diff --git a/CRISPResso2/CRISPRessoAggregateCORE.py b/CRISPResso2/CRISPRessoAggregateCORE.py
index 689bef98..b521dac7 100644
--- a/CRISPResso2/CRISPRessoAggregateCORE.py
+++ b/CRISPResso2/CRISPRessoAggregateCORE.py
@@ -17,10 +17,14 @@
 import traceback
 from datetime import datetime
 from CRISPResso2 import CRISPRessoShared
-from CRISPResso2 import CRISPRessoPlot
 from CRISPResso2.CRISPRessoReports import CRISPRessoReport
 from CRISPResso2.CRISPRessoMultiProcessing import get_max_processes, run_plot
 
+if CRISPRessoShared.is_C2Pro_installed():
+    from CRISPRessoPro import __version__ as CRISPRessoProVersion
+    C2PRO_INSTALLED = True
+else:
+    C2PRO_INSTALLED = False
 
 import logging
 
@@ -67,9 +71,18 @@ def main():
 
         parser.add_argument('--debug', help='Show debug messages', action='store_true')
         parser.add_argument('-v', '--verbosity', type=int, help='Verbosity level of output to the console (1-4), 4 is the most verbose', default=3)
+        
+        # CRISPRessoPro params
+        parser.add_argument('--use_matplotlib', action='store_true',
+                        help='Use matplotlib for plotting instead of plotly/d3 when CRISPRessoPro is installed')
 
         args = parser.parse_args()
 
+        if args.use_matplotlib or not CRISPRessoShared.is_C2Pro_installed():
+            from CRISPResso2 import CRISPRessoPlot
+        else:
+            from CRISPRessoPro import plot as CRISPRessoPlot
+
         CRISPRessoShared.set_console_log_level(logger, args.verbosity, args.debug)
 
         output_folder_name='CRISPRessoAggregate_on_%s' % args.name
@@ -85,7 +98,7 @@ def main():
 
         log_filename=_jp('CRISPRessoAggregate_RUNNING_LOG.txt')
         logger.addHandler(logging.FileHandler(log_filename))
-        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoAggregate_status.txt')))
+        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoAggregate_status.json')))
 
         with open(log_filename, 'w+') as outfile:
               outfile.write('[Command used]:\n%s\n\n[Execution log]:\n' % ' '.join(sys.argv))
@@ -595,7 +608,7 @@ def main():
                                 this_plot_suffix_int += 1
                                 this_plot_suffix = "_" + str(this_plot_suffix_int)
 
-                    if not args.suppress_plots:
+                    if C2PRO_INSTALLED and not args.use_matplotlib and not args.suppress_plots:
                         crispresso2_info['results']['general_plots']['allele_modification_heatmap_plot_names'] = []
                         crispresso2_info['results']['general_plots']['allele_modification_heatmap_plot_paths'] = {}
                         crispresso2_info['results']['general_plots']['allele_modification_heatmap_plot_titles'] = {}
diff --git a/CRISPResso2/CRISPRessoBatchCORE.py b/CRISPResso2/CRISPRessoBatchCORE.py
index 9f95986d..291a017f 100644
--- a/CRISPResso2/CRISPRessoBatchCORE.py
+++ b/CRISPResso2/CRISPRessoBatchCORE.py
@@ -14,10 +14,15 @@
 import traceback
 from datetime import datetime
 from CRISPResso2 import CRISPRessoShared
-from CRISPResso2 import CRISPRessoPlot
 from CRISPResso2 import CRISPRessoMultiProcessing
 from CRISPResso2.CRISPRessoReports import CRISPRessoReport
 
+if CRISPRessoShared.is_C2Pro_installed():
+    from CRISPRessoPro import __version__ as CRISPRessoProVersion
+    C2PRO_INSTALLED = True
+else:
+    C2PRO_INSTALLED = False
+
 import logging
 
 logger = logging.getLogger(__name__)
@@ -70,15 +75,7 @@ def main():
             ))
             sys.exit()
 
-        parser = CRISPRessoShared.getCRISPRessoArgParser(parser_title = 'CRISPRessoBatch Parameters')
-
-        #batch specific params
-        parser.add_argument('-bs', '--batch_settings', type=str, help='Settings file for batch. Must be tab-separated text file. The header row contains CRISPResso parameters (e.g., fastq_r1, fastq_r2, amplicon_seq, and other optional parameters). Each following row sets parameters for an additional batch.', required=True)
-        parser.add_argument('--skip_failed',  help='Continue with batch analysis even if one sample fails', action='store_true')
-        parser.add_argument('--min_reads_for_inclusion',  help='Minimum number of reads for a batch to be included in the batch summary', type=int, default=0)
-        parser.add_argument('-bo', '--batch_output_folder',  help='Directory where batch analysis output will be stored')
-        parser.add_argument('--suppress_batch_summary_plots',  help='Suppress batch summary plots - e.g. if many samples are run at once, the summary plots of all sub-runs may be too large. This parameter suppresses the production of these plots.', action='store_true')
-        parser.add_argument('--crispresso_command', help='CRISPResso command to call', default='CRISPResso')
+        parser = CRISPRessoShared.getCRISPRessoArgParser("Batch", parser_title = 'CRISPRessoBatch Parameters')
 
         args = parser.parse_args()
 
@@ -86,12 +83,12 @@ def main():
 
         debug_flag = args.debug
 
-        crispresso_options = CRISPRessoShared.get_crispresso_options()
+        crispresso_options = CRISPRessoShared.get_core_crispresso_options()
         options_to_ignore = {'name', 'output_folder', 'zip_output'}
         crispresso_options_for_batch = list(crispresso_options-options_to_ignore)
 
         CRISPRessoShared.check_file(args.batch_settings)
-        config = CRISPRessoShared.check_custom_config(args)
+        custom_config = CRISPRessoShared.check_custom_config(args)
 
         if args.zip_output and not args.place_report_in_output_folder:
             warn('Invalid arguement combination: If zip_output is True then place_report_in_output_folder must also be True. Setting place_report_in_output_folder to True.')
@@ -116,6 +113,12 @@ def main():
 
         _jp = lambda filename: os.path.join(OUTPUT_DIRECTORY, filename) #handy function to put a file in the output directory
 
+        if args.use_matplotlib or not C2PRO_INSTALLED:
+            from CRISPResso2 import CRISPRessoPlot
+        else:
+            from CRISPRessoPro import plot as CRISPRessoPlot
+        CRISPRessoPlot.setMatplotlibDefaults()
+
         try:
             info('Creating Folder %s' % OUTPUT_DIRECTORY, {'percent_complete': 0})
             os.makedirs(OUTPUT_DIRECTORY)
@@ -124,7 +127,7 @@ def main():
 
         log_filename = _jp('CRISPRessoBatch_RUNNING_LOG.txt')
         logger.addHandler(logging.FileHandler(log_filename))
-        status_handler = CRISPRessoShared.StatusHandler(_jp('CRISPRessoBatch_status.txt'))
+        status_handler = CRISPRessoShared.StatusHandler(_jp('CRISPRessoBatch_status.json'))
         logger.addHandler(status_handler)
 
         with open(log_filename, 'w+') as outfile:
@@ -179,7 +182,7 @@ def main():
                 batch_params[int_col] = batch_params[int_col].astype(int)
 
         # rename column "a" to "amplicon_seq", etc
-        batch_params.rename(index=str, columns=CRISPRessoShared.get_crispresso_options_lookup(), inplace=True)
+        batch_params.rename(index=str, columns=CRISPRessoShared.get_crispresso_options_lookup("Core"), inplace=True)
         batch_count = batch_params.shape[0]
         batch_params.index = range(batch_count)
 
@@ -298,7 +301,6 @@ def main():
 
         crispresso2_info['results']['batch_names_arr'] = batch_names_arr
         crispresso2_info['results']['batch_input_names'] = batch_input_names
-
         CRISPRessoMultiProcessing.run_crispresso_cmds(crispresso_cmds, n_processes_for_batch, 'batch', args.skip_failed, start_end_percent=[10, 90])
 
         run_datas = [] # crispresso2 info from each row
@@ -393,6 +395,8 @@ def main():
         crispresso2_info['results']['general_plots']['allele_modification_line_plot_labels'] = {}
         crispresso2_info['results']['general_plots']['allele_modification_line_plot_datas'] = {}
 
+        large_plot_cutoff = 300
+
         percent_complete_start, percent_complete_end = 90, 99
         percent_complete_step = (percent_complete_end - percent_complete_start) / len(all_amplicons)
         # report for amplicons
@@ -573,7 +577,7 @@ def main():
                         sub_modification_percentage_summary_filename = _jp(amplicon_plot_name + 'Modification_percentage_summary_around_sgRNA_'+sgRNA+'.txt')
                         sub_modification_percentage_summary_df.to_csv(sub_modification_percentage_summary_filename, sep='\t', index=None)
 
-                        if not args.suppress_plots and not args.suppress_batch_summary_plots:
+                        if not args.suppress_plots and not args.suppress_batch_summary_plots and (nucleotide_percentage_summary_df.shape[0] / 6) < large_plot_cutoff:
                             # plot for each guide
                             # show all sgRNA's on the plot
                             sub_sgRNA_intervals = []
@@ -604,11 +608,11 @@ def main():
                             nucleotide_quilt_input = {
                                 'nuc_pct_df': sub_nucleotide_percentage_summary_df,
                                 'mod_pct_df': sub_modification_percentage_summary_df,
-                                'fig_filename_root': this_window_nuc_pct_quilt_plot_name,
+                                'fig_filename_root': f'{this_window_nuc_pct_quilt_plot_name}.json' if not args.use_matplotlib and C2PRO_INSTALLED else this_window_nuc_pct_quilt_plot_name,
                                 'save_also_png': save_png,
                                 'sgRNA_intervals': sub_sgRNA_intervals,
                                 'quantification_window_idxs': include_idxs,
-                                'custom_colors': config['colors'],
+                                'custom_colors': custom_config['colors'],
                             }
                             debug('Plotting nucleotide percentage quilt for amplicon {0}, sgRNA {1}'.format(amplicon_name, sgRNA))
                             plot(
@@ -623,7 +627,7 @@ def main():
                             crispresso2_info['results']['general_plots']['summary_plot_labels'][plot_name] = 'Composition of each base around the guide ' + sgRNA + ' for the amplicon ' + amplicon_name
                             crispresso2_info['results']['general_plots']['summary_plot_datas'][plot_name] = [('Nucleotide frequencies', os.path.basename(nucleotide_frequency_summary_filename)), ('Modification frequencies', os.path.basename(modification_frequency_summary_filename))]
 
-                            if args.base_editor_output:
+                            if args.base_editor_output and (sub_nucleotide_percentage_summary_df.shape[0] / 6) < large_plot_cutoff:
                                 this_window_nuc_conv_plot_name = _jp(amplicon_plot_name + 'Nucleotide_conversion_map_around_sgRNA_'+sgRNA)
                                 conversion_map_input = {
                                     'nuc_pct_df': sub_nucleotide_percentage_summary_df,
@@ -633,7 +637,7 @@ def main():
                                     'save_also_png': save_png,
                                     'sgRNA_intervals': sub_sgRNA_intervals,
                                     'quantification_window_idxs': include_idxs,
-                                    'custom_colors': config['colors']
+                                    'custom_colors': custom_config['colors']
                                 }
                                 debug('Plotting nucleotide conversion map for amplicon {0}, sgRNA {1}'.format(amplicon_name, sgRNA))
                                 plot(
@@ -656,11 +660,11 @@ def main():
                         nucleotide_quilt_input = {
                             'nuc_pct_df': nucleotide_percentage_summary_df,
                             'mod_pct_df': modification_percentage_summary_df,
-                            'fig_filename_root': this_nuc_pct_quilt_plot_name,
+                            'fig_filename_root': f'{this_nuc_pct_quilt_plot_name}.json' if not args.use_matplotlib and C2PRO_INSTALLED else this_nuc_pct_quilt_plot_name,
                             'save_also_png': save_png,
                             'sgRNA_intervals': consensus_sgRNA_intervals,
                             'quantification_window_idxs': include_idxs,
-                            'custom_colors': config['colors'],
+                            'custom_colors': custom_config['colors'],
                         }
                         debug('Plotting nucleotide quilt for {0}'.format(amplicon_name))
                         plot(
@@ -674,7 +678,7 @@ def main():
                             crispresso2_info['results']['general_plots']['summary_plot_titles'][plot_name] = ''
                         crispresso2_info['results']['general_plots']['summary_plot_labels'][plot_name] = 'Composition of each base for the amplicon ' + amplicon_name
                         crispresso2_info['results']['general_plots']['summary_plot_datas'][plot_name] = [('Nucleotide frequencies', os.path.basename(nucleotide_frequency_summary_filename)), ('Modification frequencies', os.path.basename(modification_frequency_summary_filename))]
-                        if args.base_editor_output:
+                        if args.base_editor_output and (sub_nucleotide_percentage_summary_df.shape[0] / 6) < large_plot_cutoff:
                             this_nuc_conv_plot_name = _jp(amplicon_plot_name + 'Nucleotide_conversion_map')
                             conversion_map_input = {
                                 'nuc_pct_df': nucleotide_percentage_summary_df,
@@ -684,7 +688,7 @@ def main():
                                 'save_also_png': save_png,
                                 'sgRNA_intervals': consensus_sgRNA_intervals,
                                 'quantification_window_idxs': include_idxs,
-                                'custom_colors': config['colors']
+                                'custom_colors': custom_config['colors']
                             }
                             debug('Plotting nucleotide conversion map for {0}'.format(amplicon_name))
                             plot(
@@ -706,20 +710,20 @@ def main():
                         nucleotide_quilt_input = {
                             'nuc_pct_df': nucleotide_percentage_summary_df,
                             'mod_pct_df': modification_percentage_summary_df,
-                            'fig_filename_root': this_nuc_pct_quilt_plot_name,
+                            'fig_filename_root': f'{this_nuc_pct_quilt_plot_name}.json' if not args.use_matplotlib and C2PRO_INSTALLED else this_nuc_pct_quilt_plot_name,
                             'save_also_png': save_png,
-                            'custom_colors': config['colors'],
+                            'custom_colors': custom_config['colors'],
                         }
                         debug('Plotting nucleotide quilt for {0}'.format(amplicon_name))
                         plot(
-                            CRISPRessoPlot.plot_nucleotide_quilt,
-                            nucleotide_quilt_input,
-                        )
+                                CRISPRessoPlot.plot_nucleotide_quilt,
+                                nucleotide_quilt_input,
+                            )
                         plot_name = os.path.basename(this_nuc_pct_quilt_plot_name)
                         nuc_pct_quilt_plot_names.append(plot_name)
                         crispresso2_info['results']['general_plots']['summary_plot_labels'][plot_name] = 'Composition of each base for the amplicon ' + amplicon_name
                         crispresso2_info['results']['general_plots']['summary_plot_datas'][plot_name] = [('Nucleotide frequencies', os.path.basename(nucleotide_frequency_summary_filename)), ('Modification frequencies', os.path.basename(modification_frequency_summary_filename))]
-                        if args.base_editor_output:
+                        if args.base_editor_output and (sub_nucleotide_percentage_summary_df.shape[0] / 6) < large_plot_cutoff:
                             this_nuc_conv_plot_name = _jp(amplicon_plot_name + 'Nucleotide_percentage_quilt')
                             conversion_map_input = {
                                 'nuc_pct_df': nucleotide_percentage_summary_df,
@@ -727,7 +731,7 @@ def main():
                                 'conversion_nuc_from': args.conversion_nuc_from,
                                 'conversion_nuc_to': args.conversion_nuc_to,
                                 'save_also_png': save_png,
-                                'custom_colors': config['colors']
+                                'custom_colors': custom_config['colors']
                             }
                             debug('Plotting BE nucleotide conversion map for {0}'.format(amplicon_name))
                             plot(
@@ -740,7 +744,7 @@ def main():
                             crispresso2_info['results']['general_plots']['summary_plot_datas'][plot_name] = [('Nucleotide frequencies', os.path.basename(nucleotide_frequency_summary_filename)), ('Modification frequencies', os.path.basename(modification_frequency_summary_filename))]
 
                 # allele modification frequency heatmap and line plots
-                if not args.suppress_plots and not args.suppress_batch_summary_plots:
+                if C2PRO_INSTALLED and not args.use_matplotlib and not args.suppress_plots and not args.suppress_batch_summary_plots and (nucleotide_percentage_summary_df.shape[0] / 6) < large_plot_cutoff:
                     if guides_all_same:
                         sgRNA_intervals = [consensus_sgRNA_intervals] * modification_frequency_summary_df.shape[0]
                     else:
diff --git a/CRISPResso2/CRISPRessoCORE.py b/CRISPResso2/CRISPRessoCORE.py
index 99aa4838..9a032e85 100644
--- a/CRISPResso2/CRISPRessoCORE.py
+++ b/CRISPResso2/CRISPRessoCORE.py
@@ -30,7 +30,13 @@
 from CRISPResso2 import CRISPRessoCOREResources
 from CRISPResso2.CRISPRessoReports import CRISPRessoReport
 from CRISPResso2 import CRISPRessoShared
-from CRISPResso2 import CRISPRessoPlot
+
+if CRISPRessoShared.is_C2Pro_installed():
+    from CRISPRessoPro import __version__ as CRISPRessoProVersion
+    C2PRO_INSTALLED = True
+else:
+    C2PRO_INSTALLED = False
+
 from CRISPResso2 import CRISPResso2Align
 from CRISPResso2 import CRISPRessoMultiProcessing
 
@@ -81,13 +87,50 @@ def is_exe(fpath):
 
     return None
 
-def check_program(binary_name,download_url=None):
+
+def check_program(binary_name, download_url=None, version_flag=None, version_regex=None, version=None):
+    """Check if a program is installed and accessible.
+
+    Parameters
+    ----------
+    binary_name : str
+        Name of the binary to check.
+    download_url : str, optional
+        URL to download the program from that is displayed if not installed.
+    version_flag : str, optional
+        Flag to pass to the program to get the version.
+    version_regex : str, optional
+        Regex to extract the version from the output of the program.
+    version : str, optional
+        Version to check against.
+
+    Returns
+    -------
+    None, will exit if program is not installed.
+    """
     if not which(binary_name):
-        error('You need to install and have the command #####%s##### in your PATH variable to use CRISPResso!\n Please read the documentation!' % binary_name)
+        error('You need to install and have the command #####{0}##### in your PATH variable to use CRISPResso!\n Please read the documentation!'.format(binary_name))
         if download_url:
-            error('You can download it here:%s' % download_url)
+            error('You can download it here: {0}'.format(download_url))
         sys.exit(1)
 
+    if version_flag:
+        p = sb.Popen('{0} {1}'.format(binary_name, version_flag), shell=True, stdout=sb.PIPE, stderr=sb.STDOUT)
+        if binary_name == 'fastp':
+            p_output = p.communicate()[0].decode('utf-8')
+        else:
+            p_output = p.communicate()[1].decode('utf-8')
+        major_version, minor_version, patch_version = map(int, re.search(version_regex, p_output).groups())
+        if major_version <= version[0] and minor_version <= version[1] and patch_version < version[2]:
+            error('You need to install version {0} of {1} to use CRISPResso!'.format(version, binary_name))
+            error('You have version {0}.{1}.{2} installed'.format(major_version, minor_version, patch_version))
+            if download_url:
+                error('You can download it here: {0}'.format(download_url))
+            sys.exit(1)
+
+
+check_fastp = lambda: check_program('fastp', download_url='http://opengene.org/fastp/fastp', version_flag='--version', version_regex=r'fastp (\d+)\.(\d+)\.(\d+)', version=(0, 19, 8))
+
 def get_avg_read_length_fastq(fastq_filename):
      cmd=('z' if fastq_filename.endswith('.gz') else '' ) +('cat < \"%s\"' % fastq_filename)+\
                   r''' | awk 'BN {n=0;s=0;} NR%4 == 2 {s+=length($0);n++;} END { printf("%d\n",s/n)}' '''
@@ -113,7 +156,6 @@ def get_n_reads_bam(bam_filename,bam_chr_loc=""):
 #end = time.time()
 #start = time.time()
 from matplotlib import font_manager as fm
-CRISPRessoPlot.setMatplotlibDefaults()
 #end = time.time()
 
 #start = time.time()
@@ -125,7 +167,6 @@ def get_n_reads_bam(bam_filename,bam_chr_loc=""):
 
 pd=check_library('pandas')
 np=check_library('numpy')
-check_program('flash')
 
 #start = time.time()
 sns=check_library('seaborn')
@@ -205,7 +246,7 @@ def get_cloned_include_idxs_from_quant_window_coordinates(quant_window_coordinat
             idxs[i] = -1 * abs(idxs[i])
     for coord in split_quant_window_coordinates(quant_window_coordinates):
         include_idxs.extend(idxs[coord[0]:coord[1] + 1])
-        
+
     return list(filter(lambda x: x >= 0, include_idxs))
 
 
@@ -225,7 +266,7 @@ def get_pe_scaffold_search(prime_edited_ref_sequence, prime_editing_pegRNA_exten
     """
     info('Processing pegRNA scaffold sequence...')
     #first, define the sequence we are looking for (extension plus the first base(s) of the scaffold)
-    scaffold_dna = CRISPRessoShared.reverse_complement(prime_editing_pegRNA_scaffold_seq)
+    scaffold_dna = CRISPRessoShared.reverse_complement(prime_editing_pegRNA_scaffold_seq.upper().replace('U','T'))
 
     extension_seq_dna_top_strand = prime_editing_pegRNA_extension_seq.upper().replace('U', 'T')
     prime_editing_extension_seq_dna = CRISPRessoShared.reverse_complement(extension_seq_dna_top_strand)
@@ -341,6 +382,24 @@ def get_new_variant_object(args, fastq_seq, refs, ref_names, aln_matrix, pe_scaf
 
             payload['ref_name'] = best_match_name
             payload['aln_scores'] = aln_scores
+
+            payload['irregular_ends'] = False
+            if best_match_s1s[idx][0] == '-' or best_match_s2s[idx][0] == '-' or best_match_s1s[idx][0] != best_match_s2s[idx][0]:
+                payload['irregular_ends'] = True
+            elif best_match_s1s[idx][-1] == '-' or best_match_s2s[idx][-1] == '-' or best_match_s1s[idx][-1] != best_match_s2s[idx][-1]:
+                payload['irregular_ends'] = True
+
+            #Insertions out of quantification window
+            payload['insertions_outside_window'] = (len(payload['all_insertion_positions'])/2) - (len(payload['insertion_positions'])/2)
+            #Deletions out of quantification window
+            payload['deletions_outside_window'] = len(payload['all_deletion_coordinates']) - len(payload['deletion_coordinates'])
+            #Substitutions out of quantification window
+            payload['substitutions_outside_window'] = len(payload['all_substitution_positions']) - len(payload['substitution_positions'])
+            #Sums
+            payload['total_mods'] = (len(payload['all_insertion_positions'])/2) + len(payload['all_deletion_positions']) + len(payload['all_substitution_positions'])
+            payload['mods_in_window'] = payload['substitution_n'] + payload['deletion_n'] + payload['insertion_n']
+            payload['mods_outside_window'] = payload['total_mods'] - payload['mods_in_window']
+
             # If there is an insertion/deletion/substitution in the quantification window, the read is modified.
             is_modified = False
             if not args.ignore_deletions and payload['deletion_n'] > 0:
@@ -362,6 +421,7 @@ def get_new_variant_object(args, fastq_seq, refs, ref_names, aln_matrix, pe_scaf
             payload['aln_strand'] = best_match_strands[idx]
 
             new_variant['variant_'+best_match_name] = payload
+            new_variant['best_match_name'] = best_match_name
 
         new_variant['class_name'] = "&".join(class_names)
 
@@ -397,7 +457,7 @@ def get_new_variant_object(args, fastq_seq, refs, ref_names, aln_matrix, pe_scaf
 
 def process_fastq(fastq_filename, variantCache, ref_names, refs, args):
     """process_fastq processes each of the reads contained in a fastq file, given a cache of pre-computed variants
-        fastqIn: name of fastq (e.g. output of FLASH)
+        fastqIn: name of fastq (e.g. output of fastp)
             This file can be gzipped or plain text
 
         variantCache: dict with keys: sequence
@@ -468,13 +528,19 @@ def process_fastq(fastq_filename, variantCache, ref_names, refs, args):
            -allelic varaints if two variants are known to exist
 
         """
-
     N_TOT_READS = 0
     N_CACHED_ALN = 0 # read was found in cache
     N_CACHED_NOTALN = 0 #read was found in 'not aligned' cache
     N_COMPUTED_ALN = 0 # not in cache, aligned to at least 1 sequence with min cutoff
     N_COMPUTED_NOTALN = 0 #not in cache, not aligned to any sequence with min cutoff
 
+    N_GLOBAL_SUBS = 0 #number of substitutions across all reads - indicator of sequencing quality
+    N_SUBS_OUTSIDE_WINDOW = 0
+    N_MODS_IN_WINDOW = 0 #number of modifications found inside the quantification window
+    N_MODS_OUTSIDE_WINDOW = 0 #number of modifications found outside the quantification window
+    N_READS_IRREGULAR_ENDS = 0 #number of reads with modifications at the 0 or -1 position
+    READ_LENGTH = 0
+
     aln_matrix_loc = os.path.join(_ROOT, args.needleman_wunsch_aln_matrix_loc)
     CRISPRessoShared.check_file(aln_matrix_loc)
     aln_matrix = CRISPResso2Align.read_matrix(aln_matrix_loc)
@@ -500,7 +566,6 @@ def process_fastq(fastq_filename, variantCache, ref_names, refs, args):
             info("Processing reads; N_TOT_READS: %d N_COMPUTED_ALN: %d N_CACHED_ALN: %d N_COMPUTED_NOTALN: %d N_CACHED_NOTALN: %d"%(N_TOT_READS, N_COMPUTED_ALN, N_CACHED_ALN, N_COMPUTED_NOTALN, N_CACHED_NOTALN))
 
         N_TOT_READS+=1
-
         #if the sequence has been seen and can't be aligned, skip it
         if (fastq_seq in not_aln):
             N_CACHED_NOTALN += 1
@@ -509,6 +574,13 @@ def process_fastq(fastq_filename, variantCache, ref_names, refs, args):
         if (fastq_seq in variantCache):
             N_CACHED_ALN+=1
             variantCache[fastq_seq]['count'] += 1
+            match_name = "variant_" + variantCache[fastq_seq]['best_match_name']
+            N_GLOBAL_SUBS += variantCache[fastq_seq][match_name]['substitution_n'] + variantCache[fastq_seq][match_name]['substitutions_outside_window']
+            N_SUBS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['substitutions_outside_window']
+            N_MODS_IN_WINDOW += variantCache[fastq_seq][match_name]['mods_in_window']
+            N_MODS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['mods_outside_window']
+            if variantCache[fastq_seq][match_name]['irregular_ends']:
+                N_READS_IRREGULAR_ENDS += 1
 
         #otherwise, create a new variant object, and put it in the cache
         else:
@@ -519,6 +591,16 @@ def process_fastq(fastq_filename, variantCache, ref_names, refs, args):
             else:
                 N_COMPUTED_ALN+=1
                 variantCache[fastq_seq] = new_variant
+                match_name = "variant_" + new_variant['best_match_name']
+                if READ_LENGTH == 0:
+                    READ_LENGTH = len(new_variant[match_name]['aln_seq'])
+                N_GLOBAL_SUBS += new_variant[match_name]['substitution_n'] + new_variant[match_name]['substitutions_outside_window']
+                N_SUBS_OUTSIDE_WINDOW += new_variant[match_name]['substitutions_outside_window']
+                N_MODS_IN_WINDOW += new_variant[match_name]['mods_in_window']
+                N_MODS_OUTSIDE_WINDOW += new_variant[match_name]['mods_outside_window']
+                if new_variant[match_name]['irregular_ends']:
+                    N_READS_IRREGULAR_ENDS += 1
+                
 
     fastq_handle.close()
 
@@ -527,10 +609,17 @@ def process_fastq(fastq_filename, variantCache, ref_names, refs, args):
                "N_CACHED_ALN" : N_CACHED_ALN,
                "N_CACHED_NOTALN" : N_CACHED_NOTALN,
                "N_COMPUTED_ALN" : N_COMPUTED_ALN,
-               "N_COMPUTED_NOTALN" : N_COMPUTED_NOTALN
+               "N_COMPUTED_NOTALN" : N_COMPUTED_NOTALN,
+               "N_GLOBAL_SUBS": N_GLOBAL_SUBS,
+               "N_SUBS_OUTSIDE_WINDOW": N_SUBS_OUTSIDE_WINDOW,
+               "N_MODS_IN_WINDOW": N_MODS_IN_WINDOW,
+               "N_MODS_OUTSIDE_WINDOW": N_MODS_OUTSIDE_WINDOW,
+               "N_READS_IRREGULAR_ENDS": N_READS_IRREGULAR_ENDS,
+               "READ_LENGTH": READ_LENGTH
                }
     return(aln_stats)
 
+
 def process_bam(bam_filename, bam_chr_loc, output_bam, variantCache, ref_names, refs, args):
     """
     process_bam processes each of the reads contained in a bam file, given a cache of pre-computed variants
@@ -550,6 +639,13 @@ def process_bam(bam_filename, bam_chr_loc, output_bam, variantCache, ref_names,
     N_COMPUTED_ALN = 0 # not in cache, aligned to at least 1 sequence with min cutoff
     N_COMPUTED_NOTALN = 0 #not in cache, not aligned to any sequence with min cutoff
 
