACAAUGGGUGUGGAUCAAUCGUAGUUAUUU"
                name = "my RNA"
            }
            helix {
                name = "H1"
                location {
                    1 to 3
                    17 to 19
                }
            }
        }
    }
}

0.2.20-SNAPSHOT

  • if the 2D has been computed from a PDB file, the new element chimera allows to export the 2D theme (residue colors) as a chimera script (cxc file). Combined with the elements svg and/or png, this allows to have 2D and 3D pictures with the same coloring scheme.
rnartist {
    chimera {
        path = "my_output_dir/"
    }

    svg {
        path = "my_output_dir/"
    }

}

0.2.19-SNAPSHOT

  • the element ss can contain an element rna and at least one element helix to describe a secondary structure.
rnartist {

  ss {
    rna {
      seq = "ACAUAGCGUUCGCGCGUGUUCCUGUAGUUAAACUUAGAGUAUCUGUACUUAGAAUUAAUGUUGGAGGCCCAACAAUGGGUGUGGAUCAAUCGUAGUUAUUU"
      name = "my RNA"
    }
    helix {
      name = "H1"
      location {
        1 to 3
        17 to 19
      }
    }
    helix {
      name = "H2"
      location {
        6 to 8
        13 to 15
      }
    }
    helix {
      name = "H3"
      location {
        23 to 25
        39 to 41
      }
    }
    helix {
      name = "H4"
      location {
        28 to 30
        35 to 37
      }
    }
    helix {
      name = "H5"
      location {
        45 to 47
        80 to 82
      }
    }
    helix {
      name = "H6"
      location {
        48 to 50
        64 to 66
      }
    }
    helix {
      name = "H7"
      location {
        53 to 55
        60 to 62
      }
    }
    helix {
      name = "H8"
      location {
        69 to 71
        76 to 78
      }
    }
    helix {
      name = "H9"
      location {
        83 to 85
        99 to 101
      }
    }
    helix {
      name = "H10"
      location {
        88 to 90
        95 to 97
      }
    }
  }
}

0.2.18-SNAPSHOT

  • the element rfam can contain an attribute named use alignment numbering. If this attribute is set, the locations described in the script will be understood as locations in the original alignment. Check this video for details
rnartist {
    ss {
        rfam {
            id = "RF02500"
            name = "AAUW01000008.1/93016-93126"
            use alignment numbering
        }
    }
}

0.2.17-SNAPSHOT

  • details_lvl in theme: not anymore an attribute of theme. It is now an element named details
//before
rnartist {
    theme {
        details_lvl = 3
    }
}

//now 
rnartist {
    theme {
        details {
            value = 3
        }
    }
}

Using the attribute location, it is now possible to link different levels of details to different parts of the 2D. Without this attribute, the level of details is applied to the full 2D. The details levels are applied one after other.

//before
rnartist {
    theme {
        details {
            value = 2
        }
        details {
            value = 3
            location {
                50 to 53
                55 to 60
                62 to 64
            }
        }
        details {
            value = 1
            location {
                25 to 28
                37 to 39
            }
        }
    }
}

Using the attribute type, you can quickly apply details levels to all the helices, junctions and/or single-strands

//before
rnartist {
    theme {
        details {
            value = 1
        }
        details {
            value = 3
            type = "helix"
        }
        details {
            value = 2
            type = "junction"
        }
    }
}

0.2.15-SNAPSHOT

  • define an RNA 2D with a bracket notation: the bracket notation becomes an element bn. It is at the same level that the input file formats (vienna, bpseq,...). Instead to precise the filename, you need to provide the bracket notation. If no sequence is set, a random one is generated, fitting the base-pairing constraints. The default name for the sequence is 'A'.
//before
rnartist {
  rna {
    sequence = "CAACAUCAUACGUACUGCGCCCAAGCGUAACGCGAACACCACGAGUGGUGACUGGUGCUUG"
  }
  bracket_notation =
    "(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
}

//now
rnartist {
    ss {
        bn {
            seq = "CAACAUCAUACGUACUGCGCCCAAGCGUAACGCGAACACCACGAGUGGUGACUGGUGCUUG"
            name = "my_rna"
            value =
                "(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
        }
    }
}
  • 2D plot saving in PNG or SVG file for the drawing algorithm rnartist: the file format is now the name of an element (svg or png) containing the saving path. The name of the RNA molecule exported is used for the filename.
//before
rnartist {
  file = "media/real_example.svg"
}

//now
rnartist {
  svg {
    path = "media/"
  }
  
  ss {
    bn {
        value = "(((...)))"
        name = "real_example"
    }
  }
}