+    N_GLOBAL_SUBS = 0 #number of substitutions across all reads - indicator of sequencing quality
+    N_SUBS_OUTSIDE_WINDOW = 0
+    N_MODS_IN_WINDOW = 0 #number of modifications found inside the quantification window
+    N_MODS_OUTSIDE_WINDOW = 0 #number of modifications found outside the quantification window
+    N_READS_IRREGULAR_ENDS = 0 #number of reads with modifications at the 0 or -1 position
+    READ_LENGTH = 0
+
     aln_matrix_loc = os.path.join(_ROOT, args.needleman_wunsch_aln_matrix_loc)
     CRISPRessoShared.check_file(aln_matrix_loc)
     aln_matrix = CRISPResso2Align.read_matrix(aln_matrix_loc)
@@ -593,6 +689,13 @@ def process_bam(bam_filename, bam_chr_loc, output_bam, variantCache, ref_names,
             if (fastq_seq in variantCache):
                 N_CACHED_ALN+=1
                 variantCache[fastq_seq]['count'] += 1
+                match_name = "variant_" + variantCache[fastq_seq]['best_match_name']
+                N_GLOBAL_SUBS += variantCache[fastq_seq][match_name]['substitution_n'] + variantCache[fastq_seq][match_name]['substitutions_outside_window']
+                N_SUBS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['substitutions_outside_window']
+                N_MODS_IN_WINDOW += variantCache[fastq_seq][match_name]['mods_in_window']
+                N_MODS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['mods_outside_window']
+                if variantCache[fastq_seq][match_name]['irregular_ends']:
+                    N_READS_IRREGULAR_ENDS += 1
                 #sam_line_els[5] = variantCache[fastq_seq]['sam_cigar']
                 sam_line_els.append(variantCache[fastq_seq]['crispresso2_annotation'])
                 sam_out.write("\t".join(sam_line_els)+"\n")
@@ -654,6 +757,16 @@ def process_bam(bam_filename, bam_chr_loc, output_bam, variantCache, ref_names,
 
                     variantCache[fastq_seq] = new_variant
 
+                    match_name = 'variant_' + new_variant['best_match_name']
+                    if READ_LENGTH == 0:
+                        READ_LENGTH = len(new_variant[match_name]['aln_seq'])
+                    N_GLOBAL_SUBS += new_variant[match_name]['substitution_n'] + new_variant[match_name]['substitutions_outside_window']
+                    N_SUBS_OUTSIDE_WINDOW += new_variant[match_name]['substitutions_outside_window']
+                    N_MODS_IN_WINDOW += new_variant[match_name]['mods_in_window']
+                    N_MODS_OUTSIDE_WINDOW += new_variant[match_name]['mods_outside_window']
+                    if new_variant[match_name]['irregular_ends']:
+                        N_READS_IRREGULAR_ENDS += 1
+
     output_sam = output_bam+".sam"
     cmd = 'samtools view -Sb '+output_sam + '>'+output_bam + ' && samtools index ' + output_bam
     bam_status=sb.call(cmd, shell=True)
@@ -663,14 +776,21 @@ def process_bam(bam_filename, bam_chr_loc, output_bam, variantCache, ref_names,
             )
 
     info("Finished reads; N_TOT_READS: %d N_COMPUTED_ALN: %d N_CACHED_ALN: %d N_COMPUTED_NOTALN: %d N_CACHED_NOTALN: %d"%(N_TOT_READS, N_COMPUTED_ALN, N_CACHED_ALN, N_COMPUTED_NOTALN, N_CACHED_NOTALN))
-    aln_stats = {"N_TOT_READS": N_TOT_READS,
-               "N_CACHED_ALN": N_CACHED_ALN,
-               "N_CACHED_NOTALN": N_CACHED_NOTALN,
-               "N_COMPUTED_ALN": N_COMPUTED_ALN,
-               "N_COMPUTED_NOTALN": N_COMPUTED_NOTALN,
+    aln_stats = {"N_TOT_READS" : N_TOT_READS,
+               "N_CACHED_ALN" : N_CACHED_ALN,
+               "N_CACHED_NOTALN" : N_CACHED_NOTALN,
+               "N_COMPUTED_ALN" : N_COMPUTED_ALN,
+               "N_COMPUTED_NOTALN" : N_COMPUTED_NOTALN,
+               "N_GLOBAL_SUBS": N_GLOBAL_SUBS,
+               "N_SUBS_OUTSIDE_WINDOW": N_SUBS_OUTSIDE_WINDOW,
+               "N_MODS_IN_WINDOW": N_MODS_IN_WINDOW,
+               "N_MODS_OUTSIDE_WINDOW": N_MODS_OUTSIDE_WINDOW,
+               "N_READS_IRREGULAR_ENDS": N_READS_IRREGULAR_ENDS,
+               "READ_LENGTH": READ_LENGTH
                }
     return(aln_stats)
 
+
 def process_fastq_write_out(fastq_input, fastq_output, variantCache, ref_names, refs, args):
     """
     process_fastq_write_out processes each of the reads contained in a fastq input file, given a cache of pre-computed variants. All reads are read in, analyzed, and written to output with annotation
@@ -689,6 +809,13 @@ def process_fastq_write_out(fastq_input, fastq_output, variantCache, ref_names,
     N_COMPUTED_ALN = 0 # not in cache, aligned to at least 1 sequence with min cutoff
     N_COMPUTED_NOTALN = 0 #not in cache, not aligned to any sequence with min cutoff
 
+    N_GLOBAL_SUBS = 0 #number of substitutions across all reads - indicator of sequencing quality
+    N_SUBS_OUTSIDE_WINDOW = 0
+    N_MODS_IN_WINDOW = 0 #number of modifications found inside the quantification window
+    N_MODS_OUTSIDE_WINDOW = 0 #number of modifications found outside the quantification window
+    N_READS_IRREGULAR_ENDS = 0 #number of reads with modifications at the 0 or -1 position
+    READ_LENGTH = 0
+
     aln_matrix_loc = os.path.join(_ROOT, args.needleman_wunsch_aln_matrix_loc)
     CRISPRessoShared.check_file(aln_matrix_loc)
     aln_matrix = CRISPResso2Align.read_matrix(aln_matrix_loc)
@@ -725,6 +852,13 @@ def process_fastq_write_out(fastq_input, fastq_output, variantCache, ref_names,
         elif fastq_seq in variantCache: #if the sequence is already associated with a variant in the variant cache, pull it out
             N_CACHED_ALN+=1
             variantCache[fastq_seq]['count'] += 1
+            match_name = "variant_" + variantCache[fastq_seq]['best_match_name']
+            N_GLOBAL_SUBS += variantCache[fastq_seq][match_name]['substitution_n'] + variantCache[fastq_seq][match_name]['substitutions_outside_window']
+            N_SUBS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['substitutions_outside_window']
+            N_MODS_IN_WINDOW += variantCache[fastq_seq][match_name]['mods_in_window']
+            N_MODS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['mods_outside_window']
+            if variantCache[fastq_seq][match_name]['irregular_ends']:
+                N_READS_IRREGULAR_ENDS += 1
             fastq_out_handle.write(fastq_id+fastq_seq+"\n"+fastq_plus+variantCache[fastq_seq]['crispresso2_annotation']+"\n"+fastq_qual)
 
         #otherwise, create a new variant object, and put it in the cache
@@ -775,6 +909,15 @@ def process_fastq_write_out(fastq_input, fastq_output, variantCache, ref_names,
                 fastq_out_handle.write(fastq_id+fastq_seq+"\n"+fastq_plus+crispresso2_annotation+"\n"+fastq_qual)
 
                 variantCache[fastq_seq] = new_variant
+                match_name = 'variant_' + new_variant['best_match_name']
+                if READ_LENGTH == 0:
+                    READ_LENGTH = len(new_variant[match_name]['aln_seq'])
+                N_GLOBAL_SUBS += new_variant[match_name]['substitution_n'] + new_variant[match_name]['substitutions_outside_window']
+                N_SUBS_OUTSIDE_WINDOW += new_variant[match_name]['substitutions_outside_window']
+                N_MODS_IN_WINDOW += new_variant[match_name]['mods_in_window']
+                N_MODS_OUTSIDE_WINDOW += new_variant[match_name]['mods_outside_window']
+                if new_variant[match_name]['irregular_ends']:
+                    N_READS_IRREGULAR_ENDS += 1
 
         #last step of loop = read next line
         fastq_id = fastq_input_handle.readline()
@@ -782,11 +925,17 @@ def process_fastq_write_out(fastq_input, fastq_output, variantCache, ref_names,
     fastq_out_handle.close()
 
     info("Finished reads; N_TOT_READS: %d N_COMPUTED_ALN: %d N_CACHED_ALN: %d N_COMPUTED_NOTALN: %d N_CACHED_NOTALN: %d"%(N_TOT_READS, N_COMPUTED_ALN, N_CACHED_ALN, N_COMPUTED_NOTALN, N_CACHED_NOTALN))
-    aln_stats = {"N_TOT_READS": N_TOT_READS,
-               "N_CACHED_ALN": N_CACHED_ALN,
-               "N_CACHED_NOTALN": N_CACHED_NOTALN,
-               "N_COMPUTED_ALN": N_COMPUTED_ALN,
-               "N_COMPUTED_NOTALN": N_COMPUTED_NOTALN,
+    aln_stats = {"N_TOT_READS" : N_TOT_READS,
+               "N_CACHED_ALN" : N_CACHED_ALN,
+               "N_CACHED_NOTALN" : N_CACHED_NOTALN,
+               "N_COMPUTED_ALN" : N_COMPUTED_ALN,
+               "N_COMPUTED_NOTALN" : N_COMPUTED_NOTALN,
+               "N_GLOBAL_SUBS": N_GLOBAL_SUBS,
+               "N_SUBS_OUTSIDE_WINDOW": N_SUBS_OUTSIDE_WINDOW,
+               "N_MODS_IN_WINDOW": N_MODS_IN_WINDOW,
+               "N_MODS_OUTSIDE_WINDOW": N_MODS_OUTSIDE_WINDOW,
+               "N_READS_IRREGULAR_ENDS": N_READS_IRREGULAR_ENDS,
+               "READ_LENGTH": READ_LENGTH
                }
     return(aln_stats)
 
@@ -818,6 +967,13 @@ def process_single_fastq_write_bam_out(fastq_input, bam_output, bam_header, vari
     N_COMPUTED_ALN = 0  # not in cache, aligned to at least 1 sequence with min cutoff
     N_COMPUTED_NOTALN = 0  # not in cache, not aligned to any sequence with min cutoff
 
+    N_GLOBAL_SUBS = 0 #number of substitutions across all reads - indicator of sequencing quality
+    N_SUBS_OUTSIDE_WINDOW = 0
+    N_MODS_IN_WINDOW = 0 #number of modifications found inside the quantification window
+    N_MODS_OUTSIDE_WINDOW = 0 #number of modifications found outside the quantification window
+    N_READS_IRREGULAR_ENDS = 0 #number of reads with modifications at the 0 or -1 position
+    READ_LENGTH = 0
+
     aln_matrix_loc = os.path.join(_ROOT, args.needleman_wunsch_aln_matrix_loc)
     CRISPRessoShared.check_file(aln_matrix_loc)
     aln_matrix = CRISPResso2Align.read_matrix(aln_matrix_loc)
@@ -861,6 +1017,13 @@ def process_single_fastq_write_bam_out(fastq_input, bam_output, bam_header, vari
         elif fastq_seq in variantCache:  # if the sequence is already associated with a variant in the variant cache, pull it out
             N_CACHED_ALN += 1
             variantCache[fastq_seq]['count'] += 1
+            match_name = "variant_" + variantCache[fastq_seq]['best_match_name']
+            N_GLOBAL_SUBS += variantCache[fastq_seq][match_name]['substitution_n'] + variantCache[fastq_seq][match_name]['substitutions_outside_window']
+            N_SUBS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['substitutions_outside_window']
+            N_MODS_IN_WINDOW += variantCache[fastq_seq][match_name]['mods_in_window']
+            N_MODS_OUTSIDE_WINDOW += variantCache[fastq_seq][match_name]['mods_outside_window']
+            if variantCache[fastq_seq][match_name]['irregular_ends']:
+                N_READS_IRREGULAR_ENDS += 1
             new_sam_entry = variantCache[fastq_seq]['sam_entry'][:]
             new_sam_entry[0] = fastq_id
             new_sam_entry[10] = fastq_qual
@@ -973,12 +1136,20 @@ def process_single_fastq_write_bam_out(fastq_input, bam_output, bam_header, vari
                 sam_out_handle.write("\t".join(new_sam_entry)+"\n")  # write cached alignment with modified read id and qual
 
                 variantCache[fastq_seq] = new_variant
+                match_name = 'variant_' + new_variant['best_match_name']
+                if READ_LENGTH == 0:
+                    READ_LENGTH = len(new_variant[match_name]['aln_seq'])
+                N_GLOBAL_SUBS += new_variant[match_name]['substitution_n'] + new_variant[match_name]['substitutions_outside_window']
+                N_SUBS_OUTSIDE_WINDOW += new_variant[match_name]['substitutions_outside_window']
+                N_MODS_IN_WINDOW += new_variant[match_name]['mods_in_window']
+                N_MODS_OUTSIDE_WINDOW += new_variant[match_name]['mods_outside_window']
+                if new_variant[match_name]['irregular_ends']:
+                    N_READS_IRREGULAR_ENDS += 1
 
         #last step of loop = read next line
         fastq_id = fastq_input_handle.readline().strip()[1:]
     fastq_input_handle.close()
     sam_out_handle.close()
-
     sort_and_index_cmd = 'samtools sort ' + sam_out + ' -o ' + bam_output + ' && samtools index ' + bam_output
     sort_bam_status = sb.call(sort_and_index_cmd, shell=True)
     if sort_bam_status:
@@ -990,11 +1161,17 @@ def process_single_fastq_write_bam_out(fastq_input, bam_output, bam_header, vari
         os.remove(sam_out)
 
     info("Finished reads; N_TOT_READS: %d N_COMPUTED_ALN: %d N_CACHED_ALN: %d N_COMPUTED_NOTALN: %d N_CACHED_NOTALN: %d"%(N_TOT_READS, N_COMPUTED_ALN, N_CACHED_ALN, N_COMPUTED_NOTALN, N_CACHED_NOTALN))
-    aln_stats = {"N_TOT_READS": N_TOT_READS,
-               "N_CACHED_ALN": N_CACHED_ALN,
-               "N_CACHED_NOTALN": N_CACHED_NOTALN,
-               "N_COMPUTED_ALN": N_COMPUTED_ALN,
-               "N_COMPUTED_NOTALN": N_COMPUTED_NOTALN,
+    aln_stats = {"N_TOT_READS" : N_TOT_READS,
+               "N_CACHED_ALN" : N_CACHED_ALN,
+               "N_CACHED_NOTALN" : N_CACHED_NOTALN,
+               "N_COMPUTED_ALN" : N_COMPUTED_ALN,
+               "N_COMPUTED_NOTALN" : N_COMPUTED_NOTALN,
+               "N_GLOBAL_SUBS": N_GLOBAL_SUBS,
+               "N_SUBS_OUTSIDE_WINDOW": N_SUBS_OUTSIDE_WINDOW,
+               "N_MODS_IN_WINDOW": N_MODS_IN_WINDOW,
+               "N_MODS_OUTSIDE_WINDOW": N_MODS_OUTSIDE_WINDOW,
+               "N_READS_IRREGULAR_ENDS": N_READS_IRREGULAR_ENDS,
+               "READ_LENGTH": READ_LENGTH
                }
     return(aln_stats)
 
@@ -1092,7 +1269,7 @@ def print_stacktrace_if_debug():
             sys.exit()
 
 
-        arg_parser = CRISPRessoShared.getCRISPRessoArgParser()
+        arg_parser = CRISPRessoShared.getCRISPRessoArgParser("Core")
         args = arg_parser.parse_args()
 
         CRISPRessoShared.set_console_log_level(logger, args.verbosity, args.debug)
@@ -1125,7 +1302,7 @@ def print_stacktrace_if_debug():
             with open(log_filename, 'w+') as outfile:
                 outfile.write('CRISPResso version %s\n[Command used]:\n%s\n\n[Execution log]:\n' %(CRISPRessoShared.__version__, crispresso_cmd_to_write))
 
-        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPResso_status.txt')))
+        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPResso_status.json')))
 
         aln_matrix_loc = os.path.join(_ROOT, "EDNAFULL")
         CRISPRessoShared.check_file(aln_matrix_loc)
@@ -1159,7 +1336,7 @@ def print_stacktrace_if_debug():
 
         if args.amplicon_seq is None and args.auto is False:
             arg_parser.print_help()
-            raise CRISPRessoShared.BadParameterException('Please provide an amplicon sequence for analysis using the --amplicon_seq parameter.')
+            raise CRISPRessoShared.BadParameterException('Please provide an amplicon sequence for analysis using the --amplicon_seq parameter or use the --auto parameter to automatically assign amplicon to most common read.')
 
         if (args.needleman_wunsch_gap_open > 0):
             raise CRISPRessoShared.BadParameterException("Needleman Wunsch gap open penalty must be <= 0")
@@ -1167,6 +1344,13 @@ def print_stacktrace_if_debug():
             raise CRISPRessoShared.BadParameterException("Needleman Wunsch gap extend penalty must be <= 0")
 
 
+        if args.use_matplotlib or not C2PRO_INSTALLED:
+            from CRISPResso2 import CRISPRessoPlot
+        else:
+            from CRISPRessoPro import plot as CRISPRessoPlot
+        CRISPRessoPlot.setMatplotlibDefaults()
+
+
         #create output directory
         crispresso2_info_file = os.path.join(OUTPUT_DIRECTORY, 'CRISPResso2_info.json')
         crispresso2_info = {'running_info': {}, 'results': {'alignment_stats': {}, 'general_plots': {}}} #keep track of all information for this run to be pickled and saved at the end of the run
@@ -1299,6 +1483,7 @@ def rreplace(s, old, new):
 
             info('Inferring reference amplicon sequence..', {'percent_complete': 1})
 
+            check_fastp()
             auto_fastq_r1 = args.fastq_r1 #paths to fastq files for performing auto functions
             auto_fastq_r2 = args.fastq_r2
             if args.bam_input != "": #if input is a bam, create temp files with reads for processing here
@@ -1321,8 +1506,7 @@ def rreplace(s, old, new):
                         fastq_r1=auto_fastq_r1,
                         fastq_r2=auto_fastq_r2,
                         number_of_reads_to_consider=number_of_reads_to_consider,
-                        flash_command=args.flash_command,
-                        max_paired_end_reads_overlap=args.max_paired_end_reads_overlap,
+                        fastp_command=args.fastp_command,
                         min_paired_end_reads_overlap=args.min_paired_end_reads_overlap,
                         aln_matrix=aln_matrix,
                         needleman_wunsch_gap_open=args.needleman_wunsch_gap_open,
@@ -1350,8 +1534,7 @@ def rreplace(s, old, new):
                                     fastq_r1=auto_fastq_r1,
                                     fastq_r2=auto_fastq_r2,
                                     number_of_reads_to_consider=number_of_reads_to_consider,
-                                    flash_command=args.flash_command,
-                                    max_paired_end_reads_overlap=args.max_paired_end_reads_overlap,
+                                    fastp_command=args.fastp_command,
                                     min_paired_end_reads_overlap=args.min_paired_end_reads_overlap,
                                     exclude_bp_from_left=args.exclude_bp_from_left,
                                     exclude_bp_from_right=args.exclude_bp_from_right,
@@ -1389,7 +1572,7 @@ def rreplace(s, old, new):
                 )
 
         else: #not auto
-            amplicon_seq_arr = args.amplicon_seq.split(",")
+            amplicon_seq_arr = list(map(lambda x: x.upper(), args.amplicon_seq.split(",")))
             amplicon_name_arr = args.amplicon_name.split(",")
             #split on commas, only accept empty values
             amplicon_min_alignment_score_arr = [float(x) for x in args.amplicon_min_alignment_score.split(",") if x]
@@ -1665,20 +1848,17 @@ def get_prime_editing_guides(this_amp_seq, this_amp_name, ref0_seq, prime_edited
 
         #now that we're done with adding possible guides and amplicons, go through each amplicon and compute quantification windows
         info('Computing quantification windows', {'percent_complete': 2})
+        if C2PRO_INSTALLED:
+            info(f'CRISPRessoPro v{CRISPRessoProVersion} installed', {'percent_complete': 3})
+        else:
+            info(f'CRISPRessoPro not installed', {'percent_complete': 3})
 
         found_guide_seq = [False]*len(guides)
         found_coding_seq = [False]*len(coding_seqs)
 
-        max_amplicon_len = 0 #for flash
-        min_amplicon_len = 99**99 #for flash
-
         for idx, seq in enumerate(amplicon_seq_arr):
             this_seq = seq.strip().upper()
             this_seq_length = len(this_seq)
-            if this_seq_length > max_amplicon_len:
-                max_amplicon_len = this_seq_length
-            if this_seq_length < min_amplicon_len:
-                min_amplicon_len = this_seq_length
 
             this_name = 'Amplicon'+str(idx)
             if idx < len(amplicon_name_arr):
@@ -2189,134 +2369,89 @@ def get_prime_editing_guides(this_amp_seq, this_amp_name, ref0_seq, prime_edited
             raise CRISPRessoShared.BadParameterException('Read trimming options are not available with bam input')
         elif args.fastq_r1 != '' and args.fastq_r2 == '': #single end reads
             if not args.trim_sequences: #no trimming or merging required
-                output_forward_filename=args.fastq_r1
+                output_forward_filename = args.fastq_r1
             else:
+                check_fastp()
+                info('Trimming sequences with fastp...')
                 output_forward_filename=_jp('reads.trimmed.fq.gz')
-                #Trimming with trimmomatic
-                cmd='%s SE -phred33 %s  %s %s >>%s 2>&1'\
-                % (args.trimmomatic_command, args.fastq_r1,
-                   output_forward_filename,
-                   args.trimmomatic_options_string.replace('NexteraPE-PE.fa', 'TruSeq3-SE.fa'),
-                   log_filename)
-                #print cmd
-                TRIMMOMATIC_STATUS=sb.call(cmd, shell=True)
-
-                if TRIMMOMATIC_STATUS:
-                        raise CRISPRessoShared.TrimmomaticException('TRIMMOMATIC failed to run, please check the log file.')
-                crispresso2_info['trimmomatic_command'] = cmd
+                cmd = '{command} -i {r1} -o {out} {options} --json {json_report} --html {html_report} >> {log} 2>&1'.format(
+                    command=args.fastp_command,
+                    r1=args.fastq_r1,
+                    out=output_forward_filename,
+                    options=args.fastp_options_string,
+                    json_report=_jp('fastp_report.json'),
+                    html_report=_jp('fastp_report.html'),
+                    log=log_filename,
+                )
+                fastp_status = sb.call(cmd, shell=True)
+
+                if fastp_status:
+                    raise CRISPRessoShared.FastpException('FASTP failed to run, please check the log file.')
+                crispresso2_info['fastp_command'] = cmd
 
                 files_to_remove += [output_forward_filename]
 
-            processed_output_filename=output_forward_filename
+                info('Done!')
+
+            processed_output_filename = output_forward_filename
 
         elif args.fastq_r1 != '' and args.fastq_r2 != '':#paired end reads
+            processed_output_filename = _jp('oet.extendedFrags.fastq.gz')
+            not_combined_1_filename = _jp('out.notCombined_1.fastq.gz')
+            not_combined_2_filename = _jp('out.notCombined_2.fastq.gz')
+            check_fastp()
+            info('Processing sequences with fastp...')
             if not args.trim_sequences:
-                output_forward_paired_filename=args.fastq_r1
-                output_reverse_paired_filename=args.fastq_r2
-            else:
-                info('Trimming sequences with Trimmomatic...')
-                output_forward_paired_filename=_jp('output_forward_paired.fq.gz')
-                output_forward_unpaired_filename=_jp('output_forward_unpaired.fq.gz')
-                output_reverse_paired_filename=_jp('output_reverse_paired.fq.gz')
-                output_reverse_unpaired_filename=_jp('output_reverse_unpaired.fq.gz')
-
-                #Trimming with trimmomatic
-                cmd='%s PE -phred33 %s  %s %s  %s  %s  %s %s >>%s 2>&1'\
-                    % (args.trimmomatic_command,
-                        args.fastq_r1, args.fastq_r2, output_forward_paired_filename,
-                        output_forward_unpaired_filename, output_reverse_paired_filename,
-                        output_reverse_unpaired_filename, args.trimmomatic_options_string, log_filename)
-                #print cmd
-                TRIMMOMATIC_STATUS=sb.call(cmd, shell=True)
-                if TRIMMOMATIC_STATUS:
-                    raise CRISPRessoShared.TrimmomaticException('TRIMMOMATIC failed to run, please check the log file.')
-                crispresso2_info['trimmomatic_command'] = cmd
-
-                files_to_remove += [output_forward_paired_filename]
-                files_to_remove += [output_reverse_paired_filename]
-
-                info('Done!', {'percent_complete': 6})
-
-            #for paired-end reads, merge them
-            info('Estimating average read length...')
-            if args.debug:
-                info('Checking average read length from ' + output_forward_paired_filename)
-            if get_n_reads_fastq(output_forward_paired_filename):
-                avg_read_length=get_avg_read_length_fastq(output_forward_paired_filename)
-                if args.debug:
-                    info('Average read length is ' + str(avg_read_length) + ' from ' + output_forward_paired_filename)
+                args.fastp_options_string += ' --disable_adapter_trimming --disable_trim_poly_g --disable_quality_filtering --disable_length_filtering'
             else:
-               raise CRISPRessoShared.NoReadsAfterQualityFilteringException('No reads survived the average or single bp quality filtering.')
-
-            #Merging with Flash
-            info('Merging paired sequences with Flash...')
-            min_overlap = args.min_paired_end_reads_overlap
-            max_overlap = args.max_paired_end_reads_overlap
-            if args.stringent_flash_merging:
-                expected_max_overlap=2*avg_read_length - min_amplicon_len
-                expected_min_overlap=2*avg_read_length - max_amplicon_len
-    #            print('avg read len: ' + str(avg_read_length))
-    #            print('expected_max_overlap' + str(expected_max_overlap))
-    #            print('expected_min_overlap' + str(expected_min_overlap))
-    #            print('min amplicon len:' + str(min_amplicon_len))
-    #            print('max amplicon len:' + str(max_amplicon_len))
-                indel_overlap_tolerance = 10 # magic number bound on how many bp inserted/deleted in ~90% of reads (for flash)
-                #max overlap is either the entire read (avg_read_length) or the expected amplicon length + indel tolerance
-                max_overlap = max(10, min(avg_read_length, expected_max_overlap+indel_overlap_tolerance))
-                #min overlap is either 4bp (as in crispresso1) or the expected amplicon length - indel tolerance
-                min_overlap = max(4, expected_min_overlap-indel_overlap_tolerance)
-    #            print('max_overlap: ' + str(max_overlap))
-    #            print('min_overlap: ' + str(min_overlap))
-                # if reads are longer than the amplicon, there is no way to tell flash to have them overlap like this..
-                if avg_read_length > min_amplicon_len:
-                    info('Warning: Reads are longer than amplicon.')
-                    min_overlap = avg_read_length-10
-                    max_overlap = 2*avg_read_length
-
-            output_prefix = "out"
-            if clean_file_prefix != "":
-                output_prefix = clean_file_prefix + "out"
-            cmd='%s "%s" "%s" --min-overlap %d --max-overlap %d --allow-outies -z -d %s -o %s >>%s 2>&1' %\
-            (args.flash_command,
-                 output_forward_paired_filename,
-                 output_reverse_paired_filename,
-                 min_overlap,
-                 max_overlap,
-                 OUTPUT_DIRECTORY,
-                 output_prefix,
-                 log_filename)
-
-            info('Running FLASH command: ' + cmd)
-            crispresso2_info['flash_command'] = cmd
-            FLASH_STATUS=sb.call(cmd, shell=True)
-            if FLASH_STATUS:
-                raise CRISPRessoShared.FlashException('Flash failed to run, please check the log file.')
-
-            flash_hist_filename=_jp('out.hist')
-            flash_histogram_filename=_jp('out.histogram')
-            flash_not_combined_1_filename=_jp('out.notCombined_1.fastq.gz')
-            flash_not_combined_2_filename=_jp('out.notCombined_2.fastq.gz')
-
-            processed_output_filename=_jp('out.extendedFrags.fastq.gz')
-            if os.path.isfile(processed_output_filename) is False:
-                raise CRISPRessoShared.FlashException('Flash failed to produce merged reads file, please check the log file.')
-
-            files_to_remove+=[processed_output_filename, flash_hist_filename, flash_histogram_filename,\
-                    flash_not_combined_1_filename, flash_not_combined_2_filename, _jp('out.hist.innie'), _jp('out.histogram.innie'), _jp('out.histogram.outie'), _jp('out.hist.outie')]
-
-            if (args.force_merge_pairs):
-                 old_flashed_filename = processed_output_filename
+                args.fastp_options_string += ' --detect_adapter_for_pe'
+
+            fastp_cmd = '{command} -i {r1} -I {r2} --merge --merged_out {out_merged} --unpaired1 {unpaired1} --unpaired2 {unpaired2} --overlap_len_require {min_overlap} --thread {num_threads} --json {json_report} --html {html_report} {options} >> {log} 2>&1'.format(
+                command=args.fastp_command,
+                r1=args.fastq_r1,
+                r2=args.fastq_r2,
+                out_merged=processed_output_filename,
+                unpaired1=not_combined_1_filename,
+                unpaired2=not_combined_2_filename,
+                min_overlap=args.min_paired_end_reads_overlap,
+                num_threads=n_processes,
+                json_report=_jp('fastp_report.json'),
+                html_report=_jp('fastp_report.html'),
+                options=args.fastp_options_string,
+                log=log_filename,
+            )
+            fastp_status = sb.call(fastp_cmd, shell=True)
+            if fastp_status:
+                raise CRISPRessoShared.FastpException('Fastp failed to run, please check the log file.')
+            crispresso2_info['running_info']['fastp_command'] = fastp_cmd
+
+            if not os.path.isfile(processed_output_filename):
+                raise CRISPRessoShared.FastpException('Fastp failed to produce merged reads file, please check the log file.')
+
+            info('Done!', {'percent_complete': 6})
+
+            files_to_remove += [
+                processed_output_filename,
+                not_combined_1_filename,
+                not_combined_2_filename,
+            ]
+
+            if args.force_merge_pairs:
                  new_merged_filename=_jp('out.forcemerged_uncombined.fastq.gz')
-                 num_reads_force_merged = CRISPRessoShared.force_merge_pairs(flash_not_combined_1_filename, flash_not_combined_2_filename, new_merged_filename)
+                 num_reads_force_merged = CRISPRessoShared.force_merge_pairs(not_combined_1_filename, not_combined_2_filename, new_merged_filename)
                  new_output_filename=_jp('out.forcemerged.fastq.gz')
-                 merge_command = "cat %s %s > %s"%(processed_output_filename, new_merged_filename, new_output_filename)
-                 MERGE_STATUS=sb.call(merge_command, shell=True)
-                 if MERGE_STATUS:
-                     raise FlashException('Force-merging read pairs failed to run, please check the log file.')
+                 merge_command = "cat {0} {1} > {2}".format(
+                     processed_output_filename, new_merged_filename, new_output_filename,
+                 )
+                 merge_status = sb.call(merge_command, shell=True)
+                 if merge_status:
+                     raise CRISPRessoShared.FastpException('Force-merging read pairs failed to run, please check the log file.')
+                 else:
+                     info(f'Forced {num_reads_force_merged} read paisr together.')
                  processed_output_filename = new_output_filename
 
-                 files_to_remove+=[new_merged_filename]
-                 files_to_remove+=[new_output_filename]
+                 files_to_remove += [new_merged_filename]
+                 files_to_remove += [new_output_filename]
                  if args.debug:
                      info('Wrote force-merged reads to ' + new_merged_filename)
 
@@ -3432,7 +3567,7 @@ def save_count_vectors_to_file(vectors, vectorNames, refSeq, filename):
             info('Making Plots...')
         ###############################################################################################################################################
         save_png = True
-        config = CRISPRessoShared.check_custom_config(args)
+        custom_config = CRISPRessoShared.check_custom_config(args)
         if args.suppress_report:
             save_png = False
 
@@ -3511,6 +3646,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                 'N_TOTAL': N_TOTAL,
                 'piechart_plot_root': plot_1b_root,
                 'barplot_plot_root': plot_1c_root,
+                'custom_colors': custom_config['colors'],
                 'save_png': save_png
             }
             crispresso2_info['results']['general_plots']['plot_1b_root'] = os.path.basename(plot_1b_root)
@@ -3653,17 +3789,18 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                     mod_df_for_plot = modification_percentage_summary_df.copy()
                     mod_df_for_plot.insert(0, 'Batch', ref_name)
 
-                    plot_root = _jp('2a.'+ref_plot_name + 'Nucleotide_percentage_quilt')
+                    plot_root = _jp('2a.'+ ref_plot_name + 'Nucleotide_percentage_quilt')
+                    pro_output_name = f'plot_{os.path.basename(plot_root)}.json'
                     plot_2a_input = {
                         'nuc_pct_df': nuc_df_for_plot,
                         'mod_pct_df': mod_df_for_plot,
-                        'fig_filename_root': plot_root,
+                        'fig_filename_root': f'{_jp(pro_output_name)}' if not args.use_matplotlib and C2PRO_INSTALLED else plot_root,
                         'save_also_png': save_png,
                         'sgRNA_intervals': sgRNA_intervals,
                         'sgRNA_names': sgRNA_names,
                         'sgRNA_mismatches': sgRNA_mismatches,
                         'quantification_window_idxs': include_idxs_list,
-                        'custom_colors': config["colors"],
+                        'custom_colors': custom_config["colors"],
                     }
                     debug('Plotting nucleotide quilt across amplicon')
                     plot(CRISPRessoPlot.plot_nucleotide_quilt, plot_2a_input)
@@ -3700,17 +3837,18 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         new_include_idx = []
                         for x in include_idxs_list:
                             new_include_idx += [x - new_sel_cols_start]
-                        plot_root = _jp('2b.'+ref_plot_name + 'Nucleotide_percentage_quilt_around_' + sgRNA_label)
+                        plot_root = _jp('2b.'+ ref_plot_name + 'Nucleotide_percentage_quilt_around_' + sgRNA_label)
+                        pro_output_name = f'plot_{os.path.basename(plot_root)}.json'
                         plot_2b_input = {
                             'nuc_pct_df': nuc_df_for_plot.iloc[:, sel_cols],
                             'mod_pct_df': mod_df_for_plot.iloc[:, sel_cols],
-                            'fig_filename_root': plot_root,
+                            'fig_filename_root': f'{_jp(pro_output_name)}' if not args.use_matplotlib and C2PRO_INSTALLED else plot_root,
                             'save_also_png': save_png,
                             'sgRNA_intervals': new_sgRNA_intervals,
                             'sgRNA_names': sgRNA_names,
                             'sgRNA_mismatches': sgRNA_mismatches,
                             'quantification_window_idxs': new_include_idx,
-                            'custom_colors': config["colors"],
+                            'custom_colors': custom_config["colors"],
                         }
                         debug('Plotting nucleotide distribuition around {0} for {1}'.format(sgRNA_legend, ref_name))
                         plot(CRISPRessoPlot.plot_nucleotide_quilt, plot_2b_input)
@@ -3762,6 +3900,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                     ),
                     'plot_root': plot_root,
                     'save_also_png': save_png,
+                    'ref_name': ref_name,
                 }
                 debug('Plotting indel size distribution for {0}'.format(ref_name))
                 plot(CRISPRessoPlot.plot_indel_size_distribution, plot_3a_input)
@@ -3843,6 +3982,8 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                     'xmax_ins': xmax_ins,
                     'xmax_mut': xmax_mut,
                     'save_also_png': save_png,
+                    'custom_colors': custom_config["colors"],
+                    'ref_name' : ref_name,
                 }
                 debug('Plotting frequency deletions/insertions for {0}'.format(ref_name))
                 plot(CRISPRessoPlot.plot_frequency_deletions_insertions, plot_3b_input)
@@ -3888,7 +4029,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         ),
                     },
                     'plot_root': plot_root,
-                    'custom_colors': config["colors"],
+                    'custom_colors': custom_config["colors"],
                     'save_also_png': save_png,
                 }
                 debug('Plotting amplication modifications for {0}'.format(ref_name))
@@ -3918,7 +4059,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'Mutation position distribution', ref_name,
                     ),
                     'plot_root': plot_root,
-                    'custom_colors': config["colors"],
+                    'custom_colors': custom_config["colors"],
                     'save_also_png': save_png,
                 }
                 debug('Plotting modification frequency for {0}'.format(ref_name))
@@ -3947,7 +4088,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                     ),
                     'ref_name': ref_name,
                     'plot_root': plot_root,
-                    'custom_colors': config["colors"],
+                    'custom_colors': custom_config["colors"],
                     'save_also_png': save_png,
                 }
                 debug('Plotting quantification window locations for {0}'.format(ref_name))
@@ -3979,6 +4120,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                     },
                     'plot_root': plot_root,
                     'save_also_png': save_png,
+                    'ref_name': ref_name,
                 }
                 debug('Plotting position dependent indel for {0}'.format(ref_name))
                 plot(
@@ -4004,7 +4146,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'n_total': N_TOTAL,
                         'ref_len': ref_len,
                         'ref_name': ref_names[0],
-                        'custom_colors': config["colors"],
+                        'custom_colors': custom_config["colors"],
                         'save_also_png': save_png,
                     }
                     if ref_name == ref_names[0]:
@@ -4066,16 +4208,17 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                     hdr_nucleotide_percentage_summary_df.rename(columns={'Batch':'Amplicon'}).to_csv(nuc_freq_filename,sep='\t',header=True,index=False)
 
                     plot_root = _jp('4g.HDR_nucleotide_percentage_quilt')
+                    pro_output_name = f'plot_{os.path.basename(plot_root)}.json'
                     plot_4g_input = {
                         'nuc_pct_df': hdr_nucleotide_percentage_summary_df,
                         'mod_pct_df': hdr_modification_percentage_summary_df,
-                        'fig_filename_root': plot_root,
+                        'fig_filename_root': f'{_jp(pro_output_name)}' if not args.use_matplotlib and C2PRO_INSTALLED else plot_root,
                         'save_also_png': save_png,
                         'sgRNA_intervals': sgRNA_intervals,
                         'quantification_window_idxs': include_idxs_list,
                         'sgRNA_names': sgRNA_names,
                         'sgRNA_mismatches': sgRNA_mismatches,
-                        'custom_colors': config["colors"],
+                        'custom_colors': custom_config["colors"],
                     }
                     debug('Plotting HDR nucleotide quilt')
                     plot(CRISPRessoPlot.plot_nucleotide_quilt, plot_4g_input)
@@ -4124,6 +4267,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                             'ref_name': ref_name,
                             'plot_root': plot_root,
                             'save_also_png': save_png,
+                            'custom_colors': custom_config['colors'],
                         }
                         debug('Plotting frameshift analysis for {0}'.format(ref_name))
                         plot(CRISPRessoPlot.plot_frameshift_analysis, plot_5_input)
@@ -4149,6 +4293,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
 
                         'plot_root': plot_root,
                         'save_also_png': save_png,
+                        'ref_name': ref_name,
                     }
                     debug('Plotting frameshift frequency for {0}'.format(ref_name))
                     plot(CRISPRessoPlot.plot_frameshift_frequency, plot_6_input)
@@ -4176,8 +4321,9 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                             ref_name,
                         ),
                         'plot_root': plot_root,
-                        'custom_colors': config["colors"],
+                        'custom_colors': custom_config["colors"],
                         'save_also_png': save_png,
+                        'ref_name': ref_name,
                     }
                     debug('Plotting non-coding mutation positions for {0}'.format(ref_name))
                     plot(CRISPRessoPlot.plot_non_coding_mutations, plot_7_input)
@@ -4191,6 +4337,8 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'count_total': count_total,
                         'plot_root': plot_root,
                         'save_also_png': save_png,
+                        'ref_name': ref_name,
+                        'custom_colors': custom_config['colors'],
                     }
                     debug('Plotting potential splice sites')
                     plot(CRISPRessoPlot.plot_potential_splice_sites, plot_8_input)
@@ -4216,7 +4364,8 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'fig_filename_root': fig_filename_root,
                         'save_also_png': save_png,
                         'quantification_window_idxs': include_idxs_list,
-                        'custom_colors': config['colors']
+                        'custom_colors': custom_config['colors'],
+                        'ref_name': ref_name,
                     }
                     debug('Plotting substitutions across reference for {0}'.format(ref_name))
                     plot(CRISPRessoPlot.plot_subs_across_ref, plot_10a_input)
@@ -4235,7 +4384,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         ),
                         'fig_filename_root': fig_filename_root,
                         'save_also_png': save_png,
-                        'custom_colors': config['colors']
+                        'custom_colors': custom_config['colors']
                     }
                     debug('Plotting substitution frequency barplot for {0}'.format(ref_name))
                     plot(CRISPRessoPlot.plot_sub_freqs, plot_10b_input)
@@ -4250,7 +4399,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'plot_title': get_plot_title_with_ref_name('Substitution frequency\nin quantification window', ref_name),
                         'fig_filename_root': fig_filename_root,
                         'save_also_png': save_png,
-                        'custom_colors': config['colors']
+                        'custom_colors': custom_config['colors']
                     }
                     debug('Plotting substitution frequency barplot in quantification window for {0}'.format(ref_name))
                     plot(CRISPRessoPlot.plot_sub_freqs, plot_10c_input)
@@ -4333,6 +4482,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'reference_seq': ref_seq_around_cut,
                         'df_alleles': df_to_plot,
                         'fig_filename_root': fig_filename_root,
+                        'custom_colors': custom_config["colors"],
                         'MIN_FREQUENCY': args.min_frequency_alleles_around_cut_to_plot,
                         'MAX_N_ROWS': args.max_rows_alleles_around_cut_to_plot,
                         'SAVE_ALSO_PNG': save_png,
@@ -4341,7 +4491,6 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'sgRNA_names': sgRNA_names,
                         'sgRNA_mismatches': sgRNA_mismatches,
                         'annotate_wildtype_allele': args.annotate_wildtype_allele,
-                        'custom_colors': config["colors"],
                     }
                     debug('Plotting allele distribution around cut for {0}'.format(ref_name))
                     plot(CRISPRessoPlot.plot_alleles_table, plot_9_input)
@@ -4428,7 +4577,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                             'conversion_nuc_from': args.conversion_nuc_from,
                             'fig_filename_root': fig_filename_root,
                             'save_also_png': save_png,
-                            'custom_colors': config['colors'],
+                            'custom_colors': custom_config['colors'],
                         }
                         debug('Plotting conversion at {0}s around the {1} for {2}'.format(args.conversion_nuc_from, sgRNA_legend, ref_name))
                         plot(
@@ -4448,7 +4597,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                             'conversion_nuc_from': args.conversion_nuc_from,
                             'fig_filename_root': fig_filename_root,
                             'save_also_png': save_png,
-                            'custom_colors': config['colors']
+                            'custom_colors': custom_config['colors']
                         }
                         debug('Plotting non-reference conversion at {0}s around the {1} for {2}'.format(args.conversion_nuc_from, sgRNA_legend, ref_name))
                         plot(
@@ -4471,7 +4620,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                             'conversion_nuc_from': args.conversion_nuc_from,
                             'fig_filename_root': fig_filename_root,
                             'save_also_png': save_png,
-                            'custom_colors': config['colors']
+                            'custom_colors': custom_config['colors']
                         }
                         debug('Plotting scaled non-reference conversion at {0}s around the {1} for {2}'.format(args.conversion_nuc_from, sgRNA_legend, ref_name))
                         plot(
@@ -4538,6 +4687,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                         'global_non_modified_non_frameshift': global_NON_MODIFIED_NON_FRAMESHIFT,
                         'plot_root': plot_root,
                         'save_also_png': save_png,
+                        'custom_colors': custom_config['colors'],
                     }
                     debug('Plotting global frameshift in-frame mutations pie chart', {'percent_complete': 90})
                     plot(
@@ -4577,6 +4727,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
                     'global_count_total': global_count_total,
                     'plot_root': plot_root,
                     'save_also_png': save_png,
+                    'custom_colors': custom_config['colors'],
                 }
                 debug('Plotting global potential splice sites pie chart', {'percent_complete': 94})
                 plot(CRISPRessoPlot.plot_impact_on_splice_sites, plot_8a_input)
@@ -4592,7 +4743,7 @@ def count_alternate_alleles(sub_base_vectors, ref_name, ref_sequence, ref_total_
             scaffold_insertion_sizes_filename = ""
             if args.prime_editing_pegRNA_scaffold_seq != "":
                 #first, define the sequence we are looking for (extension plus the first base(s) of the scaffold)
-                scaffold_dna_seq = CRISPRessoShared.reverse_complement(args.prime_editing_pegRNA_scaffold_seq)
+                scaffold_dna_seq = CRISPRessoShared.reverse_complement(args.prime_editing_pegRNA_scaffold_seq.upper().replace('U','T'))
                 pe_seq = refs['Prime-edited']['sequence']
                 pe_scaffold_dna_info = get_pe_scaffold_search(pe_seq, args.prime_editing_pegRNA_extension_seq, args.prime_editing_pegRNA_scaffold_seq, args.prime_editing_pegRNA_scaffold_min_match_length)
 
@@ -4655,16 +4806,17 @@ def get_scaffold_len(row, scaffold_start_loc, scaffold_seq):
                 include_idxs_list = refs[ref_names[0]]['include_idxs']
 
                 plot_root = _jp('11a.Prime_editing_nucleotide_percentage_quilt')
+                pro_output_name = f'plot_{os.path.basename(plot_root)}.json'
                 plot_11a_input = {
                     'nuc_pct_df': pe_nucleotide_percentage_summary_df,
                     'mod_pct_df': pe_modification_percentage_summary_df,
-                    'fig_filename_root': plot_root,
+                    'fig_filename_root': f'{_jp(pro_output_name)}' if not args.use_matplotlib and C2PRO_INSTALLED else plot_root,
                     'save_also_png': save_png,
                     'sgRNA_intervals': sgRNA_intervals,
                     'sgRNA_names': sgRNA_names,
                     'sgRNA_mismatches': sgRNA_mismatches,
                     'quantification_window_idxs': include_idxs_list,
-                    'custom_colors': config['colors']
+                    'custom_colors': custom_config['colors']
                 }
                 info('Plotting prime editing nucleotide percentage quilt', {'percent_complete': 96})
                 plot(CRISPRessoPlot.plot_nucleotide_quilt, plot_11a_input)
@@ -4714,16 +4866,17 @@ def get_scaffold_len(row, scaffold_start_loc, scaffold_seq):
                     for x in pe_include_idxs_list:
                         new_include_idx += [x - new_sel_cols_start]
                     plot_root = _jp('11b.Nucleotide_percentage_quilt_around_' + sgRNA_label)
+                    pro_output_name = f'plot_{os.path.basename(plot_root)}.json'
                     plot_11b_input = {
                         'nuc_pct_df': pe_nucleotide_percentage_summary_df.iloc[:, sel_cols],
                         'mod_pct_df': pe_modification_percentage_summary_df.iloc[:, sel_cols],
-                        'fig_filename_root': plot_root,
+                        'fig_filename_root': f'{_jp(pro_output_name)}' if not args.use_matplotlib and C2PRO_INSTALLED else plot_root,
                         'save_also_png': save_png,
                         'sgRNA_intervals': new_sgRNA_intervals,
                         'sgRNA_names': sgRNA_names,
                         'sgRNA_mismatches': sgRNA_mismatches,
                         'quantification_window_idxs': new_include_idx,
-                        'custom_colors': config['colors']
+                        'custom_colors': custom_config['colors']
                     }
                     info('Plotting nucleotide quilt', {'percent_complete': 97})
                     plot(CRISPRessoPlot.plot_nucleotide_quilt, plot_11b_input)
@@ -4803,6 +4956,11 @@ def get_scaffold_len(row, scaffold_start_loc, scaffold_seq):
         crispresso2_info['running_info']['running_time'] = running_time
         crispresso2_info['running_info']['running_time_string'] = running_time_string
 
+        if args.disable_guardrails:
+            crispresso2_info['results']['guardrails_htmls'] = []
+        else:
+            crispresso2_info['results']['guardrails_htmls'] = CRISPRessoShared.safety_check(crispresso2_info, aln_stats, custom_config['guardrails'])
+
 
         if not args.suppress_report:
             if (args.place_report_in_output_folder):
@@ -4833,13 +4991,9 @@ def get_scaffold_len(row, scaffold_start_loc, scaffold_seq):
         print_stacktrace_if_debug()
         error('sgRNA error, please check your input.\n\nERROR: %s' % e)
         sys.exit(2)
-    except CRISPRessoShared.TrimmomaticException as e:
-        print_stacktrace_if_debug()
-        error('Trimming error, please check your input.\n\nERROR: %s' % e)
-        sys.exit(4)
-    except CRISPRessoShared.FlashException as e:
+    except CRISPRessoShared.FastpException as e:
         print_stacktrace_if_debug()
-        error('Merging error, please check your input.\n\nERROR: %s' % e)
+        error('Merging or trimming error, please check your input.\n\nERROR: %s' % e)
         sys.exit(5)
     except CRISPRessoShared.BadParameterException as e:
         print_stacktrace_if_debug()
diff --git a/CRISPResso2/CRISPRessoCOREResources.c b/CRISPResso2/CRISPRessoCOREResources.c
index 9d3b6102..b312833b 100644
--- a/CRISPResso2/CRISPRessoCOREResources.c
+++ b/CRISPResso2/CRISPRessoCOREResources.c
@@ -1,21 +1,21 @@
-/* Generated by Cython 3.0.6 */
+/* Generated by Cython 3.0.9 */
 
 /* BEGIN: Cython Metadata
 {
     "distutils": {
         "depends": [
-            "/opt/conda/lib/python3.10/site-packages/numpy/core/include/numpy/arrayobject.h",
-            "/opt/conda/lib/python3.10/site-packages/numpy/core/include/numpy/arrayscalars.h",
-            "/opt/conda/lib/python3.10/site-packages/numpy/core/include/numpy/ndarrayobject.h",
-            "/opt/conda/lib/python3.10/site-packages/numpy/core/include/numpy/ndarraytypes.h",
-            "/opt/conda/lib/python3.10/site-packages/numpy/core/include/numpy/ufuncobject.h"
+            "/Users/cole/mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/core/include/numpy/arrayobject.h",
+            "/Users/cole/mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/core/include/numpy/arrayscalars.h",
+            "/Users/cole/mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/core/include/numpy/ndarrayobject.h",
+            "/Users/cole/mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/core/include/numpy/ndarraytypes.h",
+            "/Users/cole/mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/core/include/numpy/ufuncobject.h"
         ],
         "extra_compile_args": [
             "-w",
             "-Ofast"
         ],
         "include_dirs": [
-            "/opt/conda/lib/python3.10/site-packages/numpy/core/include"
+            "/Users/cole/mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/core/include"
         ],
         "name": "CRISPResso2.CRISPRessoCOREResources",
         "sources": [
@@ -50,10 +50,10 @@ END: Cython Metadata */
 #else
 #define __PYX_EXTRA_ABI_MODULE_NAME ""
 #endif
-#define CYTHON_ABI "3_0_6" __PYX_EXTRA_ABI_MODULE_NAME
+#define CYTHON_ABI "3_0_9" __PYX_EXTRA_ABI_MODULE_NAME
 #define __PYX_ABI_MODULE_NAME "_cython_" CYTHON_ABI
 #define __PYX_TYPE_MODULE_PREFIX __PYX_ABI_MODULE_NAME "."
-#define CYTHON_HEX_VERSION 0x030006F0
+#define CYTHON_HEX_VERSION 0x030009F0
 #define CYTHON_FUTURE_DIVISION 1
 #include <stddef.h>
 #ifndef offsetof
@@ -595,14 +595,14 @@ END: Cython Metadata */
         PyObject *exception_table = NULL;
         PyObject *types_module=NULL, *code_type=NULL, *result=NULL;
         #if __PYX_LIMITED_VERSION_HEX < 0x030B0000
-        PyObject *version_info; // borrowed
+        PyObject *version_info;
         PyObject *py_minor_version = NULL;
         #endif
         long minor_version = 0;
         PyObject *type, *value, *traceback;
         PyErr_Fetch(&type, &value, &traceback);
         #if __PYX_LIMITED_VERSION_HEX >= 0x030B0000
-        minor_version = 11; // we don't yet need to distinguish between versions > 11
+        minor_version = 11;
         #else
         if (!(version_info = PySys_GetObject("version_info"))) goto end;
         if (!(py_minor_version = PySequence_GetItem(version_info, 1))) goto end;
@@ -660,7 +660,7 @@ END: Cython Metadata */
                                                     PyObject *fv, PyObject *cell, PyObject* fn,
                                                     PyObject *name, int fline, PyObject *lnos) {
     PyCodeObject *result;
-    PyObject *empty_bytes = PyBytes_FromStringAndSize("", 0);  // we don't have access to __pyx_empty_bytes here
+    PyObject *empty_bytes = PyBytes_FromStringAndSize("", 0);
     if (!empty_bytes) return NULL;
     result =
       #if PY_VERSION_HEX >= 0x030C0000
@@ -746,8 +746,13 @@ END: Cython Metadata */
   typedef PyObject *(*__Pyx_PyCFunctionFastWithKeywords) (PyObject *self, PyObject *const *args,
                                                           Py_ssize_t nargs, PyObject *kwnames);
 #else
-  #define __Pyx_PyCFunctionFast _PyCFunctionFast
-  #define __Pyx_PyCFunctionFastWithKeywords _PyCFunctionFastWithKeywords
+  #if PY_VERSION_HEX >= 0x030d00A4
+  #  define __Pyx_PyCFunctionFast PyCFunctionFast
+  #  define __Pyx_PyCFunctionFastWithKeywords PyCFunctionFastWithKeywords
+  #else
+  #  define __Pyx_PyCFunctionFast _PyCFunctionFast
+  #  define __Pyx_PyCFunctionFastWithKeywords _PyCFunctionFastWithKeywords
+  #endif
 #endif
 #if CYTHON_METH_FASTCALL
   #define __Pyx_METH_FASTCALL METH_FASTCALL
@@ -1099,7 +1104,7 @@ static CYTHON_INLINE PyObject * __Pyx_PyDict_GetItemStrWithError(PyObject *dict,
   #define __Pyx_PyBytes_GET_SIZE(o) PyBytes_Size(o)
   #define __Pyx_PyByteArray_GET_SIZE(o) PyByteArray_Size(o)
 #endif
-#if PY_VERSION_HEX >= 0x030d00A1
+#if __PYX_LIMITED_VERSION_HEX >= 0x030d00A1
   #define __Pyx_PyImport_AddModuleRef(name) PyImport_AddModuleRef(name)
 #else
   static CYTHON_INLINE PyObject *__Pyx_PyImport_AddModuleRef(const char *name) {
@@ -1186,7 +1191,7 @@ static CYTHON_INLINE float __PYX_NAN() {
 #endif
 
 #define __PYX_MARK_ERR_POS(f_index, lineno) \
-    { __pyx_filename = __pyx_f[f_index]; (void)__pyx_filename; __pyx_lineno = lineno; (void)__pyx_lineno; __pyx_clineno = __LINE__; (void)__pyx_clineno; }
+    { __pyx_filename = __pyx_f[f_index]; (void)__pyx_filename; __pyx_lineno = lineno; (void)__pyx_lineno; __pyx_clineno = __LINE__;  (void)__pyx_clineno; }
 #define __PYX_ERR(f_index, lineno, Ln_error) \
     { __PYX_MARK_ERR_POS(f_index, lineno) goto Ln_error; }
 
@@ -1300,24 +1305,7 @@ static CYTHON_INLINE PyObject* __Pyx_PyUnicode_FromString(const char*);
 #define __Pyx_PyByteArray_FromCString(s)   __Pyx_PyByteArray_FromString((const char*)s)
 #define __Pyx_PyStr_FromCString(s)     __Pyx_PyStr_FromString((const char*)s)
 #define __Pyx_PyUnicode_FromCString(s) __Pyx_PyUnicode_FromString((const char*)s)
-#if CYTHON_COMPILING_IN_LIMITED_API
-static CYTHON_INLINE size_t __Pyx_Py_UNICODE_strlen(const wchar_t *u)
-{
-    const wchar_t *u_end = u;
-    while (*u_end++) ;
-    return (size_t)(u_end - u - 1);
-}
-#else
-static CYTHON_INLINE size_t __Pyx_Py_UNICODE_strlen(const Py_UNICODE *u)
-{
-    const Py_UNICODE *u_end = u;
-    while (*u_end++) ;
-    return (size_t)(u_end - u - 1);
-}
-#endif
 #define __Pyx_PyUnicode_FromOrdinal(o)       PyUnicode_FromOrdinal((int)o)
-#define __Pyx_PyUnicode_FromUnicode(u)       PyUnicode_FromUnicode(u, __Pyx_Py_UNICODE_strlen(u))
-#define __Pyx_PyUnicode_FromUnicodeAndLength PyUnicode_FromUnicode
 #define __Pyx_PyUnicode_AsUnicode            PyUnicode_AsUnicode
 #define __Pyx_NewRef(obj) (Py_INCREF(obj), obj)
 #define __Pyx_Owned_Py_None(b) __Pyx_NewRef(Py_None)
@@ -1367,7 +1355,7 @@ static CYTHON_INLINE Py_hash_t __Pyx_PyIndex_AsHash_t(PyObject*);
   #endif
   typedef Py_ssize_t  __Pyx_compact_pylong;
   typedef size_t  __Pyx_compact_upylong;
-  #else  // Py < 3.12
+  #else
   #define __Pyx_PyLong_IsNeg(x)  (Py_SIZE(x) < 0)
   #define __Pyx_PyLong_IsNonNeg(x)  (Py_SIZE(x) >= 0)
   #define __Pyx_PyLong_IsZero(x)  (Py_SIZE(x) == 0)
@@ -1520,7 +1508,7 @@ static const char *__pyx_f[] = {
 
 /* #### Code section: numeric_typedefs ### */
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":730
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":730
  * # in Cython to enable them only on the right systems.
  * 
  * ctypedef npy_int8       int8_t             # <<<<<<<<<<<<<<
@@ -1529,7 +1517,7 @@ static const char *__pyx_f[] = {
  */
 typedef npy_int8 __pyx_t_5numpy_int8_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":731
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":731
  * 
  * ctypedef npy_int8       int8_t
  * ctypedef npy_int16      int16_t             # <<<<<<<<<<<<<<
@@ -1538,7 +1526,7 @@ typedef npy_int8 __pyx_t_5numpy_int8_t;
  */
 typedef npy_int16 __pyx_t_5numpy_int16_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":732
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":732
  * ctypedef npy_int8       int8_t
  * ctypedef npy_int16      int16_t
  * ctypedef npy_int32      int32_t             # <<<<<<<<<<<<<<
@@ -1547,7 +1535,7 @@ typedef npy_int16 __pyx_t_5numpy_int16_t;
  */
 typedef npy_int32 __pyx_t_5numpy_int32_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":733
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":733
  * ctypedef npy_int16      int16_t
  * ctypedef npy_int32      int32_t
  * ctypedef npy_int64      int64_t             # <<<<<<<<<<<<<<
@@ -1556,7 +1544,7 @@ typedef npy_int32 __pyx_t_5numpy_int32_t;
  */
 typedef npy_int64 __pyx_t_5numpy_int64_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":737
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":737
  * #ctypedef npy_int128     int128_t
  * 
  * ctypedef npy_uint8      uint8_t             # <<<<<<<<<<<<<<
@@ -1565,7 +1553,7 @@ typedef npy_int64 __pyx_t_5numpy_int64_t;
  */
 typedef npy_uint8 __pyx_t_5numpy_uint8_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":738
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":738
  * 
  * ctypedef npy_uint8      uint8_t
  * ctypedef npy_uint16     uint16_t             # <<<<<<<<<<<<<<
@@ -1574,7 +1562,7 @@ typedef npy_uint8 __pyx_t_5numpy_uint8_t;
  */
 typedef npy_uint16 __pyx_t_5numpy_uint16_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":739
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":739
  * ctypedef npy_uint8      uint8_t
  * ctypedef npy_uint16     uint16_t
  * ctypedef npy_uint32     uint32_t             # <<<<<<<<<<<<<<
@@ -1583,7 +1571,7 @@ typedef npy_uint16 __pyx_t_5numpy_uint16_t;
  */
 typedef npy_uint32 __pyx_t_5numpy_uint32_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":740
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":740
  * ctypedef npy_uint16     uint16_t
  * ctypedef npy_uint32     uint32_t
  * ctypedef npy_uint64     uint64_t             # <<<<<<<<<<<<<<
@@ -1592,7 +1580,7 @@ typedef npy_uint32 __pyx_t_5numpy_uint32_t;
  */
 typedef npy_uint64 __pyx_t_5numpy_uint64_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":744
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":744
  * #ctypedef npy_uint128    uint128_t
  * 
  * ctypedef npy_float32    float32_t             # <<<<<<<<<<<<<<
@@ -1601,7 +1589,7 @@ typedef npy_uint64 __pyx_t_5numpy_uint64_t;
  */
 typedef npy_float32 __pyx_t_5numpy_float32_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":745
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":745
  * 
  * ctypedef npy_float32    float32_t
  * ctypedef npy_float64    float64_t             # <<<<<<<<<<<<<<
@@ -1610,7 +1598,7 @@ typedef npy_float32 __pyx_t_5numpy_float32_t;
  */
 typedef npy_float64 __pyx_t_5numpy_float64_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":754
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":754
  * # The int types are mapped a bit surprising --
  * # numpy.int corresponds to 'l' and numpy.long to 'q'
  * ctypedef npy_long       int_t             # <<<<<<<<<<<<<<
@@ -1619,7 +1607,7 @@ typedef npy_float64 __pyx_t_5numpy_float64_t;
  */
 typedef npy_long __pyx_t_5numpy_int_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":755
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":755
  * # numpy.int corresponds to 'l' and numpy.long to 'q'
  * ctypedef npy_long       int_t
  * ctypedef npy_longlong   longlong_t             # <<<<<<<<<<<<<<
@@ -1628,7 +1616,7 @@ typedef npy_long __pyx_t_5numpy_int_t;
  */
 typedef npy_longlong __pyx_t_5numpy_longlong_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":757
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":757
  * ctypedef npy_longlong   longlong_t
  * 
  * ctypedef npy_ulong      uint_t             # <<<<<<<<<<<<<<
@@ -1637,7 +1625,7 @@ typedef npy_longlong __pyx_t_5numpy_longlong_t;
  */
 typedef npy_ulong __pyx_t_5numpy_uint_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":758
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":758
  * 
  * ctypedef npy_ulong      uint_t
  * ctypedef npy_ulonglong  ulonglong_t             # <<<<<<<<<<<<<<
@@ -1646,7 +1634,7 @@ typedef npy_ulong __pyx_t_5numpy_uint_t;
  */
 typedef npy_ulonglong __pyx_t_5numpy_ulonglong_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":760
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":760
  * ctypedef npy_ulonglong  ulonglong_t
  * 
  * ctypedef npy_intp       intp_t             # <<<<<<<<<<<<<<
@@ -1655,7 +1643,7 @@ typedef npy_ulonglong __pyx_t_5numpy_ulonglong_t;
  */
 typedef npy_intp __pyx_t_5numpy_intp_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":761
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":761
  * 
  * ctypedef npy_intp       intp_t
  * ctypedef npy_uintp      uintp_t             # <<<<<<<<<<<<<<
@@ -1664,7 +1652,7 @@ typedef npy_intp __pyx_t_5numpy_intp_t;
  */
 typedef npy_uintp __pyx_t_5numpy_uintp_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":763
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":763
  * ctypedef npy_uintp      uintp_t
  * 
  * ctypedef npy_double     float_t             # <<<<<<<<<<<<<<
@@ -1673,7 +1661,7 @@ typedef npy_uintp __pyx_t_5numpy_uintp_t;
  */
 typedef npy_double __pyx_t_5numpy_float_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":764
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":764
  * 
  * ctypedef npy_double     float_t
  * ctypedef npy_double     double_t             # <<<<<<<<<<<<<<
@@ -1682,7 +1670,7 @@ typedef npy_double __pyx_t_5numpy_float_t;
  */
 typedef npy_double __pyx_t_5numpy_double_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":765
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":765
  * ctypedef npy_double     float_t
  * ctypedef npy_double     double_t
  * ctypedef npy_longdouble longdouble_t             # <<<<<<<<<<<<<<
@@ -1719,7 +1707,7 @@ static CYTHON_INLINE __pyx_t_double_complex __pyx_t_double_complex_from_parts(do
 
 /*--- Type declarations ---*/
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":767
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":767
  * ctypedef npy_longdouble longdouble_t
  * 
  * ctypedef npy_cfloat      cfloat_t             # <<<<<<<<<<<<<<
@@ -1728,7 +1716,7 @@ static CYTHON_INLINE __pyx_t_double_complex __pyx_t_double_complex_from_parts(do
  */
 typedef npy_cfloat __pyx_t_5numpy_cfloat_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":768
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":768
  * 
  * ctypedef npy_cfloat      cfloat_t
  * ctypedef npy_cdouble     cdouble_t             # <<<<<<<<<<<<<<
@@ -1737,7 +1725,7 @@ typedef npy_cfloat __pyx_t_5numpy_cfloat_t;
  */
 typedef npy_cdouble __pyx_t_5numpy_cdouble_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":769
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":769
  * ctypedef npy_cfloat      cfloat_t
  * ctypedef npy_cdouble     cdouble_t
  * ctypedef npy_clongdouble clongdouble_t             # <<<<<<<<<<<<<<
@@ -1746,7 +1734,7 @@ typedef npy_cdouble __pyx_t_5numpy_cdouble_t;
  */
 typedef npy_clongdouble __pyx_t_5numpy_clongdouble_t;
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":771
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":771
  * ctypedef npy_clongdouble clongdouble_t
  * 
  * ctypedef npy_cdouble     complex_t             # <<<<<<<<<<<<<<
@@ -1961,8 +1949,8 @@ static CYTHON_INLINE int __Pyx_PyUnicode_Equals(PyObject* s1, PyObject* s2, int
     #define __Pyx_Arg_NewRef_VARARGS(arg) __Pyx_NewRef(arg)
     #define __Pyx_Arg_XDECREF_VARARGS(arg) Py_XDECREF(arg)
 #else
-    #define __Pyx_Arg_NewRef_VARARGS(arg) arg // no-op
-    #define __Pyx_Arg_XDECREF_VARARGS(arg) // no-op - arg is borrowed
+    #define __Pyx_Arg_NewRef_VARARGS(arg) arg
+    #define __Pyx_Arg_XDECREF_VARARGS(arg)
 #endif
 #define __Pyx_NumKwargs_VARARGS(kwds) PyDict_Size(kwds)
 #define __Pyx_KwValues_VARARGS(args, nargs) NULL
@@ -1978,8 +1966,9 @@ static CYTHON_INLINE int __Pyx_PyUnicode_Equals(PyObject* s1, PyObject* s2, int
   #else
     #define __Pyx_KwargsAsDict_FASTCALL(kw, kwvalues) _PyStack_AsDict(kwvalues, kw)
   #endif
-    #define __Pyx_Arg_NewRef_FASTCALL(arg) arg // no-op, __Pyx_Arg_FASTCALL is direct and this needs
-    #define __Pyx_Arg_XDECREF_FASTCALL(arg)  // no-op - arg was returned from array
+    #define __Pyx_Arg_NewRef_FASTCALL(arg) arg  /* no-op, __Pyx_Arg_FASTCALL is direct and this needs
+                                                   to have the same reference counting */
+    #define __Pyx_Arg_XDECREF_FASTCALL(arg)
 #else
     #define __Pyx_Arg_FASTCALL __Pyx_Arg_VARARGS
     #define __Pyx_NumKwargs_FASTCALL __Pyx_NumKwargs_VARARGS
@@ -2214,22 +2203,22 @@ static CYTHON_INLINE int __Pyx_IterFinish(void);
 static int __Pyx_IternextUnpackEndCheck(PyObject *retval, Py_ssize_t expected);
 
 /* TypeImport.proto */
-#ifndef __PYX_HAVE_RT_ImportType_proto_3_0_6
-#define __PYX_HAVE_RT_ImportType_proto_3_0_6
+#ifndef __PYX_HAVE_RT_ImportType_proto_3_0_9
+#define __PYX_HAVE_RT_ImportType_proto_3_0_9
 #if defined (__STDC_VERSION__) && __STDC_VERSION__ >= 201112L
 #include <stdalign.h>
 #endif
 #if (defined (__STDC_VERSION__) && __STDC_VERSION__ >= 201112L) || __cplusplus >= 201103L
-#define __PYX_GET_STRUCT_ALIGNMENT_3_0_6(s) alignof(s)
+#define __PYX_GET_STRUCT_ALIGNMENT_3_0_9(s) alignof(s)
 #else
-#define __PYX_GET_STRUCT_ALIGNMENT_3_0_6(s) sizeof(void*)
+#define __PYX_GET_STRUCT_ALIGNMENT_3_0_9(s) sizeof(void*)
 #endif
-enum __Pyx_ImportType_CheckSize_3_0_6 {
-   __Pyx_ImportType_CheckSize_Error_3_0_6 = 0,
-   __Pyx_ImportType_CheckSize_Warn_3_0_6 = 1,
-   __Pyx_ImportType_CheckSize_Ignore_3_0_6 = 2
+enum __Pyx_ImportType_CheckSize_3_0_9 {
+   __Pyx_ImportType_CheckSize_Error_3_0_9 = 0,
+   __Pyx_ImportType_CheckSize_Warn_3_0_9 = 1,
+   __Pyx_ImportType_CheckSize_Ignore_3_0_9 = 2
 };
-static PyTypeObject *__Pyx_ImportType_3_0_6(PyObject* module, const char *module_name, const char *class_name, size_t size, size_t alignment, enum __Pyx_ImportType_CheckSize_3_0_6 check_size);
+static PyTypeObject *__Pyx_ImportType_3_0_9(PyObject* module, const char *module_name, const char *class_name, size_t size, size_t alignment, enum __Pyx_ImportType_CheckSize_3_0_9 check_size);
 #endif
 
 /* Import.proto */
@@ -2350,7 +2339,7 @@ typedef struct {
 #endif
     void *defaults;
     int defaults_pyobjects;
-    size_t defaults_size;  // used by FusedFunction for copying defaults
+    size_t defaults_size;
     int flags;
     PyObject *defaults_tuple;
     PyObject *defaults_kwdict;
@@ -2747,6 +2736,7 @@ static const char __pyx_k_substitution_positions[] = "substitution_positions";
 static const char __pyx_k_ResultsSlotsDict___init[] = "ResultsSlotsDict.__init__";
 static const char __pyx_k_all_insertion_positions[] = "all_insertion_positions";
 static const char __pyx_k_all_substitution_values[] = "all_substitution_values";
+static const char __pyx_k_all_deletion_coordinates[] = "all_deletion_coordinates";
 static const char __pyx_k_find_indels_substitutions[] = "find_indels_substitutions";
 static const char __pyx_k_ResultsSlotsDict___getitem[] = "ResultsSlotsDict.__getitem__";
 static const char __pyx_k_ResultsSlotsDict___setitem[] = "ResultsSlotsDict.__setitem__";
@@ -2848,6 +2838,8 @@ typedef struct {
   PyObject *__pyx_n_s__4;
   PyObject *__pyx_n_s_a;
   PyObject *__pyx_n_s_al;
+  PyObject *__pyx_n_s_all_deletion_coordinates;
+  PyObject *__pyx_n_u_all_deletion_coordinates;
   PyObject *__pyx_n_s_all_deletion_positions;
   PyObject *__pyx_n_u_all_deletion_positions;
   PyObject *__pyx_n_s_all_insertion_left_positions;
@@ -3056,6 +3048,8 @@ static int __pyx_m_clear(PyObject *m) {
   Py_CLEAR(clear_module_state->__pyx_n_s__4);
   Py_CLEAR(clear_module_state->__pyx_n_s_a);
   Py_CLEAR(clear_module_state->__pyx_n_s_al);
+  Py_CLEAR(clear_module_state->__pyx_n_s_all_deletion_coordinates);
+  Py_CLEAR(clear_module_state->__pyx_n_u_all_deletion_coordinates);
   Py_CLEAR(clear_module_state->__pyx_n_s_all_deletion_positions);
   Py_CLEAR(clear_module_state->__pyx_n_u_all_deletion_positions);
   Py_CLEAR(clear_module_state->__pyx_n_s_all_insertion_left_positions);
@@ -3242,6 +3236,8 @@ static int __pyx_m_traverse(PyObject *m, visitproc visit, void *arg) {
   Py_VISIT(traverse_module_state->__pyx_n_s__4);
   Py_VISIT(traverse_module_state->__pyx_n_s_a);
   Py_VISIT(traverse_module_state->__pyx_n_s_al);
+  Py_VISIT(traverse_module_state->__pyx_n_s_all_deletion_coordinates);
+  Py_VISIT(traverse_module_state->__pyx_n_u_all_deletion_coordinates);
   Py_VISIT(traverse_module_state->__pyx_n_s_all_deletion_positions);
   Py_VISIT(traverse_module_state->__pyx_n_u_all_deletion_positions);
   Py_VISIT(traverse_module_state->__pyx_n_s_all_insertion_left_positions);
@@ -3458,6 +3454,8 @@ static int __pyx_m_traverse(PyObject *m, visitproc visit, void *arg) {
 #define __pyx_n_s__4 __pyx_mstate_global->__pyx_n_s__4
 #define __pyx_n_s_a __pyx_mstate_global->__pyx_n_s_a
 #define __pyx_n_s_al __pyx_mstate_global->__pyx_n_s_al
+#define __pyx_n_s_all_deletion_coordinates __pyx_mstate_global->__pyx_n_s_all_deletion_coordinates
+#define __pyx_n_u_all_deletion_coordinates __pyx_mstate_global->__pyx_n_u_all_deletion_coordinates
 #define __pyx_n_s_all_deletion_positions __pyx_mstate_global->__pyx_n_s_all_deletion_positions
 #define __pyx_n_u_all_deletion_positions __pyx_mstate_global->__pyx_n_u_all_deletion_positions
 #define __pyx_n_s_all_insertion_left_positions __pyx_mstate_global->__pyx_n_s_all_insertion_left_positions
@@ -3592,7 +3590,7 @@ static int __pyx_m_traverse(PyObject *m, visitproc visit, void *arg) {
 #define __pyx_codeobj__19 __pyx_mstate_global->__pyx_codeobj__19
 /* #### Code section: module_code ### */
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":245
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":245
  * 
  *         @property
  *         cdef inline PyObject* base(self) nogil:             # <<<<<<<<<<<<<<
@@ -3603,7 +3601,7 @@ static int __pyx_m_traverse(PyObject *m, visitproc visit, void *arg) {
 static CYTHON_INLINE PyObject *__pyx_f_5numpy_7ndarray_4base_base(PyArrayObject *__pyx_v_self) {
   PyObject *__pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":248
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":248
  *             """Returns a borrowed reference to the object owning the data/memory.
  *             """
  *             return PyArray_BASE(self)             # <<<<<<<<<<<<<<
@@ -3613,7 +3611,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_7ndarray_4base_base(PyArrayObject
   __pyx_r = PyArray_BASE(__pyx_v_self);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":245
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":245
  * 
  *         @property
  *         cdef inline PyObject* base(self) nogil:             # <<<<<<<<<<<<<<
@@ -3626,7 +3624,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_7ndarray_4base_base(PyArrayObject
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":251
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":251
  * 
  *         @property
  *         cdef inline dtype descr(self):             # <<<<<<<<<<<<<<
@@ -3640,7 +3638,7 @@ static CYTHON_INLINE PyArray_Descr *__pyx_f_5numpy_7ndarray_5descr_descr(PyArray
   PyArray_Descr *__pyx_t_1;
   __Pyx_RefNannySetupContext("descr", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":254
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":254
  *             """Returns an owned reference to the dtype of the array.
  *             """
  *             return <dtype>PyArray_DESCR(self)             # <<<<<<<<<<<<<<
@@ -3653,7 +3651,7 @@ static CYTHON_INLINE PyArray_Descr *__pyx_f_5numpy_7ndarray_5descr_descr(PyArray
   __pyx_r = ((PyArray_Descr *)__pyx_t_1);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":251
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":251
  * 
  *         @property
  *         cdef inline dtype descr(self):             # <<<<<<<<<<<<<<
@@ -3668,7 +3666,7 @@ static CYTHON_INLINE PyArray_Descr *__pyx_f_5numpy_7ndarray_5descr_descr(PyArray
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":257
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":257
  * 
  *         @property
  *         cdef inline int ndim(self) nogil:             # <<<<<<<<<<<<<<
@@ -3679,7 +3677,7 @@ static CYTHON_INLINE PyArray_Descr *__pyx_f_5numpy_7ndarray_5descr_descr(PyArray
 static CYTHON_INLINE int __pyx_f_5numpy_7ndarray_4ndim_ndim(PyArrayObject *__pyx_v_self) {
   int __pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":260
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":260
  *             """Returns the number of dimensions in the array.
  *             """
  *             return PyArray_NDIM(self)             # <<<<<<<<<<<<<<
@@ -3689,7 +3687,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_7ndarray_4ndim_ndim(PyArrayObject *__pyx
   __pyx_r = PyArray_NDIM(__pyx_v_self);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":257
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":257
  * 
  *         @property
  *         cdef inline int ndim(self) nogil:             # <<<<<<<<<<<<<<
@@ -3702,7 +3700,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_7ndarray_4ndim_ndim(PyArrayObject *__pyx
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":263
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":263
  * 
  *         @property
  *         cdef inline npy_intp *shape(self) nogil:             # <<<<<<<<<<<<<<
@@ -3713,7 +3711,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_7ndarray_4ndim_ndim(PyArrayObject *__pyx
 static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_5shape_shape(PyArrayObject *__pyx_v_self) {
   npy_intp *__pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":268
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":268
  *             Can return NULL for 0-dimensional arrays.
  *             """
  *             return PyArray_DIMS(self)             # <<<<<<<<<<<<<<
@@ -3723,7 +3721,7 @@ static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_5shape_shape(PyArrayObjec
   __pyx_r = PyArray_DIMS(__pyx_v_self);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":263
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":263
  * 
  *         @property
  *         cdef inline npy_intp *shape(self) nogil:             # <<<<<<<<<<<<<<
@@ -3736,7 +3734,7 @@ static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_5shape_shape(PyArrayObjec
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":271
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":271
  * 
  *         @property
  *         cdef inline npy_intp *strides(self) nogil:             # <<<<<<<<<<<<<<
@@ -3747,7 +3745,7 @@ static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_5shape_shape(PyArrayObjec
 static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_7strides_strides(PyArrayObject *__pyx_v_self) {
   npy_intp *__pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":275
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":275
  *             The number of elements matches the number of dimensions of the array (ndim).
  *             """
  *             return PyArray_STRIDES(self)             # <<<<<<<<<<<<<<
@@ -3757,7 +3755,7 @@ static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_7strides_strides(PyArrayO
   __pyx_r = PyArray_STRIDES(__pyx_v_self);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":271
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":271
  * 
  *         @property
  *         cdef inline npy_intp *strides(self) nogil:             # <<<<<<<<<<<<<<
@@ -3770,7 +3768,7 @@ static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_7strides_strides(PyArrayO
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":278
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":278
  * 
  *         @property
  *         cdef inline npy_intp size(self) nogil:             # <<<<<<<<<<<<<<
@@ -3781,7 +3779,7 @@ static CYTHON_INLINE npy_intp *__pyx_f_5numpy_7ndarray_7strides_strides(PyArrayO
 static CYTHON_INLINE npy_intp __pyx_f_5numpy_7ndarray_4size_size(PyArrayObject *__pyx_v_self) {
   npy_intp __pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":281
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":281
  *             """Returns the total size (in number of elements) of the array.
  *             """
  *             return PyArray_SIZE(self)             # <<<<<<<<<<<<<<
@@ -3791,7 +3789,7 @@ static CYTHON_INLINE npy_intp __pyx_f_5numpy_7ndarray_4size_size(PyArrayObject *
   __pyx_r = PyArray_SIZE(__pyx_v_self);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":278
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":278
  * 
  *         @property
  *         cdef inline npy_intp size(self) nogil:             # <<<<<<<<<<<<<<
@@ -3804,7 +3802,7 @@ static CYTHON_INLINE npy_intp __pyx_f_5numpy_7ndarray_4size_size(PyArrayObject *
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":284
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":284
  * 
  *         @property
  *         cdef inline char* data(self) nogil:             # <<<<<<<<<<<<<<
@@ -3815,7 +3813,7 @@ static CYTHON_INLINE npy_intp __pyx_f_5numpy_7ndarray_4size_size(PyArrayObject *
 static CYTHON_INLINE char *__pyx_f_5numpy_7ndarray_4data_data(PyArrayObject *__pyx_v_self) {
   char *__pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":290
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":290
  *             of `PyArray_DATA()` instead, which returns a 'void*'.
  *             """
  *             return PyArray_BYTES(self)             # <<<<<<<<<<<<<<
@@ -3825,7 +3823,7 @@ static CYTHON_INLINE char *__pyx_f_5numpy_7ndarray_4data_data(PyArrayObject *__p
   __pyx_r = PyArray_BYTES(__pyx_v_self);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":284
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":284
  * 
  *         @property
  *         cdef inline char* data(self) nogil:             # <<<<<<<<<<<<<<
@@ -3838,7 +3836,7 @@ static CYTHON_INLINE char *__pyx_f_5numpy_7ndarray_4data_data(PyArrayObject *__p
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":773
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":773
  * ctypedef npy_cdouble     complex_t
  * 
  * cdef inline object PyArray_MultiIterNew1(a):             # <<<<<<<<<<<<<<
@@ -3855,7 +3853,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew1(PyObject *__
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("PyArray_MultiIterNew1", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":774
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":774
  * 
  * cdef inline object PyArray_MultiIterNew1(a):
  *     return PyArray_MultiIterNew(1, <void*>a)             # <<<<<<<<<<<<<<
@@ -3869,7 +3867,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew1(PyObject *__
   __pyx_t_1 = 0;
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":773
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":773
  * ctypedef npy_cdouble     complex_t
  * 
  * cdef inline object PyArray_MultiIterNew1(a):             # <<<<<<<<<<<<<<
@@ -3888,7 +3886,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew1(PyObject *__
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":776
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":776
  *     return PyArray_MultiIterNew(1, <void*>a)
  * 
  * cdef inline object PyArray_MultiIterNew2(a, b):             # <<<<<<<<<<<<<<
@@ -3905,7 +3903,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew2(PyObject *__
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("PyArray_MultiIterNew2", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":777
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":777
  * 
  * cdef inline object PyArray_MultiIterNew2(a, b):
  *     return PyArray_MultiIterNew(2, <void*>a, <void*>b)             # <<<<<<<<<<<<<<
@@ -3919,7 +3917,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew2(PyObject *__
   __pyx_t_1 = 0;
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":776
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":776
  *     return PyArray_MultiIterNew(1, <void*>a)
  * 
  * cdef inline object PyArray_MultiIterNew2(a, b):             # <<<<<<<<<<<<<<
@@ -3938,7 +3936,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew2(PyObject *__
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":779
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":779
  *     return PyArray_MultiIterNew(2, <void*>a, <void*>b)
  * 
  * cdef inline object PyArray_MultiIterNew3(a, b, c):             # <<<<<<<<<<<<<<
@@ -3955,7 +3953,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew3(PyObject *__
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("PyArray_MultiIterNew3", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":780
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":780
  * 
  * cdef inline object PyArray_MultiIterNew3(a, b, c):
  *     return PyArray_MultiIterNew(3, <void*>a, <void*>b, <void*> c)             # <<<<<<<<<<<<<<
@@ -3969,7 +3967,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew3(PyObject *__
   __pyx_t_1 = 0;
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":779
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":779
  *     return PyArray_MultiIterNew(2, <void*>a, <void*>b)
  * 
  * cdef inline object PyArray_MultiIterNew3(a, b, c):             # <<<<<<<<<<<<<<
@@ -3988,7 +3986,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew3(PyObject *__
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":782
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":782
  *     return PyArray_MultiIterNew(3, <void*>a, <void*>b, <void*> c)
  * 
  * cdef inline object PyArray_MultiIterNew4(a, b, c, d):             # <<<<<<<<<<<<<<
@@ -4005,7 +4003,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew4(PyObject *__
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("PyArray_MultiIterNew4", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":783
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":783
  * 
  * cdef inline object PyArray_MultiIterNew4(a, b, c, d):
  *     return PyArray_MultiIterNew(4, <void*>a, <void*>b, <void*>c, <void*> d)             # <<<<<<<<<<<<<<
@@ -4019,7 +4017,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew4(PyObject *__
   __pyx_t_1 = 0;
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":782
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":782
  *     return PyArray_MultiIterNew(3, <void*>a, <void*>b, <void*> c)
  * 
  * cdef inline object PyArray_MultiIterNew4(a, b, c, d):             # <<<<<<<<<<<<<<
@@ -4038,7 +4036,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew4(PyObject *__
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":785
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":785
  *     return PyArray_MultiIterNew(4, <void*>a, <void*>b, <void*>c, <void*> d)
  * 
  * cdef inline object PyArray_MultiIterNew5(a, b, c, d, e):             # <<<<<<<<<<<<<<
@@ -4055,7 +4053,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew5(PyObject *__
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("PyArray_MultiIterNew5", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":786
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":786
  * 
  * cdef inline object PyArray_MultiIterNew5(a, b, c, d, e):
  *     return PyArray_MultiIterNew(5, <void*>a, <void*>b, <void*>c, <void*> d, <void*> e)             # <<<<<<<<<<<<<<
@@ -4069,7 +4067,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew5(PyObject *__
   __pyx_t_1 = 0;
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":785
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":785
  *     return PyArray_MultiIterNew(4, <void*>a, <void*>b, <void*>c, <void*> d)
  * 
  * cdef inline object PyArray_MultiIterNew5(a, b, c, d, e):             # <<<<<<<<<<<<<<
@@ -4088,7 +4086,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyArray_MultiIterNew5(PyObject *__
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":788
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":788
  *     return PyArray_MultiIterNew(5, <void*>a, <void*>b, <void*>c, <void*> d, <void*> e)
  * 
  * cdef inline tuple PyDataType_SHAPE(dtype d):             # <<<<<<<<<<<<<<
@@ -4102,7 +4100,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyDataType_SHAPE(PyArray_Descr *__
   int __pyx_t_1;
   __Pyx_RefNannySetupContext("PyDataType_SHAPE", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":789
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":789
  * 
  * cdef inline tuple PyDataType_SHAPE(dtype d):
  *     if PyDataType_HASSUBARRAY(d):             # <<<<<<<<<<<<<<
@@ -4112,7 +4110,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyDataType_SHAPE(PyArray_Descr *__
   __pyx_t_1 = PyDataType_HASSUBARRAY(__pyx_v_d);
   if (__pyx_t_1) {
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":790
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":790
  * cdef inline tuple PyDataType_SHAPE(dtype d):
  *     if PyDataType_HASSUBARRAY(d):
  *         return <tuple>d.subarray.shape             # <<<<<<<<<<<<<<
@@ -4124,7 +4122,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyDataType_SHAPE(PyArray_Descr *__
     __pyx_r = ((PyObject*)__pyx_v_d->subarray->shape);
     goto __pyx_L0;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":789
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":789
  * 
  * cdef inline tuple PyDataType_SHAPE(dtype d):
  *     if PyDataType_HASSUBARRAY(d):             # <<<<<<<<<<<<<<
@@ -4133,7 +4131,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyDataType_SHAPE(PyArray_Descr *__
  */
   }
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":792
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":792
  *         return <tuple>d.subarray.shape
  *     else:
  *         return ()             # <<<<<<<<<<<<<<
@@ -4147,7 +4145,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyDataType_SHAPE(PyArray_Descr *__
     goto __pyx_L0;
   }
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":788
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":788
  *     return PyArray_MultiIterNew(5, <void*>a, <void*>b, <void*>c, <void*> d, <void*> e)
  * 
  * cdef inline tuple PyDataType_SHAPE(dtype d):             # <<<<<<<<<<<<<<
@@ -4162,7 +4160,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_PyDataType_SHAPE(PyArray_Descr *__
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":968
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":968
  *     int _import_umath() except -1
  * 
  * cdef inline void set_array_base(ndarray arr, object base):             # <<<<<<<<<<<<<<
@@ -4176,7 +4174,7 @@ static CYTHON_INLINE void __pyx_f_5numpy_set_array_base(PyArrayObject *__pyx_v_a
   const char *__pyx_filename = NULL;
   int __pyx_clineno = 0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":969
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":969
  * 
  * cdef inline void set_array_base(ndarray arr, object base):
  *     Py_INCREF(base) # important to do this before stealing the reference below!             # <<<<<<<<<<<<<<
@@ -4185,7 +4183,7 @@ static CYTHON_INLINE void __pyx_f_5numpy_set_array_base(PyArrayObject *__pyx_v_a
  */
   Py_INCREF(__pyx_v_base);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":970
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":970
  * cdef inline void set_array_base(ndarray arr, object base):
  *     Py_INCREF(base) # important to do this before stealing the reference below!
  *     PyArray_SetBaseObject(arr, base)             # <<<<<<<<<<<<<<
@@ -4194,7 +4192,7 @@ static CYTHON_INLINE void __pyx_f_5numpy_set_array_base(PyArrayObject *__pyx_v_a
  */
   __pyx_t_1 = PyArray_SetBaseObject(__pyx_v_arr, __pyx_v_base); if (unlikely(__pyx_t_1 == ((int)-1))) __PYX_ERR(1, 970, __pyx_L1_error)
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":968
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":968
  *     int _import_umath() except -1
  * 
  * cdef inline void set_array_base(ndarray arr, object base):             # <<<<<<<<<<<<<<
@@ -4209,7 +4207,7 @@ static CYTHON_INLINE void __pyx_f_5numpy_set_array_base(PyArrayObject *__pyx_v_a
   __pyx_L0:;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":972
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":972
  *     PyArray_SetBaseObject(arr, base)
  * 
  * cdef inline object get_array_base(ndarray arr):             # <<<<<<<<<<<<<<
@@ -4224,7 +4222,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_get_array_base(PyArrayObject *__py
   int __pyx_t_1;
   __Pyx_RefNannySetupContext("get_array_base", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":973
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":973
  * 
  * cdef inline object get_array_base(ndarray arr):
  *     base = PyArray_BASE(arr)             # <<<<<<<<<<<<<<
@@ -4233,7 +4231,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_get_array_base(PyArrayObject *__py
  */
   __pyx_v_base = PyArray_BASE(__pyx_v_arr);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":974
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":974
  * cdef inline object get_array_base(ndarray arr):
  *     base = PyArray_BASE(arr)
  *     if base is NULL:             # <<<<<<<<<<<<<<
@@ -4243,7 +4241,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_get_array_base(PyArrayObject *__py
   __pyx_t_1 = (__pyx_v_base == NULL);
   if (__pyx_t_1) {
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":975
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":975
  *     base = PyArray_BASE(arr)
  *     if base is NULL:
  *         return None             # <<<<<<<<<<<<<<
@@ -4254,7 +4252,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_get_array_base(PyArrayObject *__py
     __pyx_r = Py_None; __Pyx_INCREF(Py_None);
     goto __pyx_L0;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":974
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":974
  * cdef inline object get_array_base(ndarray arr):
  *     base = PyArray_BASE(arr)
  *     if base is NULL:             # <<<<<<<<<<<<<<
@@ -4263,7 +4261,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_get_array_base(PyArrayObject *__py
  */
   }
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":976
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":976
  *     if base is NULL:
  *         return None
  *     return <object>base             # <<<<<<<<<<<<<<
@@ -4275,7 +4273,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_get_array_base(PyArrayObject *__py
   __pyx_r = ((PyObject *)__pyx_v_base);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":972
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":972
  *     PyArray_SetBaseObject(arr, base)
  * 
  * cdef inline object get_array_base(ndarray arr):             # <<<<<<<<<<<<<<
@@ -4290,7 +4288,7 @@ static CYTHON_INLINE PyObject *__pyx_f_5numpy_get_array_base(PyArrayObject *__py
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":980
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":980
  * # Versions of the import_* functions which are more suitable for
  * # Cython code.
  * cdef inline int import_array() except -1:             # <<<<<<<<<<<<<<
@@ -4314,7 +4312,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("import_array", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":981
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":981
  * # Cython code.
  * cdef inline int import_array() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4330,7 +4328,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
     __Pyx_XGOTREF(__pyx_t_3);
     /*try:*/ {
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":982
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":982
  * cdef inline int import_array() except -1:
  *     try:
  *         __pyx_import_array()             # <<<<<<<<<<<<<<
@@ -4339,7 +4337,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
  */
       __pyx_t_4 = _import_array(); if (unlikely(__pyx_t_4 == ((int)-1))) __PYX_ERR(1, 982, __pyx_L3_error)
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":981
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":981
  * # Cython code.
  * cdef inline int import_array() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4353,7 +4351,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
     goto __pyx_L8_try_end;
     __pyx_L3_error:;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":983
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":983
  *     try:
  *         __pyx_import_array()
  *     except Exception:             # <<<<<<<<<<<<<<
@@ -4368,7 +4366,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
       __Pyx_XGOTREF(__pyx_t_6);
       __Pyx_XGOTREF(__pyx_t_7);
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":984
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":984
  *         __pyx_import_array()
  *     except Exception:
  *         raise ImportError("numpy.core.multiarray failed to import")             # <<<<<<<<<<<<<<
@@ -4383,7 +4381,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
     }
     goto __pyx_L5_except_error;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":981
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":981
  * # Cython code.
  * cdef inline int import_array() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4399,7 +4397,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
     __pyx_L8_try_end:;
   }
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":980
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":980
  * # Versions of the import_* functions which are more suitable for
  * # Cython code.
  * cdef inline int import_array() except -1:             # <<<<<<<<<<<<<<
@@ -4422,7 +4420,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_array(void) {
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":986
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":986
  *         raise ImportError("numpy.core.multiarray failed to import")
  * 
  * cdef inline int import_umath() except -1:             # <<<<<<<<<<<<<<
@@ -4446,7 +4444,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("import_umath", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":987
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":987
  * 
  * cdef inline int import_umath() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4462,7 +4460,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
     __Pyx_XGOTREF(__pyx_t_3);
     /*try:*/ {
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":988
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":988
  * cdef inline int import_umath() except -1:
  *     try:
  *         _import_umath()             # <<<<<<<<<<<<<<
@@ -4471,7 +4469,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
  */
       __pyx_t_4 = _import_umath(); if (unlikely(__pyx_t_4 == ((int)-1))) __PYX_ERR(1, 988, __pyx_L3_error)
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":987
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":987
  * 
  * cdef inline int import_umath() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4485,7 +4483,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
     goto __pyx_L8_try_end;
     __pyx_L3_error:;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":989
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":989
  *     try:
  *         _import_umath()
  *     except Exception:             # <<<<<<<<<<<<<<
@@ -4500,7 +4498,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
       __Pyx_XGOTREF(__pyx_t_6);
       __Pyx_XGOTREF(__pyx_t_7);
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":990
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":990
  *         _import_umath()
  *     except Exception:
  *         raise ImportError("numpy.core.umath failed to import")             # <<<<<<<<<<<<<<
@@ -4515,7 +4513,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
     }
     goto __pyx_L5_except_error;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":987
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":987
  * 
  * cdef inline int import_umath() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4531,7 +4529,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
     __pyx_L8_try_end:;
   }
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":986
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":986
  *         raise ImportError("numpy.core.multiarray failed to import")
  * 
  * cdef inline int import_umath() except -1:             # <<<<<<<<<<<<<<
@@ -4554,7 +4552,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_umath(void) {
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":992
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":992
  *         raise ImportError("numpy.core.umath failed to import")
  * 
  * cdef inline int import_ufunc() except -1:             # <<<<<<<<<<<<<<
@@ -4578,7 +4576,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("import_ufunc", 1);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":993
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":993
  * 
  * cdef inline int import_ufunc() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4594,7 +4592,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
     __Pyx_XGOTREF(__pyx_t_3);
     /*try:*/ {
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":994
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":994
  * cdef inline int import_ufunc() except -1:
  *     try:
  *         _import_umath()             # <<<<<<<<<<<<<<
@@ -4603,7 +4601,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
  */
       __pyx_t_4 = _import_umath(); if (unlikely(__pyx_t_4 == ((int)-1))) __PYX_ERR(1, 994, __pyx_L3_error)
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":993
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":993
  * 
  * cdef inline int import_ufunc() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4617,7 +4615,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
     goto __pyx_L8_try_end;
     __pyx_L3_error:;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":995
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":995
  *     try:
  *         _import_umath()
  *     except Exception:             # <<<<<<<<<<<<<<
@@ -4632,7 +4630,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
       __Pyx_XGOTREF(__pyx_t_6);
       __Pyx_XGOTREF(__pyx_t_7);
 
-      /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":996
+      /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":996
  *         _import_umath()
  *     except Exception:
  *         raise ImportError("numpy.core.umath failed to import")             # <<<<<<<<<<<<<<
@@ -4647,7 +4645,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
     }
     goto __pyx_L5_except_error;
 
-    /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":993
+    /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":993
  * 
  * cdef inline int import_ufunc() except -1:
  *     try:             # <<<<<<<<<<<<<<
@@ -4663,7 +4661,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
     __pyx_L8_try_end:;
   }
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":992
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":992
  *         raise ImportError("numpy.core.umath failed to import")
  * 
  * cdef inline int import_ufunc() except -1:             # <<<<<<<<<<<<<<
@@ -4686,7 +4684,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":999
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":999
  * 
  * 
  * cdef inline bint is_timedelta64_object(object obj):             # <<<<<<<<<<<<<<
@@ -4697,7 +4695,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_import_ufunc(void) {
 static CYTHON_INLINE int __pyx_f_5numpy_is_timedelta64_object(PyObject *__pyx_v_obj) {
   int __pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1011
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1011
  *     bool
  *     """
  *     return PyObject_TypeCheck(obj, &PyTimedeltaArrType_Type)             # <<<<<<<<<<<<<<
@@ -4707,7 +4705,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_is_timedelta64_object(PyObject *__pyx_v_
   __pyx_r = PyObject_TypeCheck(__pyx_v_obj, (&PyTimedeltaArrType_Type));
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":999
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":999
  * 
  * 
  * cdef inline bint is_timedelta64_object(object obj):             # <<<<<<<<<<<<<<
@@ -4720,7 +4718,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_is_timedelta64_object(PyObject *__pyx_v_
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1014
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1014
  * 
  * 
  * cdef inline bint is_datetime64_object(object obj):             # <<<<<<<<<<<<<<
@@ -4731,7 +4729,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_is_timedelta64_object(PyObject *__pyx_v_
 static CYTHON_INLINE int __pyx_f_5numpy_is_datetime64_object(PyObject *__pyx_v_obj) {
   int __pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1026
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1026
  *     bool
  *     """
  *     return PyObject_TypeCheck(obj, &PyDatetimeArrType_Type)             # <<<<<<<<<<<<<<
@@ -4741,7 +4739,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_is_datetime64_object(PyObject *__pyx_v_o
   __pyx_r = PyObject_TypeCheck(__pyx_v_obj, (&PyDatetimeArrType_Type));
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1014
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1014
  * 
  * 
  * cdef inline bint is_datetime64_object(object obj):             # <<<<<<<<<<<<<<
@@ -4754,7 +4752,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_is_datetime64_object(PyObject *__pyx_v_o
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1029
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1029
  * 
  * 
  * cdef inline npy_datetime get_datetime64_value(object obj) nogil:             # <<<<<<<<<<<<<<
@@ -4765,7 +4763,7 @@ static CYTHON_INLINE int __pyx_f_5numpy_is_datetime64_object(PyObject *__pyx_v_o
 static CYTHON_INLINE npy_datetime __pyx_f_5numpy_get_datetime64_value(PyObject *__pyx_v_obj) {
   npy_datetime __pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1036
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1036
  *     also needed.  That can be found using `get_datetime64_unit`.
  *     """
  *     return (<PyDatetimeScalarObject*>obj).obval             # <<<<<<<<<<<<<<
@@ -4775,7 +4773,7 @@ static CYTHON_INLINE npy_datetime __pyx_f_5numpy_get_datetime64_value(PyObject *
   __pyx_r = ((PyDatetimeScalarObject *)__pyx_v_obj)->obval;
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1029
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1029
  * 
  * 
  * cdef inline npy_datetime get_datetime64_value(object obj) nogil:             # <<<<<<<<<<<<<<
@@ -4788,7 +4786,7 @@ static CYTHON_INLINE npy_datetime __pyx_f_5numpy_get_datetime64_value(PyObject *
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1039
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1039
  * 
  * 
  * cdef inline npy_timedelta get_timedelta64_value(object obj) nogil:             # <<<<<<<<<<<<<<
@@ -4799,7 +4797,7 @@ static CYTHON_INLINE npy_datetime __pyx_f_5numpy_get_datetime64_value(PyObject *
 static CYTHON_INLINE npy_timedelta __pyx_f_5numpy_get_timedelta64_value(PyObject *__pyx_v_obj) {
   npy_timedelta __pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1043
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1043
  *     returns the int64 value underlying scalar numpy timedelta64 object
  *     """
  *     return (<PyTimedeltaScalarObject*>obj).obval             # <<<<<<<<<<<<<<
@@ -4809,7 +4807,7 @@ static CYTHON_INLINE npy_timedelta __pyx_f_5numpy_get_timedelta64_value(PyObject
   __pyx_r = ((PyTimedeltaScalarObject *)__pyx_v_obj)->obval;
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1039
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1039
  * 
  * 
  * cdef inline npy_timedelta get_timedelta64_value(object obj) nogil:             # <<<<<<<<<<<<<<
@@ -4822,7 +4820,7 @@ static CYTHON_INLINE npy_timedelta __pyx_f_5numpy_get_timedelta64_value(PyObject
   return __pyx_r;
 }
 
-/* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1046
+/* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1046
  * 
  * 
  * cdef inline NPY_DATETIMEUNIT get_datetime64_unit(object obj) nogil:             # <<<<<<<<<<<<<<
@@ -4833,7 +4831,7 @@ static CYTHON_INLINE npy_timedelta __pyx_f_5numpy_get_timedelta64_value(PyObject
 static CYTHON_INLINE NPY_DATETIMEUNIT __pyx_f_5numpy_get_datetime64_unit(PyObject *__pyx_v_obj) {
   NPY_DATETIMEUNIT __pyx_r;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1050
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1050
  *     returns the unit part of the dtype for a numpy datetime64 object.
  *     """
  *     return <NPY_DATETIMEUNIT>(<PyDatetimeScalarObject*>obj).obmeta.base             # <<<<<<<<<<<<<<
@@ -4841,7 +4839,7 @@ static CYTHON_INLINE NPY_DATETIMEUNIT __pyx_f_5numpy_get_datetime64_unit(PyObjec
   __pyx_r = ((NPY_DATETIMEUNIT)((PyDatetimeScalarObject *)__pyx_v_obj)->obmeta.base);
   goto __pyx_L0;
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1046
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":1046
  * 
  * 
  * cdef inline NPY_DATETIMEUNIT get_datetime64_unit(object obj) nogil:             # <<<<<<<<<<<<<<
@@ -4854,59 +4852,44 @@ static CYTHON_INLINE NPY_DATETIMEUNIT __pyx_f_5numpy_get_datetime64_unit(PyObjec
   return __pyx_r;
 }
 
-/* "CRISPResso2/CRISPRessoCOREResources.pyx":43
- *     )
+/* "CRISPResso2/CRISPRessoCOREResources.pyx":18
+ * re_find_indels = re.compile("(-*-)")
  * 
- *     def __init__(             # <<<<<<<<<<<<<<
- *         self,
- *         all_insertion_positions,
+ * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
+ * @cython.nonecheck(False)
+ * @cython.wraparound(False)
  */
 
 /* Python wrapper */
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_1__init__(PyObject *__pyx_self, 
+static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions(PyObject *__pyx_self, 
 #if CYTHON_METH_FASTCALL
 PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
 #else
 PyObject *__pyx_args, PyObject *__pyx_kwds
 #endif
 ); /*proto*/
-static PyMethodDef __pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_1__init__ = {"__init__", (PyCFunction)(void*)(__Pyx_PyCFunction_FastCallWithKeywords)__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_1__init__, __Pyx_METH_FASTCALL|METH_KEYWORDS, 0};
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_1__init__(PyObject *__pyx_self, 
+static PyMethodDef __pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions = {"find_indels_substitutions", (PyCFunction)(void*)(__Pyx_PyCFunction_FastCallWithKeywords)__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions, __Pyx_METH_FASTCALL|METH_KEYWORDS, 0};
+static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions(PyObject *__pyx_self, 
 #if CYTHON_METH_FASTCALL
 PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
 #else
 PyObject *__pyx_args, PyObject *__pyx_kwds
 #endif
 ) {
-  PyObject *__pyx_v_self = 0;
-  PyObject *__pyx_v_all_insertion_positions = 0;
-  PyObject *__pyx_v_all_insertion_left_positions = 0;
-  PyObject *__pyx_v_insertion_positions = 0;
-  PyObject *__pyx_v_insertion_coordinates = 0;
-  PyObject *__pyx_v_insertion_sizes = 0;
-  PyObject *__pyx_v_insertion_n = 0;
-  PyObject *__pyx_v_all_deletion_positions = 0;
-  PyObject *__pyx_v_deletion_positions = 0;
-  PyObject *__pyx_v_deletion_coordinates = 0;
-  PyObject *__pyx_v_deletion_sizes = 0;
-  PyObject *__pyx_v_deletion_n = 0;
-  PyObject *__pyx_v_all_substitution_positions = 0;
-  PyObject *__pyx_v_substitution_positions = 0;
-  PyObject *__pyx_v_all_substitution_values = 0;
-  PyObject *__pyx_v_substitution_values = 0;
-  PyObject *__pyx_v_substitution_n = 0;
-  PyObject *__pyx_v_ref_positions = 0;
+  PyObject *__pyx_v_read_seq_al = 0;
+  PyObject *__pyx_v_ref_seq_al = 0;
+  PyObject *__pyx_v__include_indx = 0;
   #if !CYTHON_METH_FASTCALL
   CYTHON_UNUSED Py_ssize_t __pyx_nargs;
   #endif
   CYTHON_UNUSED PyObject *const *__pyx_kwvalues;
-  PyObject* values[18] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0};
+  PyObject* values[3] = {0,0,0};
   int __pyx_lineno = 0;
   const char *__pyx_filename = NULL;
   int __pyx_clineno = 0;
   PyObject *__pyx_r = 0;
   __Pyx_RefNannyDeclarations
-  __Pyx_RefNannySetupContext("__init__ (wrapper)", 0);
+  __Pyx_RefNannySetupContext("find_indels_substitutions (wrapper)", 0);
   #if !CYTHON_METH_FASTCALL
   #if CYTHON_ASSUME_SAFE_MACROS
   __pyx_nargs = PyTuple_GET_SIZE(__pyx_args);
@@ -4916,40 +4899,10 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
   #endif
   __pyx_kwvalues = __Pyx_KwValues_FASTCALL(__pyx_args, __pyx_nargs);
   {
-    PyObject **__pyx_pyargnames[] = {&__pyx_n_s_self,&__pyx_n_s_all_insertion_positions,&__pyx_n_s_all_insertion_left_positions,&__pyx_n_s_insertion_positions,&__pyx_n_s_insertion_coordinates,&__pyx_n_s_insertion_sizes,&__pyx_n_s_insertion_n,&__pyx_n_s_all_deletion_positions,&__pyx_n_s_deletion_positions,&__pyx_n_s_deletion_coordinates,&__pyx_n_s_deletion_sizes,&__pyx_n_s_deletion_n,&__pyx_n_s_all_substitution_positions,&__pyx_n_s_substitution_positions,&__pyx_n_s_all_substitution_values,&__pyx_n_s_substitution_values,&__pyx_n_s_substitution_n,&__pyx_n_s_ref_positions,0};
+    PyObject **__pyx_pyargnames[] = {&__pyx_n_s_read_seq_al,&__pyx_n_s_ref_seq_al,&__pyx_n_s_include_indx,0};
     if (__pyx_kwds) {
       Py_ssize_t kw_args;
       switch (__pyx_nargs) {
-        case 18: values[17] = __Pyx_Arg_FASTCALL(__pyx_args, 17);
-        CYTHON_FALLTHROUGH;
-        case 17: values[16] = __Pyx_Arg_FASTCALL(__pyx_args, 16);
-        CYTHON_FALLTHROUGH;
-        case 16: values[15] = __Pyx_Arg_FASTCALL(__pyx_args, 15);
-        CYTHON_FALLTHROUGH;
-        case 15: values[14] = __Pyx_Arg_FASTCALL(__pyx_args, 14);
-        CYTHON_FALLTHROUGH;
-        case 14: values[13] = __Pyx_Arg_FASTCALL(__pyx_args, 13);
-        CYTHON_FALLTHROUGH;
-        case 13: values[12] = __Pyx_Arg_FASTCALL(__pyx_args, 12);
-        CYTHON_FALLTHROUGH;
-        case 12: values[11] = __Pyx_Arg_FASTCALL(__pyx_args, 11);
-        CYTHON_FALLTHROUGH;
-        case 11: values[10] = __Pyx_Arg_FASTCALL(__pyx_args, 10);
-        CYTHON_FALLTHROUGH;
-        case 10: values[9] = __Pyx_Arg_FASTCALL(__pyx_args, 9);
-        CYTHON_FALLTHROUGH;
-        case  9: values[8] = __Pyx_Arg_FASTCALL(__pyx_args, 8);
-        CYTHON_FALLTHROUGH;
-        case  8: values[7] = __Pyx_Arg_FASTCALL(__pyx_args, 7);
-        CYTHON_FALLTHROUGH;
-        case  7: values[6] = __Pyx_Arg_FASTCALL(__pyx_args, 6);
-        CYTHON_FALLTHROUGH;
-        case  6: values[5] = __Pyx_Arg_FASTCALL(__pyx_args, 5);
-        CYTHON_FALLTHROUGH;
-        case  5: values[4] = __Pyx_Arg_FASTCALL(__pyx_args, 4);
-        CYTHON_FALLTHROUGH;
-        case  4: values[3] = __Pyx_Arg_FASTCALL(__pyx_args, 3);
-        CYTHON_FALLTHROUGH;
         case  3: values[2] = __Pyx_Arg_FASTCALL(__pyx_args, 2);
         CYTHON_FALLTHROUGH;
         case  2: values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
@@ -4962,231 +4915,51 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
       kw_args = __Pyx_NumKwargs_FASTCALL(__pyx_kwds);
       switch (__pyx_nargs) {
         case  0:
-        if (likely((values[0] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_self)) != 0)) {
+        if (likely((values[0] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_read_seq_al)) != 0)) {
           (void)__Pyx_Arg_NewRef_FASTCALL(values[0]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 18, __pyx_L3_error)
         else goto __pyx_L5_argtuple_error;
         CYTHON_FALLTHROUGH;
         case  1:
-        if (likely((values[1] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_all_insertion_positions)) != 0)) {
+        if (likely((values[1] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_ref_seq_al)) != 0)) {
           (void)__Pyx_Arg_NewRef_FASTCALL(values[1]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 18, __pyx_L3_error)
         else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 1); __PYX_ERR(0, 43, __pyx_L3_error)
+          __Pyx_RaiseArgtupleInvalid("find_indels_substitutions", 1, 3, 3, 1); __PYX_ERR(0, 18, __pyx_L3_error)
         }
         CYTHON_FALLTHROUGH;
         case  2:
-        if (likely((values[2] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_all_insertion_left_positions)) != 0)) {
+        if (likely((values[2] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_include_indx)) != 0)) {
           (void)__Pyx_Arg_NewRef_FASTCALL(values[2]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 2); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  3:
-        if (likely((values[3] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_insertion_positions)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[3]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 3); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  4:
-        if (likely((values[4] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_insertion_coordinates)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[4]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 4); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  5:
-        if (likely((values[5] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_insertion_sizes)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[5]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 5); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  6:
-        if (likely((values[6] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_insertion_n)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[6]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 6); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  7:
-        if (likely((values[7] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_all_deletion_positions)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[7]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 7); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  8:
-        if (likely((values[8] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_deletion_positions)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[8]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 8); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  9:
-        if (likely((values[9] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_deletion_coordinates)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[9]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 9); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 10:
-        if (likely((values[10] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_deletion_sizes)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[10]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 10); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 11:
-        if (likely((values[11] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_deletion_n)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[11]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 11); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 12:
-        if (likely((values[12] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_all_substitution_positions)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[12]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 12); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 13:
-        if (likely((values[13] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_substitution_positions)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[13]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 13); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 14:
-        if (likely((values[14] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_all_substitution_values)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[14]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 14); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 15:
-        if (likely((values[15] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_substitution_values)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[15]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 15); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 16:
-        if (likely((values[16] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_substitution_n)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[16]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 18, __pyx_L3_error)
         else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 16); __PYX_ERR(0, 43, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case 17:
-        if (likely((values[17] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_ref_positions)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[17]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 43, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, 17); __PYX_ERR(0, 43, __pyx_L3_error)
+          __Pyx_RaiseArgtupleInvalid("find_indels_substitutions", 1, 3, 3, 2); __PYX_ERR(0, 18, __pyx_L3_error)
         }
       }
       if (unlikely(kw_args > 0)) {
         const Py_ssize_t kwd_pos_args = __pyx_nargs;
-        if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_kwvalues, __pyx_pyargnames, 0, values + 0, kwd_pos_args, "__init__") < 0)) __PYX_ERR(0, 43, __pyx_L3_error)
+        if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_kwvalues, __pyx_pyargnames, 0, values + 0, kwd_pos_args, "find_indels_substitutions") < 0)) __PYX_ERR(0, 18, __pyx_L3_error)
       }
-    } else if (unlikely(__pyx_nargs != 18)) {
+    } else if (unlikely(__pyx_nargs != 3)) {
       goto __pyx_L5_argtuple_error;
     } else {
       values[0] = __Pyx_Arg_FASTCALL(__pyx_args, 0);
       values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
       values[2] = __Pyx_Arg_FASTCALL(__pyx_args, 2);
-      values[3] = __Pyx_Arg_FASTCALL(__pyx_args, 3);
-      values[4] = __Pyx_Arg_FASTCALL(__pyx_args, 4);
-      values[5] = __Pyx_Arg_FASTCALL(__pyx_args, 5);
-      values[6] = __Pyx_Arg_FASTCALL(__pyx_args, 6);
-      values[7] = __Pyx_Arg_FASTCALL(__pyx_args, 7);
-      values[8] = __Pyx_Arg_FASTCALL(__pyx_args, 8);
-      values[9] = __Pyx_Arg_FASTCALL(__pyx_args, 9);
-      values[10] = __Pyx_Arg_FASTCALL(__pyx_args, 10);
-      values[11] = __Pyx_Arg_FASTCALL(__pyx_args, 11);
-      values[12] = __Pyx_Arg_FASTCALL(__pyx_args, 12);
-      values[13] = __Pyx_Arg_FASTCALL(__pyx_args, 13);
-      values[14] = __Pyx_Arg_FASTCALL(__pyx_args, 14);
-      values[15] = __Pyx_Arg_FASTCALL(__pyx_args, 15);
-      values[16] = __Pyx_Arg_FASTCALL(__pyx_args, 16);
-      values[17] = __Pyx_Arg_FASTCALL(__pyx_args, 17);
-    }
-    __pyx_v_self = values[0];
-    __pyx_v_all_insertion_positions = values[1];
-    __pyx_v_all_insertion_left_positions = values[2];
-    __pyx_v_insertion_positions = values[3];
-    __pyx_v_insertion_coordinates = values[4];
-    __pyx_v_insertion_sizes = values[5];
-    __pyx_v_insertion_n = values[6];
-    __pyx_v_all_deletion_positions = values[7];
-    __pyx_v_deletion_positions = values[8];
-    __pyx_v_deletion_coordinates = values[9];
-    __pyx_v_deletion_sizes = values[10];
-    __pyx_v_deletion_n = values[11];
-    __pyx_v_all_substitution_positions = values[12];
-    __pyx_v_substitution_positions = values[13];
-    __pyx_v_all_substitution_values = values[14];
-    __pyx_v_substitution_values = values[15];
-    __pyx_v_substitution_n = values[16];
-    __pyx_v_ref_positions = values[17];
+    }
+    __pyx_v_read_seq_al = values[0];
+    __pyx_v_ref_seq_al = values[1];
+    __pyx_v__include_indx = values[2];
   }
   goto __pyx_L6_skip;
   __pyx_L5_argtuple_error:;
-  __Pyx_RaiseArgtupleInvalid("__init__", 1, 18, 18, __pyx_nargs); __PYX_ERR(0, 43, __pyx_L3_error)
+  __Pyx_RaiseArgtupleInvalid("find_indels_substitutions", 1, 3, 3, __pyx_nargs); __PYX_ERR(0, 18, __pyx_L3_error)
   __pyx_L6_skip:;
   goto __pyx_L4_argument_unpacking_done;
   __pyx_L3_error:;
@@ -5196,11 +4969,11 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
       __Pyx_Arg_XDECREF_FASTCALL(values[__pyx_temp]);
     }
   }
-  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.ResultsSlotsDict.__init__", __pyx_clineno, __pyx_lineno, __pyx_filename);
+  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.find_indels_substitutions", __pyx_clineno, __pyx_lineno, __pyx_filename);
   __Pyx_RefNannyFinishContext();
   return NULL;
   __pyx_L4_argument_unpacking_done:;
-  __pyx_r = __pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict___init__(__pyx_self, __pyx_v_self, __pyx_v_all_insertion_positions, __pyx_v_all_insertion_left_positions, __pyx_v_insertion_positions, __pyx_v_insertion_coordinates, __pyx_v_insertion_sizes, __pyx_v_insertion_n, __pyx_v_all_deletion_positions, __pyx_v_deletion_positions, __pyx_v_deletion_coordinates, __pyx_v_deletion_sizes, __pyx_v_deletion_n, __pyx_v_all_substitution_positions, __pyx_v_substitution_positions, __pyx_v_all_substitution_values, __pyx_v_substitution_values, __pyx_v_substitution_n, __pyx_v_ref_positions);
+  __pyx_r = __pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_substitutions(__pyx_self, __pyx_v_read_seq_al, __pyx_v_ref_seq_al, __pyx_v__include_indx);
 
   /* function exit code */
   {
@@ -5213,850 +4986,161 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
   return __pyx_r;
 }
 
-static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict___init__(CYTHON_UNUSED PyObject *__pyx_self, PyObject *__pyx_v_self, PyObject *__pyx_v_all_insertion_positions, PyObject *__pyx_v_all_insertion_left_positions, PyObject *__pyx_v_insertion_positions, PyObject *__pyx_v_insertion_coordinates, PyObject *__pyx_v_insertion_sizes, PyObject *__pyx_v_insertion_n, PyObject *__pyx_v_all_deletion_positions, PyObject *__pyx_v_deletion_positions, PyObject *__pyx_v_deletion_coordinates, PyObject *__pyx_v_deletion_sizes, PyObject *__pyx_v_deletion_n, PyObject *__pyx_v_all_substitution_positions, PyObject *__pyx_v_substitution_positions, PyObject *__pyx_v_all_substitution_values, PyObject *__pyx_v_substitution_values, PyObject *__pyx_v_substitution_n, PyObject *__pyx_v_ref_positions) {
+static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_substitutions(CYTHON_UNUSED PyObject *__pyx_self, PyObject *__pyx_v_read_seq_al, PyObject *__pyx_v_ref_seq_al, PyObject *__pyx_v__include_indx) {
+  PyObject *__pyx_v_ref_positions = NULL;
+  PyObject *__pyx_v_all_substitution_positions = NULL;
+  PyObject *__pyx_v_substitution_positions = NULL;
+  PyObject *__pyx_v_all_substitution_values = NULL;
+  PyObject *__pyx_v_substitution_values = NULL;
+  PyObject *__pyx_v_all_deletion_positions = NULL;
+  PyObject *__pyx_v_all_deletion_coordinates = NULL;
+  PyObject *__pyx_v_deletion_positions = NULL;
+  PyObject *__pyx_v_deletion_coordinates = NULL;
+  PyObject *__pyx_v_deletion_sizes = NULL;
+  int __pyx_v_start_deletion;
+  PyObject *__pyx_v_all_insertion_positions = NULL;
+  PyObject *__pyx_v_all_insertion_left_positions = NULL;
+  PyObject *__pyx_v_insertion_positions = NULL;
+  PyObject *__pyx_v_insertion_coordinates = NULL;
+  PyObject *__pyx_v_insertion_sizes = NULL;
+  int __pyx_v_start_insertion;
+  size_t __pyx_v_seq_len;
+  PyObject *__pyx_v_include_indx_set = NULL;
+  CYTHON_UNUSED PyObject *__pyx_v_nucSet = NULL;
+  int __pyx_v_idx;
+  int __pyx_v_idx_c;
+  int __pyx_v_current_insertion_size;
+  PyObject *__pyx_v_c = NULL;
+  PyObject *__pyx_v_end_deletion = NULL;
+  size_t __pyx_v_substitution_n;
+  size_t __pyx_v_deletion_n;
+  size_t __pyx_v_insertion_n;
   PyObject *__pyx_r = NULL;
   __Pyx_RefNannyDeclarations
+  PyObject *__pyx_t_1 = NULL;
+  Py_ssize_t __pyx_t_2;
+  int __pyx_t_3;
+  PyObject *(*__pyx_t_4)(PyObject *);
+  PyObject *__pyx_t_5 = NULL;
+  int __pyx_t_6;
+  int __pyx_t_7;
+  PyObject *__pyx_t_8 = NULL;
+  PyObject *__pyx_t_9 = NULL;
+  int __pyx_t_10;
+  int __pyx_t_11;
+  size_t __pyx_t_12;
   int __pyx_lineno = 0;
   const char *__pyx_filename = NULL;
   int __pyx_clineno = 0;
-  __Pyx_RefNannySetupContext("__init__", 1);
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":63
- *         ref_positions
- *         ):
- *         self.all_insertion_positions = all_insertion_positions             # <<<<<<<<<<<<<<
- *         self.all_insertion_left_positions = all_insertion_left_positions
- *         self.insertion_positions = insertion_positions
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_all_insertion_positions, __pyx_v_all_insertion_positions) < 0) __PYX_ERR(0, 63, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":64
- *         ):
- *         self.all_insertion_positions = all_insertion_positions
- *         self.all_insertion_left_positions = all_insertion_left_positions             # <<<<<<<<<<<<<<
- *         self.insertion_positions = insertion_positions
- *         self.insertion_coordinates = insertion_coordinates
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_all_insertion_left_positions, __pyx_v_all_insertion_left_positions) < 0) __PYX_ERR(0, 64, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":65
- *         self.all_insertion_positions = all_insertion_positions
- *         self.all_insertion_left_positions = all_insertion_left_positions
- *         self.insertion_positions = insertion_positions             # <<<<<<<<<<<<<<
- *         self.insertion_coordinates = insertion_coordinates
- *         self.insertion_sizes = insertion_sizes
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_insertion_positions, __pyx_v_insertion_positions) < 0) __PYX_ERR(0, 65, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":66
- *         self.all_insertion_left_positions = all_insertion_left_positions
- *         self.insertion_positions = insertion_positions
- *         self.insertion_coordinates = insertion_coordinates             # <<<<<<<<<<<<<<
- *         self.insertion_sizes = insertion_sizes
- *         self.insertion_n = insertion_n
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_insertion_coordinates, __pyx_v_insertion_coordinates) < 0) __PYX_ERR(0, 66, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":67
- *         self.insertion_positions = insertion_positions
- *         self.insertion_coordinates = insertion_coordinates
- *         self.insertion_sizes = insertion_sizes             # <<<<<<<<<<<<<<
- *         self.insertion_n = insertion_n
- *         self.all_deletion_positions = all_deletion_positions
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_insertion_sizes, __pyx_v_insertion_sizes) < 0) __PYX_ERR(0, 67, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":68
- *         self.insertion_coordinates = insertion_coordinates
- *         self.insertion_sizes = insertion_sizes
- *         self.insertion_n = insertion_n             # <<<<<<<<<<<<<<
- *         self.all_deletion_positions = all_deletion_positions
- *         self.deletion_positions = deletion_positions
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_insertion_n, __pyx_v_insertion_n) < 0) __PYX_ERR(0, 68, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":69
- *         self.insertion_sizes = insertion_sizes
- *         self.insertion_n = insertion_n
- *         self.all_deletion_positions = all_deletion_positions             # <<<<<<<<<<<<<<
- *         self.deletion_positions = deletion_positions
- *         self.deletion_coordinates = deletion_coordinates
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_all_deletion_positions, __pyx_v_all_deletion_positions) < 0) __PYX_ERR(0, 69, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":70
- *         self.insertion_n = insertion_n
- *         self.all_deletion_positions = all_deletion_positions
- *         self.deletion_positions = deletion_positions             # <<<<<<<<<<<<<<
- *         self.deletion_coordinates = deletion_coordinates
- *         self.deletion_sizes = deletion_sizes
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_deletion_positions, __pyx_v_deletion_positions) < 0) __PYX_ERR(0, 70, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":71
- *         self.all_deletion_positions = all_deletion_positions
- *         self.deletion_positions = deletion_positions
- *         self.deletion_coordinates = deletion_coordinates             # <<<<<<<<<<<<<<
- *         self.deletion_sizes = deletion_sizes
- *         self.deletion_n = deletion_n
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_deletion_coordinates, __pyx_v_deletion_coordinates) < 0) __PYX_ERR(0, 71, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":72
- *         self.deletion_positions = deletion_positions
- *         self.deletion_coordinates = deletion_coordinates
- *         self.deletion_sizes = deletion_sizes             # <<<<<<<<<<<<<<
- *         self.deletion_n = deletion_n
- *         self.all_substitution_positions = all_substitution_positions
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_deletion_sizes, __pyx_v_deletion_sizes) < 0) __PYX_ERR(0, 72, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":73
- *         self.deletion_coordinates = deletion_coordinates
- *         self.deletion_sizes = deletion_sizes
- *         self.deletion_n = deletion_n             # <<<<<<<<<<<<<<
- *         self.all_substitution_positions = all_substitution_positions
- *         self.substitution_positions = substitution_positions
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_deletion_n, __pyx_v_deletion_n) < 0) __PYX_ERR(0, 73, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":74
- *         self.deletion_sizes = deletion_sizes
- *         self.deletion_n = deletion_n
- *         self.all_substitution_positions = all_substitution_positions             # <<<<<<<<<<<<<<
- *         self.substitution_positions = substitution_positions
- *         self.all_substitution_values = all_substitution_values
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_all_substitution_positions, __pyx_v_all_substitution_positions) < 0) __PYX_ERR(0, 74, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":75
- *         self.deletion_n = deletion_n
- *         self.all_substitution_positions = all_substitution_positions
- *         self.substitution_positions = substitution_positions             # <<<<<<<<<<<<<<
- *         self.all_substitution_values = all_substitution_values
- *         self.substitution_values = substitution_values
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_substitution_positions, __pyx_v_substitution_positions) < 0) __PYX_ERR(0, 75, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":76
- *         self.all_substitution_positions = all_substitution_positions
- *         self.substitution_positions = substitution_positions
- *         self.all_substitution_values = all_substitution_values             # <<<<<<<<<<<<<<
- *         self.substitution_values = substitution_values
- *         self.substitution_n = substitution_n
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_all_substitution_values, __pyx_v_all_substitution_values) < 0) __PYX_ERR(0, 76, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":77
- *         self.substitution_positions = substitution_positions
- *         self.all_substitution_values = all_substitution_values
- *         self.substitution_values = substitution_values             # <<<<<<<<<<<<<<
- *         self.substitution_n = substitution_n
- *         self.ref_positions = ref_positions
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_substitution_values, __pyx_v_substitution_values) < 0) __PYX_ERR(0, 77, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":78
- *         self.all_substitution_values = all_substitution_values
- *         self.substitution_values = substitution_values
- *         self.substitution_n = substitution_n             # <<<<<<<<<<<<<<
- *         self.ref_positions = ref_positions
- *         self.ref_name = None
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_substitution_n, __pyx_v_substitution_n) < 0) __PYX_ERR(0, 78, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":79
- *         self.substitution_values = substitution_values
- *         self.substitution_n = substitution_n
- *         self.ref_positions = ref_positions             # <<<<<<<<<<<<<<
- *         self.ref_name = None
- *         self.aln_scores = None
- */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_ref_positions, __pyx_v_ref_positions) < 0) __PYX_ERR(0, 79, __pyx_L1_error)
+  __Pyx_RefNannySetupContext("find_indels_substitutions", 1);
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":80
- *         self.substitution_n = substitution_n
- *         self.ref_positions = ref_positions
- *         self.ref_name = None             # <<<<<<<<<<<<<<
- *         self.aln_scores = None
- *         self.classification = None
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":32
+ *     # aln A - T T T G G C C
+ *     #     1 2 3 4-4 5 6 7 8 <ref positions. Note that the negative values/indices represent places that don't map back to the original reference
+ *     ref_positions=[]             # <<<<<<<<<<<<<<
+ *     all_substitution_positions=[]
+ *     substitution_positions=[]
  */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_ref_name, Py_None) < 0) __PYX_ERR(0, 80, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 32, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_ref_positions = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":81
- *         self.ref_positions = ref_positions
- *         self.ref_name = None
- *         self.aln_scores = None             # <<<<<<<<<<<<<<
- *         self.classification = None
- *         self.aln_seq = None
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":33
+ *     #     1 2 3 4-4 5 6 7 8 <ref positions. Note that the negative values/indices represent places that don't map back to the original reference
+ *     ref_positions=[]
+ *     all_substitution_positions=[]             # <<<<<<<<<<<<<<
+ *     substitution_positions=[]
+ *     all_substitution_values=[]
  */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_aln_scores, Py_None) < 0) __PYX_ERR(0, 81, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 33, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_all_substitution_positions = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":82
- *         self.ref_name = None
- *         self.aln_scores = None
- *         self.classification = None             # <<<<<<<<<<<<<<
- *         self.aln_seq = None
- *         self.aln_ref = None
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":34
+ *     ref_positions=[]
+ *     all_substitution_positions=[]
+ *     substitution_positions=[]             # <<<<<<<<<<<<<<
+ *     all_substitution_values=[]
+ *     substitution_values=[]
  */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_classification, Py_None) < 0) __PYX_ERR(0, 82, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 34, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_substitution_positions = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":83
- *         self.aln_scores = None
- *         self.classification = None
- *         self.aln_seq = None             # <<<<<<<<<<<<<<
- *         self.aln_ref = None
- *         self.aln_strand = None
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":35
+ *     all_substitution_positions=[]
+ *     substitution_positions=[]
+ *     all_substitution_values=[]             # <<<<<<<<<<<<<<
+ *     substitution_values=[]
+ * 
  */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_aln_seq, Py_None) < 0) __PYX_ERR(0, 83, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 35, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_all_substitution_values = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":84
- *         self.classification = None
- *         self.aln_seq = None
- *         self.aln_ref = None             # <<<<<<<<<<<<<<
- *         self.aln_strand = None
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":36
+ *     substitution_positions=[]
+ *     all_substitution_values=[]
+ *     substitution_values=[]             # <<<<<<<<<<<<<<
  * 
+ *     all_deletion_positions = []
  */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_aln_ref, Py_None) < 0) __PYX_ERR(0, 84, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 36, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_substitution_values = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":85
- *         self.aln_seq = None
- *         self.aln_ref = None
- *         self.aln_strand = None             # <<<<<<<<<<<<<<
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":38
+ *     substitution_values=[]
  * 
- *     def __getitem__(self, key):
+ *     all_deletion_positions = []             # <<<<<<<<<<<<<<
+ *     all_deletion_coordinates = []
+ *     deletion_positions = []
  */
-  if (__Pyx_PyObject_SetAttrStr(__pyx_v_self, __pyx_n_s_aln_strand, Py_None) < 0) __PYX_ERR(0, 85, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 38, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_all_deletion_positions = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":43
- *     )
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":39
  * 
- *     def __init__(             # <<<<<<<<<<<<<<
- *         self,
- *         all_insertion_positions,
+ *     all_deletion_positions = []
+ *     all_deletion_coordinates = []             # <<<<<<<<<<<<<<
+ *     deletion_positions = []
+ *     deletion_coordinates = []
  */
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 116, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_all_deletion_coordinates = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-  /* function exit code */
-  __pyx_r = Py_None; __Pyx_INCREF(Py_None);
-  goto __pyx_L0;
-  __pyx_L1_error:;
-  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.ResultsSlotsDict.__init__", __pyx_clineno, __pyx_lineno, __pyx_filename);
-  __pyx_r = NULL;
-  __pyx_L0:;
-  __Pyx_XGIVEREF(__pyx_r);
-  __Pyx_RefNannyFinishContext();
-  return __pyx_r;
-}
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":40
+ *     all_deletion_positions = []
+ *     all_deletion_coordinates = []
+ *     deletion_positions = []             # <<<<<<<<<<<<<<
+ *     deletion_coordinates = []
+ *     deletion_sizes = []
+ */
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 117, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_deletion_positions = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
-/* "CRISPResso2/CRISPRessoCOREResources.pyx":87
- *         self.aln_strand = None
- * 
- *     def __getitem__(self, key):             # <<<<<<<<<<<<<<
- *         return getattr(self, key)
- * 
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":41
+ *     all_deletion_coordinates = []
+ *     deletion_positions = []
+ *     deletion_coordinates = []             # <<<<<<<<<<<<<<
+ *     deletion_sizes = []
+ *     cdef int start_deletion = -1  # the -1 value indicates that there currently isn't a deletion
  */
-
-/* Python wrapper */
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_3__getitem__(PyObject *__pyx_self, 
-#if CYTHON_METH_FASTCALL
-PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
-#else
-PyObject *__pyx_args, PyObject *__pyx_kwds
-#endif
-); /*proto*/
-static PyMethodDef __pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_3__getitem__ = {"__getitem__", (PyCFunction)(void*)(__Pyx_PyCFunction_FastCallWithKeywords)__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_3__getitem__, __Pyx_METH_FASTCALL|METH_KEYWORDS, 0};
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_3__getitem__(PyObject *__pyx_self, 
-#if CYTHON_METH_FASTCALL
-PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
-#else
-PyObject *__pyx_args, PyObject *__pyx_kwds
-#endif
-) {
-  PyObject *__pyx_v_self = 0;
-  PyObject *__pyx_v_key = 0;
-  #if !CYTHON_METH_FASTCALL
-  CYTHON_UNUSED Py_ssize_t __pyx_nargs;
-  #endif
-  CYTHON_UNUSED PyObject *const *__pyx_kwvalues;
-  PyObject* values[2] = {0,0};
-  int __pyx_lineno = 0;
-  const char *__pyx_filename = NULL;
-  int __pyx_clineno = 0;
-  PyObject *__pyx_r = 0;
-  __Pyx_RefNannyDeclarations
-  __Pyx_RefNannySetupContext("__getitem__ (wrapper)", 0);
-  #if !CYTHON_METH_FASTCALL
-  #if CYTHON_ASSUME_SAFE_MACROS
-  __pyx_nargs = PyTuple_GET_SIZE(__pyx_args);
-  #else
-  __pyx_nargs = PyTuple_Size(__pyx_args); if (unlikely(__pyx_nargs < 0)) return NULL;
-  #endif
-  #endif
-  __pyx_kwvalues = __Pyx_KwValues_FASTCALL(__pyx_args, __pyx_nargs);
-  {
-    PyObject **__pyx_pyargnames[] = {&__pyx_n_s_self,&__pyx_n_s_key,0};
-    if (__pyx_kwds) {
-      Py_ssize_t kw_args;
-      switch (__pyx_nargs) {
-        case  2: values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
-        CYTHON_FALLTHROUGH;
-        case  1: values[0] = __Pyx_Arg_FASTCALL(__pyx_args, 0);
-        CYTHON_FALLTHROUGH;
-        case  0: break;
-        default: goto __pyx_L5_argtuple_error;
-      }
-      kw_args = __Pyx_NumKwargs_FASTCALL(__pyx_kwds);
-      switch (__pyx_nargs) {
-        case  0:
-        if (likely((values[0] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_self)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[0]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 87, __pyx_L3_error)
-        else goto __pyx_L5_argtuple_error;
-        CYTHON_FALLTHROUGH;
-        case  1:
-        if (likely((values[1] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_key)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[1]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 87, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__getitem__", 1, 2, 2, 1); __PYX_ERR(0, 87, __pyx_L3_error)
-        }
-      }
-      if (unlikely(kw_args > 0)) {
-        const Py_ssize_t kwd_pos_args = __pyx_nargs;
-        if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_kwvalues, __pyx_pyargnames, 0, values + 0, kwd_pos_args, "__getitem__") < 0)) __PYX_ERR(0, 87, __pyx_L3_error)
-      }
-    } else if (unlikely(__pyx_nargs != 2)) {
-      goto __pyx_L5_argtuple_error;
-    } else {
-      values[0] = __Pyx_Arg_FASTCALL(__pyx_args, 0);
-      values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
-    }
-    __pyx_v_self = values[0];
-    __pyx_v_key = values[1];
-  }
-  goto __pyx_L6_skip;
-  __pyx_L5_argtuple_error:;
-  __Pyx_RaiseArgtupleInvalid("__getitem__", 1, 2, 2, __pyx_nargs); __PYX_ERR(0, 87, __pyx_L3_error)
-  __pyx_L6_skip:;
-  goto __pyx_L4_argument_unpacking_done;
-  __pyx_L3_error:;
-  {
-    Py_ssize_t __pyx_temp;
-    for (__pyx_temp=0; __pyx_temp < (Py_ssize_t)(sizeof(values)/sizeof(values[0])); ++__pyx_temp) {
-      __Pyx_Arg_XDECREF_FASTCALL(values[__pyx_temp]);
-    }
-  }
-  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.ResultsSlotsDict.__getitem__", __pyx_clineno, __pyx_lineno, __pyx_filename);
-  __Pyx_RefNannyFinishContext();
-  return NULL;
-  __pyx_L4_argument_unpacking_done:;
-  __pyx_r = __pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_2__getitem__(__pyx_self, __pyx_v_self, __pyx_v_key);
-
-  /* function exit code */
-  {
-    Py_ssize_t __pyx_temp;
-    for (__pyx_temp=0; __pyx_temp < (Py_ssize_t)(sizeof(values)/sizeof(values[0])); ++__pyx_temp) {
-      __Pyx_Arg_XDECREF_FASTCALL(values[__pyx_temp]);
-    }
-  }
-  __Pyx_RefNannyFinishContext();
-  return __pyx_r;
-}
-
-static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_2__getitem__(CYTHON_UNUSED PyObject *__pyx_self, PyObject *__pyx_v_self, PyObject *__pyx_v_key) {
-  PyObject *__pyx_r = NULL;
-  __Pyx_RefNannyDeclarations
-  PyObject *__pyx_t_1 = NULL;
-  int __pyx_lineno = 0;
-  const char *__pyx_filename = NULL;
-  int __pyx_clineno = 0;
-  __Pyx_RefNannySetupContext("__getitem__", 1);
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":88
- * 
- *     def __getitem__(self, key):
- *         return getattr(self, key)             # <<<<<<<<<<<<<<
- * 
- *     def __setitem__(self, key, value):
- */
-  __Pyx_XDECREF(__pyx_r);
-  __pyx_t_1 = __Pyx_GetAttr(__pyx_v_self, __pyx_v_key); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 88, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_r = __pyx_t_1;
-  __pyx_t_1 = 0;
-  goto __pyx_L0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":87
- *         self.aln_strand = None
- * 
- *     def __getitem__(self, key):             # <<<<<<<<<<<<<<
- *         return getattr(self, key)
- * 
- */
-
-  /* function exit code */
-  __pyx_L1_error:;
-  __Pyx_XDECREF(__pyx_t_1);
-  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.ResultsSlotsDict.__getitem__", __pyx_clineno, __pyx_lineno, __pyx_filename);
-  __pyx_r = NULL;
-  __pyx_L0:;
-  __Pyx_XGIVEREF(__pyx_r);
-  __Pyx_RefNannyFinishContext();
-  return __pyx_r;
-}
-
-/* "CRISPResso2/CRISPRessoCOREResources.pyx":90
- *         return getattr(self, key)
- * 
- *     def __setitem__(self, key, value):             # <<<<<<<<<<<<<<
- *         setattr(self, key, value)
- * 
- */
-
-/* Python wrapper */
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_5__setitem__(PyObject *__pyx_self, 
-#if CYTHON_METH_FASTCALL
-PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
-#else
-PyObject *__pyx_args, PyObject *__pyx_kwds
-#endif
-); /*proto*/
-static PyMethodDef __pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_5__setitem__ = {"__setitem__", (PyCFunction)(void*)(__Pyx_PyCFunction_FastCallWithKeywords)__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_5__setitem__, __Pyx_METH_FASTCALL|METH_KEYWORDS, 0};
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_5__setitem__(PyObject *__pyx_self, 
-#if CYTHON_METH_FASTCALL
-PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
-#else
-PyObject *__pyx_args, PyObject *__pyx_kwds
-#endif
-) {
-  PyObject *__pyx_v_self = 0;
-  PyObject *__pyx_v_key = 0;
-  PyObject *__pyx_v_value = 0;
-  #if !CYTHON_METH_FASTCALL
-  CYTHON_UNUSED Py_ssize_t __pyx_nargs;
-  #endif
-  CYTHON_UNUSED PyObject *const *__pyx_kwvalues;
-  PyObject* values[3] = {0,0,0};
-  int __pyx_lineno = 0;
-  const char *__pyx_filename = NULL;
-  int __pyx_clineno = 0;
-  PyObject *__pyx_r = 0;
-  __Pyx_RefNannyDeclarations
-  __Pyx_RefNannySetupContext("__setitem__ (wrapper)", 0);
-  #if !CYTHON_METH_FASTCALL
-  #if CYTHON_ASSUME_SAFE_MACROS
-  __pyx_nargs = PyTuple_GET_SIZE(__pyx_args);
-  #else
-  __pyx_nargs = PyTuple_Size(__pyx_args); if (unlikely(__pyx_nargs < 0)) return NULL;
-  #endif
-  #endif
-  __pyx_kwvalues = __Pyx_KwValues_FASTCALL(__pyx_args, __pyx_nargs);
-  {
-    PyObject **__pyx_pyargnames[] = {&__pyx_n_s_self,&__pyx_n_s_key,&__pyx_n_s_value,0};
-    if (__pyx_kwds) {
-      Py_ssize_t kw_args;
-      switch (__pyx_nargs) {
-        case  3: values[2] = __Pyx_Arg_FASTCALL(__pyx_args, 2);
-        CYTHON_FALLTHROUGH;
-        case  2: values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
-        CYTHON_FALLTHROUGH;
-        case  1: values[0] = __Pyx_Arg_FASTCALL(__pyx_args, 0);
-        CYTHON_FALLTHROUGH;
-        case  0: break;
-        default: goto __pyx_L5_argtuple_error;
-      }
-      kw_args = __Pyx_NumKwargs_FASTCALL(__pyx_kwds);
-      switch (__pyx_nargs) {
-        case  0:
-        if (likely((values[0] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_self)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[0]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 90, __pyx_L3_error)
-        else goto __pyx_L5_argtuple_error;
-        CYTHON_FALLTHROUGH;
-        case  1:
-        if (likely((values[1] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_key)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[1]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 90, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__setitem__", 1, 3, 3, 1); __PYX_ERR(0, 90, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  2:
-        if (likely((values[2] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_value)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[2]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 90, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("__setitem__", 1, 3, 3, 2); __PYX_ERR(0, 90, __pyx_L3_error)
-        }
-      }
-      if (unlikely(kw_args > 0)) {
-        const Py_ssize_t kwd_pos_args = __pyx_nargs;
-        if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_kwvalues, __pyx_pyargnames, 0, values + 0, kwd_pos_args, "__setitem__") < 0)) __PYX_ERR(0, 90, __pyx_L3_error)
-      }
-    } else if (unlikely(__pyx_nargs != 3)) {
-      goto __pyx_L5_argtuple_error;
-    } else {
-      values[0] = __Pyx_Arg_FASTCALL(__pyx_args, 0);
-      values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
-      values[2] = __Pyx_Arg_FASTCALL(__pyx_args, 2);
-    }
-    __pyx_v_self = values[0];
-    __pyx_v_key = values[1];
-    __pyx_v_value = values[2];
-  }
-  goto __pyx_L6_skip;
-  __pyx_L5_argtuple_error:;
-  __Pyx_RaiseArgtupleInvalid("__setitem__", 1, 3, 3, __pyx_nargs); __PYX_ERR(0, 90, __pyx_L3_error)
-  __pyx_L6_skip:;
-  goto __pyx_L4_argument_unpacking_done;
-  __pyx_L3_error:;
-  {
-    Py_ssize_t __pyx_temp;
-    for (__pyx_temp=0; __pyx_temp < (Py_ssize_t)(sizeof(values)/sizeof(values[0])); ++__pyx_temp) {
-      __Pyx_Arg_XDECREF_FASTCALL(values[__pyx_temp]);
-    }
-  }
-  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.ResultsSlotsDict.__setitem__", __pyx_clineno, __pyx_lineno, __pyx_filename);
-  __Pyx_RefNannyFinishContext();
-  return NULL;
-  __pyx_L4_argument_unpacking_done:;
-  __pyx_r = __pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_4__setitem__(__pyx_self, __pyx_v_self, __pyx_v_key, __pyx_v_value);
-
-  /* function exit code */
-  {
-    Py_ssize_t __pyx_temp;
-    for (__pyx_temp=0; __pyx_temp < (Py_ssize_t)(sizeof(values)/sizeof(values[0])); ++__pyx_temp) {
-      __Pyx_Arg_XDECREF_FASTCALL(values[__pyx_temp]);
-    }
-  }
-  __Pyx_RefNannyFinishContext();
-  return __pyx_r;
-}
-
-static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_4__setitem__(CYTHON_UNUSED PyObject *__pyx_self, PyObject *__pyx_v_self, PyObject *__pyx_v_key, PyObject *__pyx_v_value) {
-  PyObject *__pyx_r = NULL;
-  __Pyx_RefNannyDeclarations
-  int __pyx_t_1;
-  int __pyx_lineno = 0;
-  const char *__pyx_filename = NULL;
-  int __pyx_clineno = 0;
-  __Pyx_RefNannySetupContext("__setitem__", 1);
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":91
- * 
- *     def __setitem__(self, key, value):
- *         setattr(self, key, value)             # <<<<<<<<<<<<<<
- * 
- * 
- */
-  __pyx_t_1 = PyObject_SetAttr(__pyx_v_self, __pyx_v_key, __pyx_v_value); if (unlikely(__pyx_t_1 == ((int)-1))) __PYX_ERR(0, 91, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":90
- *         return getattr(self, key)
- * 
- *     def __setitem__(self, key, value):             # <<<<<<<<<<<<<<
- *         setattr(self, key, value)
- * 
- */
-
-  /* function exit code */
-  __pyx_r = Py_None; __Pyx_INCREF(Py_None);
-  goto __pyx_L0;
-  __pyx_L1_error:;
-  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.ResultsSlotsDict.__setitem__", __pyx_clineno, __pyx_lineno, __pyx_filename);
-  __pyx_r = NULL;
-  __pyx_L0:;
-  __Pyx_XGIVEREF(__pyx_r);
-  __Pyx_RefNannyFinishContext();
-  return __pyx_r;
-}
-
-/* "CRISPResso2/CRISPRessoCOREResources.pyx":96
- * re_find_indels = re.compile("(-*-)")
- * 
- * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
- * @cython.nonecheck(False)
- * @cython.wraparound(False)
- */
-
-/* Python wrapper */
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions(PyObject *__pyx_self, 
-#if CYTHON_METH_FASTCALL
-PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
-#else
-PyObject *__pyx_args, PyObject *__pyx_kwds
-#endif
-); /*proto*/
-static PyMethodDef __pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions = {"find_indels_substitutions", (PyCFunction)(void*)(__Pyx_PyCFunction_FastCallWithKeywords)__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions, __Pyx_METH_FASTCALL|METH_KEYWORDS, 0};
-static PyObject *__pyx_pw_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions(PyObject *__pyx_self, 
-#if CYTHON_METH_FASTCALL
-PyObject *const *__pyx_args, Py_ssize_t __pyx_nargs, PyObject *__pyx_kwds
-#else
-PyObject *__pyx_args, PyObject *__pyx_kwds
-#endif
-) {
-  PyObject *__pyx_v_read_seq_al = 0;
-  PyObject *__pyx_v_ref_seq_al = 0;
-  PyObject *__pyx_v__include_indx = 0;
-  #if !CYTHON_METH_FASTCALL
-  CYTHON_UNUSED Py_ssize_t __pyx_nargs;
-  #endif
-  CYTHON_UNUSED PyObject *const *__pyx_kwvalues;
-  PyObject* values[3] = {0,0,0};
-  int __pyx_lineno = 0;
-  const char *__pyx_filename = NULL;
-  int __pyx_clineno = 0;
-  PyObject *__pyx_r = 0;
-  __Pyx_RefNannyDeclarations
-  __Pyx_RefNannySetupContext("find_indels_substitutions (wrapper)", 0);
-  #if !CYTHON_METH_FASTCALL
-  #if CYTHON_ASSUME_SAFE_MACROS
-  __pyx_nargs = PyTuple_GET_SIZE(__pyx_args);
-  #else
-  __pyx_nargs = PyTuple_Size(__pyx_args); if (unlikely(__pyx_nargs < 0)) return NULL;
-  #endif
-  #endif
-  __pyx_kwvalues = __Pyx_KwValues_FASTCALL(__pyx_args, __pyx_nargs);
-  {
-    PyObject **__pyx_pyargnames[] = {&__pyx_n_s_read_seq_al,&__pyx_n_s_ref_seq_al,&__pyx_n_s_include_indx,0};
-    if (__pyx_kwds) {
-      Py_ssize_t kw_args;
-      switch (__pyx_nargs) {
-        case  3: values[2] = __Pyx_Arg_FASTCALL(__pyx_args, 2);
-        CYTHON_FALLTHROUGH;
-        case  2: values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
-        CYTHON_FALLTHROUGH;
-        case  1: values[0] = __Pyx_Arg_FASTCALL(__pyx_args, 0);
-        CYTHON_FALLTHROUGH;
-        case  0: break;
-        default: goto __pyx_L5_argtuple_error;
-      }
-      kw_args = __Pyx_NumKwargs_FASTCALL(__pyx_kwds);
-      switch (__pyx_nargs) {
-        case  0:
-        if (likely((values[0] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_read_seq_al)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[0]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 96, __pyx_L3_error)
-        else goto __pyx_L5_argtuple_error;
-        CYTHON_FALLTHROUGH;
-        case  1:
-        if (likely((values[1] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_ref_seq_al)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[1]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 96, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("find_indels_substitutions", 1, 3, 3, 1); __PYX_ERR(0, 96, __pyx_L3_error)
-        }
-        CYTHON_FALLTHROUGH;
-        case  2:
-        if (likely((values[2] = __Pyx_GetKwValue_FASTCALL(__pyx_kwds, __pyx_kwvalues, __pyx_n_s_include_indx)) != 0)) {
-          (void)__Pyx_Arg_NewRef_FASTCALL(values[2]);
-          kw_args--;
-        }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 96, __pyx_L3_error)
-        else {
-          __Pyx_RaiseArgtupleInvalid("find_indels_substitutions", 1, 3, 3, 2); __PYX_ERR(0, 96, __pyx_L3_error)
-        }
-      }
-      if (unlikely(kw_args > 0)) {
-        const Py_ssize_t kwd_pos_args = __pyx_nargs;
-        if (unlikely(__Pyx_ParseOptionalKeywords(__pyx_kwds, __pyx_kwvalues, __pyx_pyargnames, 0, values + 0, kwd_pos_args, "find_indels_substitutions") < 0)) __PYX_ERR(0, 96, __pyx_L3_error)
-      }
-    } else if (unlikely(__pyx_nargs != 3)) {
-      goto __pyx_L5_argtuple_error;
-    } else {
-      values[0] = __Pyx_Arg_FASTCALL(__pyx_args, 0);
-      values[1] = __Pyx_Arg_FASTCALL(__pyx_args, 1);
-      values[2] = __Pyx_Arg_FASTCALL(__pyx_args, 2);
-    }
-    __pyx_v_read_seq_al = values[0];
-    __pyx_v_ref_seq_al = values[1];
-    __pyx_v__include_indx = values[2];
-  }
-  goto __pyx_L6_skip;
-  __pyx_L5_argtuple_error:;
-  __Pyx_RaiseArgtupleInvalid("find_indels_substitutions", 1, 3, 3, __pyx_nargs); __PYX_ERR(0, 96, __pyx_L3_error)
-  __pyx_L6_skip:;
-  goto __pyx_L4_argument_unpacking_done;
-  __pyx_L3_error:;
-  {
-    Py_ssize_t __pyx_temp;
-    for (__pyx_temp=0; __pyx_temp < (Py_ssize_t)(sizeof(values)/sizeof(values[0])); ++__pyx_temp) {
-      __Pyx_Arg_XDECREF_FASTCALL(values[__pyx_temp]);
-    }
-  }
-  __Pyx_AddTraceback("CRISPResso2.CRISPRessoCOREResources.find_indels_substitutions", __pyx_clineno, __pyx_lineno, __pyx_filename);
-  __Pyx_RefNannyFinishContext();
-  return NULL;
-  __pyx_L4_argument_unpacking_done:;
-  __pyx_r = __pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_substitutions(__pyx_self, __pyx_v_read_seq_al, __pyx_v_ref_seq_al, __pyx_v__include_indx);
-
-  /* function exit code */
-  {
-    Py_ssize_t __pyx_temp;
-    for (__pyx_temp=0; __pyx_temp < (Py_ssize_t)(sizeof(values)/sizeof(values[0])); ++__pyx_temp) {
-      __Pyx_Arg_XDECREF_FASTCALL(values[__pyx_temp]);
-    }
-  }
-  __Pyx_RefNannyFinishContext();
-  return __pyx_r;
-}
-
-static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_substitutions(CYTHON_UNUSED PyObject *__pyx_self, PyObject *__pyx_v_read_seq_al, PyObject *__pyx_v_ref_seq_al, PyObject *__pyx_v__include_indx) {
-  PyObject *__pyx_v_ref_positions = NULL;
-  PyObject *__pyx_v_all_substitution_positions = NULL;
-  PyObject *__pyx_v_substitution_positions = NULL;
-  PyObject *__pyx_v_all_substitution_values = NULL;
-  PyObject *__pyx_v_substitution_values = NULL;
-  PyObject *__pyx_v_all_deletion_positions = NULL;
-  PyObject *__pyx_v_deletion_positions = NULL;
-  PyObject *__pyx_v_deletion_coordinates = NULL;
-  PyObject *__pyx_v_deletion_sizes = NULL;
-  int __pyx_v_start_deletion;
-  PyObject *__pyx_v_all_insertion_positions = NULL;
-  PyObject *__pyx_v_all_insertion_left_positions = NULL;
-  PyObject *__pyx_v_insertion_positions = NULL;
-  PyObject *__pyx_v_insertion_coordinates = NULL;
-  PyObject *__pyx_v_insertion_sizes = NULL;
-  int __pyx_v_start_insertion;
-  size_t __pyx_v_seq_len;
-  PyObject *__pyx_v_include_indx_set = NULL;
-  CYTHON_UNUSED PyObject *__pyx_v_nucSet = NULL;
-  int __pyx_v_idx;
-  int __pyx_v_idx_c;
-  int __pyx_v_current_insertion_size;
-  PyObject *__pyx_v_c = NULL;
-  PyObject *__pyx_v_end_deletion = NULL;
-  size_t __pyx_v_substitution_n;
-  size_t __pyx_v_deletion_n;
-  size_t __pyx_v_insertion_n;
-  PyObject *__pyx_r = NULL;
-  __Pyx_RefNannyDeclarations
-  PyObject *__pyx_t_1 = NULL;
-  Py_ssize_t __pyx_t_2;
-  int __pyx_t_3;
-  PyObject *(*__pyx_t_4)(PyObject *);
-  PyObject *__pyx_t_5 = NULL;
-  int __pyx_t_6;
-  int __pyx_t_7;
-  PyObject *__pyx_t_8 = NULL;
-  PyObject *__pyx_t_9 = NULL;
-  int __pyx_t_10;
-  int __pyx_t_11;
-  size_t __pyx_t_12;
-  int __pyx_lineno = 0;
-  const char *__pyx_filename = NULL;
-  int __pyx_clineno = 0;
-  __Pyx_RefNannySetupContext("find_indels_substitutions", 1);
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":110
- *     # aln A - T T T G G C C
- *     #     1 2 3 4-4 5 6 7 8 <ref positions. Note that the negative values/indices represent places that don't map back to the original reference
- *     ref_positions=[]             # <<<<<<<<<<<<<<
- *     all_substitution_positions=[]
- *     substitution_positions=[]
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 110, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_ref_positions = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":111
- *     #     1 2 3 4-4 5 6 7 8 <ref positions. Note that the negative values/indices represent places that don't map back to the original reference
- *     ref_positions=[]
- *     all_substitution_positions=[]             # <<<<<<<<<<<<<<
- *     substitution_positions=[]
- *     all_substitution_values=[]
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 111, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_all_substitution_positions = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":112
- *     ref_positions=[]
- *     all_substitution_positions=[]
- *     substitution_positions=[]             # <<<<<<<<<<<<<<
- *     all_substitution_values=[]
- *     substitution_values=[]
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 112, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_substitution_positions = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":113
- *     all_substitution_positions=[]
- *     substitution_positions=[]
- *     all_substitution_values=[]             # <<<<<<<<<<<<<<
- *     substitution_values=[]
- * 
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 113, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_all_substitution_values = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":114
- *     substitution_positions=[]
- *     all_substitution_values=[]
- *     substitution_values=[]             # <<<<<<<<<<<<<<
- * 
- *     all_deletion_positions = []
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 114, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_substitution_values = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":116
- *     substitution_values=[]
- * 
- *     all_deletion_positions = []             # <<<<<<<<<<<<<<
- *     deletion_positions = []
- *     deletion_coordinates = []
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 116, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_all_deletion_positions = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":117
- * 
- *     all_deletion_positions = []
- *     deletion_positions = []             # <<<<<<<<<<<<<<
- *     deletion_coordinates = []
- *     deletion_sizes = []
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 117, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_deletion_positions = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":118
- *     all_deletion_positions = []
- *     deletion_positions = []
- *     deletion_coordinates = []             # <<<<<<<<<<<<<<
- *     deletion_sizes = []
- *     cdef int start_deletion = -1  # the -1 value indicates that there currently isn't a deletion
- */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 118, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  __pyx_v_deletion_coordinates = ((PyObject*)__pyx_t_1);
-  __pyx_t_1 = 0;
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 118, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_v_deletion_coordinates = ((PyObject*)__pyx_t_1);
+  __pyx_t_1 = 0;
 
   /* "CRISPResso2/CRISPRessoCOREResources.pyx":119
  *     deletion_positions = []
@@ -6228,28 +5312,28 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
         {
           Py_ssize_t __pyx_temp = __Pyx_PyList_GET_SIZE(__pyx_t_1);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 135, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 58, __pyx_L1_error)
           #endif
           if (__pyx_t_2 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
         __pyx_t_5 = PyList_GET_ITEM(__pyx_t_1, __pyx_t_2); __Pyx_INCREF(__pyx_t_5); __pyx_t_2++; if (unlikely((0 < 0))) __PYX_ERR(0, 135, __pyx_L1_error)
         #else
-        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_2); __pyx_t_2++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 135, __pyx_L1_error)
+        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_2); __pyx_t_2++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 58, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_5);
         #endif
       } else {
         {
           Py_ssize_t __pyx_temp = __Pyx_PyTuple_GET_SIZE(__pyx_t_1);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 135, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 58, __pyx_L1_error)
           #endif
           if (__pyx_t_2 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
         __pyx_t_5 = PyTuple_GET_ITEM(__pyx_t_1, __pyx_t_2); __Pyx_INCREF(__pyx_t_5); __pyx_t_2++; if (unlikely((0 < 0))) __PYX_ERR(0, 135, __pyx_L1_error)
         #else
-        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_2); __pyx_t_2++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 135, __pyx_L1_error)
+        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_2); __pyx_t_2++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 58, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_5);
         #endif
       }
@@ -6493,9 +5577,9 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
           __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 149, __pyx_L1_error)
           __Pyx_GOTREF(__pyx_t_5);
           __Pyx_GIVEREF(__pyx_t_9);
-          if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_9)) __PYX_ERR(0, 149, __pyx_L1_error);
+          if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_9)) __PYX_ERR(0, 72, __pyx_L1_error);
           __Pyx_GIVEREF(__pyx_t_8);
-          if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_t_8)) __PYX_ERR(0, 149, __pyx_L1_error);
+          if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_t_8)) __PYX_ERR(0, 72, __pyx_L1_error);
           __pyx_t_9 = 0;
           __pyx_t_8 = 0;
           __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_coordinates, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 149, __pyx_L1_error)
@@ -6783,7 +5867,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
  *         elif read_seq_al[idx_c] != '-' and start_deletion != -1:  # this is the end of a deletion
  *             end_deletion = ref_positions[idx_c]             # <<<<<<<<<<<<<<
  *             all_deletion_positions.extend(range(start_deletion, end_deletion))
- *             if include_indx_set.intersection(range(start_deletion, end_deletion)):
+ *             all_deletion_coordinates.append((start_deletion, end_deletion))
  */
       __pyx_t_5 = PyList_GET_ITEM(__pyx_v_ref_positions, __pyx_v_idx_c);
       __Pyx_INCREF(__pyx_t_5);
@@ -6794,18 +5878,18 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
  *         elif read_seq_al[idx_c] != '-' and start_deletion != -1:  # this is the end of a deletion
  *             end_deletion = ref_positions[idx_c]
  *             all_deletion_positions.extend(range(start_deletion, end_deletion))             # <<<<<<<<<<<<<<
+ *             all_deletion_coordinates.append((start_deletion, end_deletion))
  *             if include_indx_set.intersection(range(start_deletion, end_deletion)):
- *                 deletion_positions.extend(range(start_deletion, end_deletion))
  */
       __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
       __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_8);
       __Pyx_GIVEREF(__pyx_t_5);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_5)) __PYX_ERR(0, 172, __pyx_L1_error);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_5)) __PYX_ERR(0, 95, __pyx_L1_error);
       __Pyx_INCREF(__pyx_v_end_deletion);
       __Pyx_GIVEREF(__pyx_v_end_deletion);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 172, __pyx_L1_error);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 95, __pyx_L1_error);
       __pyx_t_5 = 0;
       __pyx_t_5 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_8, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
@@ -6816,98 +5900,118 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
       /* "CRISPResso2/CRISPRessoCOREResources.pyx":173
  *             end_deletion = ref_positions[idx_c]
  *             all_deletion_positions.extend(range(start_deletion, end_deletion))
- *             if include_indx_set.intersection(range(start_deletion, end_deletion)):             # <<<<<<<<<<<<<<
+ *             all_deletion_coordinates.append((start_deletion, end_deletion))             # <<<<<<<<<<<<<<
+ *             if include_indx_set.intersection(range(start_deletion, end_deletion)):
  *                 deletion_positions.extend(range(start_deletion, end_deletion))
- *                 deletion_coordinates.append((start_deletion, end_deletion))
  */
       __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 173, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
       __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 173, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_8);
       __Pyx_GIVEREF(__pyx_t_5);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_5)) __PYX_ERR(0, 173, __pyx_L1_error);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_5)) __PYX_ERR(0, 96, __pyx_L1_error);
       __Pyx_INCREF(__pyx_v_end_deletion);
       __Pyx_GIVEREF(__pyx_v_end_deletion);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 173, __pyx_L1_error);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 96, __pyx_L1_error);
       __pyx_t_5 = 0;
-      __pyx_t_5 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_8, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 173, __pyx_L1_error)
-      __Pyx_GOTREF(__pyx_t_5);
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_deletion_coordinates, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 96, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
-      __pyx_t_8 = __Pyx_CallUnboundCMethod1(&__pyx_umethod_PySet_Type_intersection, __pyx_v_include_indx_set, __pyx_t_5); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 173, __pyx_L1_error)
+
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":97
+ *             all_deletion_positions.extend(range(start_deletion, end_deletion))
+ *             all_deletion_coordinates.append((start_deletion, end_deletion))
+ *             if include_indx_set.intersection(range(start_deletion, end_deletion)):             # <<<<<<<<<<<<<<
+ *                 deletion_positions.extend(range(start_deletion, end_deletion))
+ *                 deletion_coordinates.append((start_deletion, end_deletion))
+ */
+      __pyx_t_8 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 97, __pyx_L1_error)
+      __Pyx_GOTREF(__pyx_t_8);
+      __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 97, __pyx_L1_error)
+      __Pyx_GOTREF(__pyx_t_5);
+      __Pyx_GIVEREF(__pyx_t_8);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_8)) __PYX_ERR(0, 97, __pyx_L1_error);
+      __Pyx_INCREF(__pyx_v_end_deletion);
+      __Pyx_GIVEREF(__pyx_v_end_deletion);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 97, __pyx_L1_error);
+      __pyx_t_8 = 0;
+      __pyx_t_8 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 97, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_8);
       __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
-      __pyx_t_6 = __Pyx_PyObject_IsTrue(__pyx_t_8); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 173, __pyx_L1_error)
+      __pyx_t_5 = __Pyx_CallUnboundCMethod1(&__pyx_umethod_PySet_Type_intersection, __pyx_v_include_indx_set, __pyx_t_8); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 97, __pyx_L1_error)
+      __Pyx_GOTREF(__pyx_t_5);
       __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+      __pyx_t_6 = __Pyx_PyObject_IsTrue(__pyx_t_5); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 97, __pyx_L1_error)
+      __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
       if (__pyx_t_6) {
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":174
- *             all_deletion_positions.extend(range(start_deletion, end_deletion))
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":98
+ *             all_deletion_coordinates.append((start_deletion, end_deletion))
  *             if include_indx_set.intersection(range(start_deletion, end_deletion)):
  *                 deletion_positions.extend(range(start_deletion, end_deletion))             # <<<<<<<<<<<<<<
  *                 deletion_coordinates.append((start_deletion, end_deletion))
  *                 deletion_sizes.append(end_deletion - start_deletion)
  */
-        __pyx_t_8 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 174, __pyx_L1_error)
-        __Pyx_GOTREF(__pyx_t_8);
-        __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 174, __pyx_L1_error)
+        __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 98, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_5);
-        __Pyx_GIVEREF(__pyx_t_8);
-        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_8)) __PYX_ERR(0, 174, __pyx_L1_error);
+        __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 98, __pyx_L1_error)
+        __Pyx_GOTREF(__pyx_t_8);
+        __Pyx_GIVEREF(__pyx_t_5);
+        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_5)) __PYX_ERR(0, 98, __pyx_L1_error);
         __Pyx_INCREF(__pyx_v_end_deletion);
         __Pyx_GIVEREF(__pyx_v_end_deletion);
-        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 174, __pyx_L1_error);
-        __pyx_t_8 = 0;
-        __pyx_t_8 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 174, __pyx_L1_error)
-        __Pyx_GOTREF(__pyx_t_8);
-        __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
-        __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_deletion_positions, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 174, __pyx_L1_error)
+        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 98, __pyx_L1_error);
+        __pyx_t_5 = 0;
+        __pyx_t_5 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_8, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 98, __pyx_L1_error)
+        __Pyx_GOTREF(__pyx_t_5);
         __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+        __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_deletion_positions, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 98, __pyx_L1_error)
+        __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":175
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":99
  *             if include_indx_set.intersection(range(start_deletion, end_deletion)):
  *                 deletion_positions.extend(range(start_deletion, end_deletion))
  *                 deletion_coordinates.append((start_deletion, end_deletion))             # <<<<<<<<<<<<<<
  *                 deletion_sizes.append(end_deletion - start_deletion)
  *             start_deletion = -1
  */
-        __pyx_t_8 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 175, __pyx_L1_error)
-        __Pyx_GOTREF(__pyx_t_8);
-        __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 175, __pyx_L1_error)
+        __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 99, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_5);
-        __Pyx_GIVEREF(__pyx_t_8);
-        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_8)) __PYX_ERR(0, 175, __pyx_L1_error);
+        __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 99, __pyx_L1_error)
+        __Pyx_GOTREF(__pyx_t_8);
+        __Pyx_GIVEREF(__pyx_t_5);
+        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_5)) __PYX_ERR(0, 99, __pyx_L1_error);
         __Pyx_INCREF(__pyx_v_end_deletion);
         __Pyx_GIVEREF(__pyx_v_end_deletion);
-        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 175, __pyx_L1_error);
-        __pyx_t_8 = 0;
-        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_coordinates, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 175, __pyx_L1_error)
-        __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
+        if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 99, __pyx_L1_error);
+        __pyx_t_5 = 0;
+        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_coordinates, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 99, __pyx_L1_error)
+        __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":176
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":100
  *                 deletion_positions.extend(range(start_deletion, end_deletion))
  *                 deletion_coordinates.append((start_deletion, end_deletion))
  *                 deletion_sizes.append(end_deletion - start_deletion)             # <<<<<<<<<<<<<<
  *             start_deletion = -1
  * 
  */
-        __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 176, __pyx_L1_error)
-        __Pyx_GOTREF(__pyx_t_5);
-        __pyx_t_8 = PyNumber_Subtract(__pyx_v_end_deletion, __pyx_t_5); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 176, __pyx_L1_error)
+        __pyx_t_8 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 100, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_8);
-        __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
-        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_sizes, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 176, __pyx_L1_error)
+        __pyx_t_5 = PyNumber_Subtract(__pyx_v_end_deletion, __pyx_t_8); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 100, __pyx_L1_error)
+        __Pyx_GOTREF(__pyx_t_5);
         __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_sizes, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 100, __pyx_L1_error)
+        __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":173
- *             end_deletion = ref_positions[idx_c]
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":97
  *             all_deletion_positions.extend(range(start_deletion, end_deletion))
+ *             all_deletion_coordinates.append((start_deletion, end_deletion))
  *             if include_indx_set.intersection(range(start_deletion, end_deletion)):             # <<<<<<<<<<<<<<
  *                 deletion_positions.extend(range(start_deletion, end_deletion))
  *                 deletion_coordinates.append((start_deletion, end_deletion))
  */
       }
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":177
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":101
  *                 deletion_coordinates.append((start_deletion, end_deletion))
  *                 deletion_sizes.append(end_deletion - start_deletion)
  *             start_deletion = -1             # <<<<<<<<<<<<<<
@@ -6936,7 +6040,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
   }
   __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":179
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":103
  *             start_deletion = -1
  * 
  *     if start_deletion != -1:             # <<<<<<<<<<<<<<
@@ -6946,12 +6050,12 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
   __pyx_t_6 = (__pyx_v_start_deletion != -1L);
   if (__pyx_t_6) {
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":180
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":104
  * 
  *     if start_deletion != -1:
  *         end_deletion = ref_positions[seq_len - 1]             # <<<<<<<<<<<<<<
  *         all_deletion_positions.extend(range(start_deletion, end_deletion))
- *         if include_indx_set.intersection(range(start_deletion, end_deletion)):
+ *         all_deletion_coordinates.append((start_deletion, end_deletion))
  */
     __pyx_t_12 = (__pyx_v_seq_len - 1);
     __pyx_t_1 = PyList_GET_ITEM(__pyx_v_ref_positions, __pyx_t_12);
@@ -6959,124 +6063,144 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
     __Pyx_XDECREF_SET(__pyx_v_end_deletion, __pyx_t_1);
     __pyx_t_1 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":181
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":105
  *     if start_deletion != -1:
  *         end_deletion = ref_positions[seq_len - 1]
  *         all_deletion_positions.extend(range(start_deletion, end_deletion))             # <<<<<<<<<<<<<<
+ *         all_deletion_coordinates.append((start_deletion, end_deletion))
  *         if include_indx_set.intersection(range(start_deletion, end_deletion)):
- *             deletion_positions.extend(range(start_deletion, end_deletion))
  */
-    __pyx_t_1 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 181, __pyx_L1_error)
+    __pyx_t_1 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 105, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
-    __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 181, __pyx_L1_error)
-    __Pyx_GOTREF(__pyx_t_8);
+    __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 105, __pyx_L1_error)
+    __Pyx_GOTREF(__pyx_t_5);
     __Pyx_GIVEREF(__pyx_t_1);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_1)) __PYX_ERR(0, 181, __pyx_L1_error);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_1)) __PYX_ERR(0, 105, __pyx_L1_error);
     __Pyx_INCREF(__pyx_v_end_deletion);
     __Pyx_GIVEREF(__pyx_v_end_deletion);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 181, __pyx_L1_error);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 105, __pyx_L1_error);
     __pyx_t_1 = 0;
-    __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_8, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 181, __pyx_L1_error)
+    __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 105, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
-    __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
-    __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_all_deletion_positions, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 181, __pyx_L1_error)
+    __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
+    __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_all_deletion_positions, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 105, __pyx_L1_error)
     __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":182
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":106
  *         end_deletion = ref_positions[seq_len - 1]
  *         all_deletion_positions.extend(range(start_deletion, end_deletion))
- *         if include_indx_set.intersection(range(start_deletion, end_deletion)):             # <<<<<<<<<<<<<<
+ *         all_deletion_coordinates.append((start_deletion, end_deletion))             # <<<<<<<<<<<<<<
+ *         if include_indx_set.intersection(range(start_deletion, end_deletion)):
  *             deletion_positions.extend(range(start_deletion, end_deletion))
- *             deletion_coordinates.append((start_deletion, end_deletion))
  */
-    __pyx_t_1 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 182, __pyx_L1_error)
+    __pyx_t_1 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 106, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
-    __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 182, __pyx_L1_error)
-    __Pyx_GOTREF(__pyx_t_8);
+    __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 106, __pyx_L1_error)
+    __Pyx_GOTREF(__pyx_t_5);
     __Pyx_GIVEREF(__pyx_t_1);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_t_1)) __PYX_ERR(0, 182, __pyx_L1_error);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_1)) __PYX_ERR(0, 106, __pyx_L1_error);
     __Pyx_INCREF(__pyx_v_end_deletion);
     __Pyx_GIVEREF(__pyx_v_end_deletion);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 182, __pyx_L1_error);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 106, __pyx_L1_error);
     __pyx_t_1 = 0;
-    __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_8, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 182, __pyx_L1_error)
+    __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_deletion_coordinates, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 106, __pyx_L1_error)
+    __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
+
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":107
+ *         all_deletion_positions.extend(range(start_deletion, end_deletion))
+ *         all_deletion_coordinates.append((start_deletion, end_deletion))
+ *         if include_indx_set.intersection(range(start_deletion, end_deletion)):             # <<<<<<<<<<<<<<
+ *             deletion_positions.extend(range(start_deletion, end_deletion))
+ *             deletion_coordinates.append((start_deletion, end_deletion))
+ */
+    __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 107, __pyx_L1_error)
+    __Pyx_GOTREF(__pyx_t_5);
+    __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 107, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
-    __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
-    __pyx_t_8 = __Pyx_CallUnboundCMethod1(&__pyx_umethod_PySet_Type_intersection, __pyx_v_include_indx_set, __pyx_t_1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 182, __pyx_L1_error)
-    __Pyx_GOTREF(__pyx_t_8);
+    __Pyx_GIVEREF(__pyx_t_5);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_t_5)) __PYX_ERR(0, 107, __pyx_L1_error);
+    __Pyx_INCREF(__pyx_v_end_deletion);
+    __Pyx_GIVEREF(__pyx_v_end_deletion);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 107, __pyx_L1_error);
+    __pyx_t_5 = 0;
+    __pyx_t_5 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_1, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 107, __pyx_L1_error)
+    __Pyx_GOTREF(__pyx_t_5);
+    __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
+    __pyx_t_1 = __Pyx_CallUnboundCMethod1(&__pyx_umethod_PySet_Type_intersection, __pyx_v_include_indx_set, __pyx_t_5); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 107, __pyx_L1_error)
+    __Pyx_GOTREF(__pyx_t_1);
+    __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
+    __pyx_t_6 = __Pyx_PyObject_IsTrue(__pyx_t_1); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 107, __pyx_L1_error)
     __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
-    __pyx_t_6 = __Pyx_PyObject_IsTrue(__pyx_t_8); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 182, __pyx_L1_error)
-    __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":183
- *         all_deletion_positions.extend(range(start_deletion, end_deletion))
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":108
+ *         all_deletion_coordinates.append((start_deletion, end_deletion))
  *         if include_indx_set.intersection(range(start_deletion, end_deletion)):
  *             deletion_positions.extend(range(start_deletion, end_deletion))             # <<<<<<<<<<<<<<
  *             deletion_coordinates.append((start_deletion, end_deletion))
  *             deletion_sizes.append(end_deletion - start_deletion)
  */
-      __pyx_t_8 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 183, __pyx_L1_error)
-      __Pyx_GOTREF(__pyx_t_8);
-      __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 183, __pyx_L1_error)
+      __pyx_t_1 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 108, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_1);
-      __Pyx_GIVEREF(__pyx_t_8);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_t_8)) __PYX_ERR(0, 183, __pyx_L1_error);
+      __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 108, __pyx_L1_error)
+      __Pyx_GOTREF(__pyx_t_5);
+      __Pyx_GIVEREF(__pyx_t_1);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_1)) __PYX_ERR(0, 108, __pyx_L1_error);
       __Pyx_INCREF(__pyx_v_end_deletion);
       __Pyx_GIVEREF(__pyx_v_end_deletion);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 183, __pyx_L1_error);
-      __pyx_t_8 = 0;
-      __pyx_t_8 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_1, NULL); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 183, __pyx_L1_error)
-      __Pyx_GOTREF(__pyx_t_8);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 108, __pyx_L1_error);
+      __pyx_t_1 = 0;
+      __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 108, __pyx_L1_error)
+      __Pyx_GOTREF(__pyx_t_1);
+      __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
+      __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_deletion_positions, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 108, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
-      __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_deletion_positions, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 183, __pyx_L1_error)
-      __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":184
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":109
  *         if include_indx_set.intersection(range(start_deletion, end_deletion)):
  *             deletion_positions.extend(range(start_deletion, end_deletion))
  *             deletion_coordinates.append((start_deletion, end_deletion))             # <<<<<<<<<<<<<<
  *             deletion_sizes.append(end_deletion - start_deletion)
  * 
  */
-      __pyx_t_8 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 184, __pyx_L1_error)
-      __Pyx_GOTREF(__pyx_t_8);
-      __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 184, __pyx_L1_error)
+      __pyx_t_1 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 109, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_1);
-      __Pyx_GIVEREF(__pyx_t_8);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_t_8)) __PYX_ERR(0, 184, __pyx_L1_error);
+      __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 109, __pyx_L1_error)
+      __Pyx_GOTREF(__pyx_t_5);
+      __Pyx_GIVEREF(__pyx_t_1);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_t_1)) __PYX_ERR(0, 109, __pyx_L1_error);
       __Pyx_INCREF(__pyx_v_end_deletion);
       __Pyx_GIVEREF(__pyx_v_end_deletion);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 184, __pyx_L1_error);
-      __pyx_t_8 = 0;
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_coordinates, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 184, __pyx_L1_error)
-      __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_end_deletion)) __PYX_ERR(0, 109, __pyx_L1_error);
+      __pyx_t_1 = 0;
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_coordinates, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 109, __pyx_L1_error)
+      __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":185
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":110
  *             deletion_positions.extend(range(start_deletion, end_deletion))
  *             deletion_coordinates.append((start_deletion, end_deletion))
  *             deletion_sizes.append(end_deletion - start_deletion)             # <<<<<<<<<<<<<<
  * 
  *     cdef size_t substitution_n = len(substitution_positions)
  */
-      __pyx_t_1 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 185, __pyx_L1_error)
+      __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_start_deletion); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 110, __pyx_L1_error)
+      __Pyx_GOTREF(__pyx_t_5);
+      __pyx_t_1 = PyNumber_Subtract(__pyx_v_end_deletion, __pyx_t_5); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 110, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_1);
-      __pyx_t_8 = PyNumber_Subtract(__pyx_v_end_deletion, __pyx_t_1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 185, __pyx_L1_error)
-      __Pyx_GOTREF(__pyx_t_8);
+      __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_sizes, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 110, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_sizes, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 185, __pyx_L1_error)
-      __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":182
- *         end_deletion = ref_positions[seq_len - 1]
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":107
  *         all_deletion_positions.extend(range(start_deletion, end_deletion))
+ *         all_deletion_coordinates.append((start_deletion, end_deletion))
  *         if include_indx_set.intersection(range(start_deletion, end_deletion)):             # <<<<<<<<<<<<<<
  *             deletion_positions.extend(range(start_deletion, end_deletion))
  *             deletion_coordinates.append((start_deletion, end_deletion))
  */
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":179
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":103
  *             start_deletion = -1
  * 
  *     if start_deletion != -1:             # <<<<<<<<<<<<<<
@@ -7085,44 +6209,44 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
  */
   }
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":187
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":112
  *             deletion_sizes.append(end_deletion - start_deletion)
  * 
  *     cdef size_t substitution_n = len(substitution_positions)             # <<<<<<<<<<<<<<
  *     cdef size_t deletion_n = sum(deletion_sizes)
  *     cdef size_t insertion_n = sum(insertion_sizes)
  */
-  __pyx_t_2 = __Pyx_PyList_GET_SIZE(__pyx_v_substitution_positions); if (unlikely(__pyx_t_2 == ((Py_ssize_t)-1))) __PYX_ERR(0, 187, __pyx_L1_error)
+  __pyx_t_2 = __Pyx_PyList_GET_SIZE(__pyx_v_substitution_positions); if (unlikely(__pyx_t_2 == ((Py_ssize_t)-1))) __PYX_ERR(0, 112, __pyx_L1_error)
   __pyx_v_substitution_n = __pyx_t_2;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":188
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":113
  * 
  *     cdef size_t substitution_n = len(substitution_positions)
  *     cdef size_t deletion_n = sum(deletion_sizes)             # <<<<<<<<<<<<<<
  *     cdef size_t insertion_n = sum(insertion_sizes)
  * 
  */
-  __pyx_t_8 = __Pyx_PyObject_CallOneArg(__pyx_builtin_sum, __pyx_v_deletion_sizes); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 188, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_8);
-  __pyx_t_12 = __Pyx_PyInt_As_size_t(__pyx_t_8); if (unlikely((__pyx_t_12 == (size_t)-1) && PyErr_Occurred())) __PYX_ERR(0, 188, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+  __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_builtin_sum, __pyx_v_deletion_sizes); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 113, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_t_12 = __Pyx_PyInt_As_size_t(__pyx_t_1); if (unlikely((__pyx_t_12 == (size_t)-1) && PyErr_Occurred())) __PYX_ERR(0, 113, __pyx_L1_error)
+  __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
   __pyx_v_deletion_n = __pyx_t_12;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":189
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":114
  *     cdef size_t substitution_n = len(substitution_positions)
  *     cdef size_t deletion_n = sum(deletion_sizes)
  *     cdef size_t insertion_n = sum(insertion_sizes)             # <<<<<<<<<<<<<<
  * 
  *     # return ResultsSlotsDict(
  */
-  __pyx_t_8 = __Pyx_PyObject_CallOneArg(__pyx_builtin_sum, __pyx_v_insertion_sizes); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 189, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_8);
-  __pyx_t_12 = __Pyx_PyInt_As_size_t(__pyx_t_8); if (unlikely((__pyx_t_12 == (size_t)-1) && PyErr_Occurred())) __PYX_ERR(0, 189, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+  __pyx_t_1 = __Pyx_PyObject_CallOneArg(__pyx_builtin_sum, __pyx_v_insertion_sizes); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 114, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  __pyx_t_12 = __Pyx_PyInt_As_size_t(__pyx_t_1); if (unlikely((__pyx_t_12 == (size_t)-1) && PyErr_Occurred())) __PYX_ERR(0, 114, __pyx_L1_error)
+  __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
   __pyx_v_insertion_n = __pyx_t_12;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":214
- *     # )
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":116
+ *     cdef size_t insertion_n = sum(insertion_sizes)
  * 
  *     return {             # <<<<<<<<<<<<<<
  *         'all_insertion_positions': all_insertion_positions,
@@ -7130,151 +6254,160 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
  */
   __Pyx_XDECREF(__pyx_r);
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":215
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":117
  * 
  *     return {
  *         'all_insertion_positions': all_insertion_positions,             # <<<<<<<<<<<<<<
  *         'all_insertion_left_positions': all_insertion_left_positions,
  *         'insertion_positions': insertion_positions,
  */
-  __pyx_t_8 = __Pyx_PyDict_NewPresized(17); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 215, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_8);
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_all_insertion_positions, __pyx_v_all_insertion_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  __pyx_t_1 = __Pyx_PyDict_NewPresized(18); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 117, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_1);
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_insertion_positions, __pyx_v_all_insertion_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":216
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":118
  *     return {
  *         'all_insertion_positions': all_insertion_positions,
  *         'all_insertion_left_positions': all_insertion_left_positions,             # <<<<<<<<<<<<<<
  *         'insertion_positions': insertion_positions,
  *         'insertion_coordinates': insertion_coordinates,
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_all_insertion_left_positions, __pyx_v_all_insertion_left_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_insertion_left_positions, __pyx_v_all_insertion_left_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":217
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":119
  *         'all_insertion_positions': all_insertion_positions,
  *         'all_insertion_left_positions': all_insertion_left_positions,
  *         'insertion_positions': insertion_positions,             # <<<<<<<<<<<<<<
  *         'insertion_coordinates': insertion_coordinates,
  *         'insertion_sizes': insertion_sizes,
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_insertion_positions, __pyx_v_insertion_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_positions, __pyx_v_insertion_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":218
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":120
  *         'all_insertion_left_positions': all_insertion_left_positions,
  *         'insertion_positions': insertion_positions,
  *         'insertion_coordinates': insertion_coordinates,             # <<<<<<<<<<<<<<
  *         'insertion_sizes': insertion_sizes,
  *         'insertion_n': insertion_n,
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_insertion_coordinates, __pyx_v_insertion_coordinates) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_coordinates, __pyx_v_insertion_coordinates) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":219
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":121
  *         'insertion_positions': insertion_positions,
  *         'insertion_coordinates': insertion_coordinates,
  *         'insertion_sizes': insertion_sizes,             # <<<<<<<<<<<<<<
  *         'insertion_n': insertion_n,
  * 
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_insertion_sizes, __pyx_v_insertion_sizes) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_sizes, __pyx_v_insertion_sizes) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":220
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":122
  *         'insertion_coordinates': insertion_coordinates,
  *         'insertion_sizes': insertion_sizes,
  *         'insertion_n': insertion_n,             # <<<<<<<<<<<<<<
  * 
  *         'all_deletion_positions': all_deletion_positions,
  */
-  __pyx_t_1 = __Pyx_PyInt_FromSize_t(__pyx_v_insertion_n); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 220, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_insertion_n, __pyx_t_1) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
+  __pyx_t_5 = __Pyx_PyInt_FromSize_t(__pyx_v_insertion_n); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 122, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_5);
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_n, __pyx_t_5) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
+  __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":222
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":124
  *         'insertion_n': insertion_n,
  * 
  *         'all_deletion_positions': all_deletion_positions,             # <<<<<<<<<<<<<<
+ *         'all_deletion_coordinates': all_deletion_coordinates,
  *         'deletion_positions': deletion_positions,
- *         'deletion_coordinates': deletion_coordinates,
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_all_deletion_positions, __pyx_v_all_deletion_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_deletion_positions, __pyx_v_all_deletion_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":223
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":125
  * 
  *         'all_deletion_positions': all_deletion_positions,
+ *         'all_deletion_coordinates': all_deletion_coordinates,             # <<<<<<<<<<<<<<
+ *         'deletion_positions': deletion_positions,
+ *         'deletion_coordinates': deletion_coordinates,
+ */
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_deletion_coordinates, __pyx_v_all_deletion_coordinates) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
+
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":126
+ *         'all_deletion_positions': all_deletion_positions,
+ *         'all_deletion_coordinates': all_deletion_coordinates,
  *         'deletion_positions': deletion_positions,             # <<<<<<<<<<<<<<
  *         'deletion_coordinates': deletion_coordinates,
  *         'deletion_sizes': deletion_sizes,
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_deletion_positions, __pyx_v_deletion_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_positions, __pyx_v_deletion_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":224
- *         'all_deletion_positions': all_deletion_positions,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":127
+ *         'all_deletion_coordinates': all_deletion_coordinates,
  *         'deletion_positions': deletion_positions,
  *         'deletion_coordinates': deletion_coordinates,             # <<<<<<<<<<<<<<
  *         'deletion_sizes': deletion_sizes,
  *         'deletion_n': deletion_n,
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_deletion_coordinates, __pyx_v_deletion_coordinates) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_coordinates, __pyx_v_deletion_coordinates) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":225
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":128
  *         'deletion_positions': deletion_positions,
  *         'deletion_coordinates': deletion_coordinates,
  *         'deletion_sizes': deletion_sizes,             # <<<<<<<<<<<<<<
  *         'deletion_n': deletion_n,
  * 
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_deletion_sizes, __pyx_v_deletion_sizes) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_sizes, __pyx_v_deletion_sizes) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":226
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":129
  *         'deletion_coordinates': deletion_coordinates,
  *         'deletion_sizes': deletion_sizes,
  *         'deletion_n': deletion_n,             # <<<<<<<<<<<<<<
  * 
  *         'all_substitution_positions': all_substitution_positions,
  */
-  __pyx_t_1 = __Pyx_PyInt_FromSize_t(__pyx_v_deletion_n); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 226, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_deletion_n, __pyx_t_1) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
+  __pyx_t_5 = __Pyx_PyInt_FromSize_t(__pyx_v_deletion_n); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 129, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_5);
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_n, __pyx_t_5) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
+  __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":228
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":131
  *         'deletion_n': deletion_n,
  * 
  *         'all_substitution_positions': all_substitution_positions,             # <<<<<<<<<<<<<<
  *         'substitution_positions': substitution_positions,
  *         'all_substitution_values': np.array(all_substitution_values),
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_all_substitution_positions, __pyx_v_all_substitution_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_substitution_positions, __pyx_v_all_substitution_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":229
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":132
  * 
  *         'all_substitution_positions': all_substitution_positions,
  *         'substitution_positions': substitution_positions,             # <<<<<<<<<<<<<<
  *         'all_substitution_values': np.array(all_substitution_values),
  *         'substitution_values': np.array(substitution_values),
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_substitution_positions, __pyx_v_substitution_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_substitution_positions, __pyx_v_substitution_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":230
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":133
  *         'all_substitution_positions': all_substitution_positions,
  *         'substitution_positions': substitution_positions,
  *         'all_substitution_values': np.array(all_substitution_values),             # <<<<<<<<<<<<<<
  *         'substitution_values': np.array(substitution_values),
  *         'substitution_n': substitution_n,
  */
-  __Pyx_GetModuleGlobalName(__pyx_t_5, __pyx_n_s_np); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 230, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_5);
-  __pyx_t_9 = __Pyx_PyObject_GetAttrStr(__pyx_t_5, __pyx_n_s_array); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 230, __pyx_L1_error)
+  __Pyx_GetModuleGlobalName(__pyx_t_8, __pyx_n_s_np); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 133, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_8);
+  __pyx_t_9 = __Pyx_PyObject_GetAttrStr(__pyx_t_8, __pyx_n_s_array); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 133, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_9);
-  __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
-  __pyx_t_5 = NULL;
+  __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
+  __pyx_t_8 = NULL;
   __pyx_t_3 = 0;
   #if CYTHON_UNPACK_METHODS
   if (unlikely(PyMethod_Check(__pyx_t_9))) {
-    __pyx_t_5 = PyMethod_GET_SELF(__pyx_t_9);
-    if (likely(__pyx_t_5)) {
+    __pyx_t_8 = PyMethod_GET_SELF(__pyx_t_9);
+    if (likely(__pyx_t_8)) {
       PyObject* function = PyMethod_GET_FUNCTION(__pyx_t_9);
-      __Pyx_INCREF(__pyx_t_5);
+      __Pyx_INCREF(__pyx_t_8);
       __Pyx_INCREF(function);
       __Pyx_DECREF_SET(__pyx_t_9, function);
       __pyx_t_3 = 1;
@@ -7282,78 +6415,78 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
   }
   #endif
   {
-    PyObject *__pyx_callargs[2] = {__pyx_t_5, __pyx_v_all_substitution_values};
-    __pyx_t_1 = __Pyx_PyObject_FastCall(__pyx_t_9, __pyx_callargs+1-__pyx_t_3, 1+__pyx_t_3);
-    __Pyx_XDECREF(__pyx_t_5); __pyx_t_5 = 0;
-    if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 230, __pyx_L1_error)
-    __Pyx_GOTREF(__pyx_t_1);
+    PyObject *__pyx_callargs[2] = {__pyx_t_8, __pyx_v_all_substitution_values};
+    __pyx_t_5 = __Pyx_PyObject_FastCall(__pyx_t_9, __pyx_callargs+1-__pyx_t_3, 1+__pyx_t_3);
+    __Pyx_XDECREF(__pyx_t_8); __pyx_t_8 = 0;
+    if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 133, __pyx_L1_error)
+    __Pyx_GOTREF(__pyx_t_5);
     __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
   }
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_all_substitution_values, __pyx_t_1) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_substitution_values, __pyx_t_5) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
+  __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":231
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":134
  *         'substitution_positions': substitution_positions,
  *         'all_substitution_values': np.array(all_substitution_values),
  *         'substitution_values': np.array(substitution_values),             # <<<<<<<<<<<<<<
  *         'substitution_n': substitution_n,
- * 
+ *         'ref_positions': ref_positions,
  */
-  __Pyx_GetModuleGlobalName(__pyx_t_9, __pyx_n_s_np); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 231, __pyx_L1_error)
+  __Pyx_GetModuleGlobalName(__pyx_t_9, __pyx_n_s_np); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 134, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_9);
-  __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_t_9, __pyx_n_s_array); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 231, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_5);
+  __pyx_t_8 = __Pyx_PyObject_GetAttrStr(__pyx_t_9, __pyx_n_s_array); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 134, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_8);
   __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
   __pyx_t_9 = NULL;
   __pyx_t_3 = 0;
   #if CYTHON_UNPACK_METHODS
-  if (unlikely(PyMethod_Check(__pyx_t_5))) {
-    __pyx_t_9 = PyMethod_GET_SELF(__pyx_t_5);
+  if (unlikely(PyMethod_Check(__pyx_t_8))) {
+    __pyx_t_9 = PyMethod_GET_SELF(__pyx_t_8);
     if (likely(__pyx_t_9)) {
-      PyObject* function = PyMethod_GET_FUNCTION(__pyx_t_5);
+      PyObject* function = PyMethod_GET_FUNCTION(__pyx_t_8);
       __Pyx_INCREF(__pyx_t_9);
       __Pyx_INCREF(function);
-      __Pyx_DECREF_SET(__pyx_t_5, function);
+      __Pyx_DECREF_SET(__pyx_t_8, function);
       __pyx_t_3 = 1;
     }
   }
   #endif
   {
     PyObject *__pyx_callargs[2] = {__pyx_t_9, __pyx_v_substitution_values};
-    __pyx_t_1 = __Pyx_PyObject_FastCall(__pyx_t_5, __pyx_callargs+1-__pyx_t_3, 1+__pyx_t_3);
+    __pyx_t_5 = __Pyx_PyObject_FastCall(__pyx_t_8, __pyx_callargs+1-__pyx_t_3, 1+__pyx_t_3);
     __Pyx_XDECREF(__pyx_t_9); __pyx_t_9 = 0;
-    if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 231, __pyx_L1_error)
-    __Pyx_GOTREF(__pyx_t_1);
-    __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
+    if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 134, __pyx_L1_error)
+    __Pyx_GOTREF(__pyx_t_5);
+    __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
   }
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_substitution_values, __pyx_t_1) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_substitution_values, __pyx_t_5) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
+  __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":232
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":135
  *         'all_substitution_values': np.array(all_substitution_values),
  *         'substitution_values': np.array(substitution_values),
  *         'substitution_n': substitution_n,             # <<<<<<<<<<<<<<
- * 
  *         'ref_positions': ref_positions,
+ *     }
  */
-  __pyx_t_1 = __Pyx_PyInt_FromSize_t(__pyx_v_substitution_n); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 232, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_1);
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_substitution_n, __pyx_t_1) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
+  __pyx_t_5 = __Pyx_PyInt_FromSize_t(__pyx_v_substitution_n); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 135, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_t_5);
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_substitution_n, __pyx_t_5) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
+  __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":234
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":136
+ *         'substitution_values': np.array(substitution_values),
  *         'substitution_n': substitution_n,
- * 
  *         'ref_positions': ref_positions,             # <<<<<<<<<<<<<<
  *     }
- * 
+ * @cython.boundscheck(False)
  */
-  if (PyDict_SetItem(__pyx_t_8, __pyx_n_u_ref_positions, __pyx_v_ref_positions) < 0) __PYX_ERR(0, 215, __pyx_L1_error)
-  __pyx_r = __pyx_t_8;
-  __pyx_t_8 = 0;
+  if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_ref_positions, __pyx_v_ref_positions) < 0) __PYX_ERR(0, 117, __pyx_L1_error)
+  __pyx_r = __pyx_t_1;
+  __pyx_t_1 = 0;
   goto __pyx_L0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":96
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":18
  * re_find_indels = re.compile("(-*-)")
  * 
  * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
@@ -7376,6 +6509,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
   __Pyx_XDECREF(__pyx_v_all_substitution_values);
   __Pyx_XDECREF(__pyx_v_substitution_values);
   __Pyx_XDECREF(__pyx_v_all_deletion_positions);
+  __Pyx_XDECREF(__pyx_v_all_deletion_coordinates);
   __Pyx_XDECREF(__pyx_v_deletion_positions);
   __Pyx_XDECREF(__pyx_v_deletion_coordinates);
   __Pyx_XDECREF(__pyx_v_deletion_sizes);
@@ -7393,9 +6527,9 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_find_indels_su
   return __pyx_r;
 }
 
-/* "CRISPResso2/CRISPRessoCOREResources.pyx":238
- * 
- * 
+/* "CRISPResso2/CRISPRessoCOREResources.pyx":138
+ *         'ref_positions': ref_positions,
+ *     }
  * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
  * @cython.nonecheck(False)
  * @cython.wraparound(False)
@@ -7460,7 +6594,7 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
           (void)__Pyx_Arg_NewRef_FASTCALL(values[0]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 238, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 138, __pyx_L3_error)
         else goto __pyx_L5_argtuple_error;
         CYTHON_FALLTHROUGH;
         case  1:
@@ -7468,7 +6602,7 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
           (void)__Pyx_Arg_NewRef_FASTCALL(values[1]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 238, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 138, __pyx_L3_error)
         else {
           __Pyx_RaiseArgtupleInvalid("find_indels_substitutions_legacy", 1, 3, 3, 1); __PYX_ERR(0, 238, __pyx_L3_error)
         }
@@ -7478,7 +6612,7 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
           (void)__Pyx_Arg_NewRef_FASTCALL(values[2]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 238, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 138, __pyx_L3_error)
         else {
           __Pyx_RaiseArgtupleInvalid("find_indels_substitutions_legacy", 1, 3, 3, 2); __PYX_ERR(0, 238, __pyx_L3_error)
         }
@@ -7500,7 +6634,7 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
   }
   goto __pyx_L6_skip;
   __pyx_L5_argtuple_error:;
-  __Pyx_RaiseArgtupleInvalid("find_indels_substitutions_legacy", 1, 3, 3, __pyx_nargs); __PYX_ERR(0, 238, __pyx_L3_error)
+  __Pyx_RaiseArgtupleInvalid("find_indels_substitutions_legacy", 1, 3, 3, __pyx_nargs); __PYX_ERR(0, 138, __pyx_L3_error)
   __pyx_L6_skip:;
   goto __pyx_L4_argument_unpacking_done;
   __pyx_L3_error:;
@@ -7580,7 +6714,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   int __pyx_clineno = 0;
   __Pyx_RefNannySetupContext("find_indels_substitutions_legacy", 1);
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":243
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":145
  * def find_indels_substitutions_legacy(read_seq_al, ref_seq_al, _include_indx):
  * 
  *     cdef char* sub_seq=''             # <<<<<<<<<<<<<<
@@ -7589,85 +6723,85 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
   __pyx_v_sub_seq = ((char *)"");
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":260
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":162
  *     # aln A - T T T G G C C
  *     #     1 2 3 4-4 5 6 7 8 <ref positions. Note that the negative values/indices represent places that don't map back to the original reference
  *     ref_positions=[]             # <<<<<<<<<<<<<<
  *     all_substitution_positions=[]
  *     substitution_positions=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 260, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 162, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_ref_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":261
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":163
  *     #     1 2 3 4-4 5 6 7 8 <ref positions. Note that the negative values/indices represent places that don't map back to the original reference
  *     ref_positions=[]
  *     all_substitution_positions=[]             # <<<<<<<<<<<<<<
  *     substitution_positions=[]
  *     all_substitution_values=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 261, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 163, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_all_substitution_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":262
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":164
  *     ref_positions=[]
  *     all_substitution_positions=[]
  *     substitution_positions=[]             # <<<<<<<<<<<<<<
  *     all_substitution_values=[]
  *     substitution_values=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 262, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 164, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_substitution_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":263
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":165
  *     all_substitution_positions=[]
  *     substitution_positions=[]
  *     all_substitution_values=[]             # <<<<<<<<<<<<<<
  *     substitution_values=[]
- * 
+ *     nucSet = set(['A', 'T', 'C', 'G', 'N'])
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 263, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 165, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_all_substitution_values = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":264
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":166
  *     substitution_positions=[]
  *     all_substitution_values=[]
  *     substitution_values=[]             # <<<<<<<<<<<<<<
- * 
  *     nucSet = set(['A', 'T', 'C', 'G', 'N'])
+ *     idx=0
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 264, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 166, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_substitution_values = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":266
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":167
+ *     all_substitution_values=[]
  *     substitution_values=[]
- * 
  *     nucSet = set(['A', 'T', 'C', 'G', 'N'])             # <<<<<<<<<<<<<<
  *     idx=0
  *     for idx_c, c in enumerate(ref_seq_al):
  */
-  __pyx_t_1 = PySet_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 266, __pyx_L1_error)
+  __pyx_t_1 = PySet_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 167, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
-  if (PySet_Add(__pyx_t_1, __pyx_n_u_A) < 0) __PYX_ERR(0, 266, __pyx_L1_error)
-  if (PySet_Add(__pyx_t_1, __pyx_n_u_T) < 0) __PYX_ERR(0, 266, __pyx_L1_error)
-  if (PySet_Add(__pyx_t_1, __pyx_n_u_C) < 0) __PYX_ERR(0, 266, __pyx_L1_error)
-  if (PySet_Add(__pyx_t_1, __pyx_n_u_G) < 0) __PYX_ERR(0, 266, __pyx_L1_error)
-  if (PySet_Add(__pyx_t_1, __pyx_n_u_N) < 0) __PYX_ERR(0, 266, __pyx_L1_error)
+  if (PySet_Add(__pyx_t_1, __pyx_n_u_A) < 0) __PYX_ERR(0, 167, __pyx_L1_error)
+  if (PySet_Add(__pyx_t_1, __pyx_n_u_T) < 0) __PYX_ERR(0, 167, __pyx_L1_error)
+  if (PySet_Add(__pyx_t_1, __pyx_n_u_C) < 0) __PYX_ERR(0, 167, __pyx_L1_error)
+  if (PySet_Add(__pyx_t_1, __pyx_n_u_G) < 0) __PYX_ERR(0, 167, __pyx_L1_error)
+  if (PySet_Add(__pyx_t_1, __pyx_n_u_N) < 0) __PYX_ERR(0, 167, __pyx_L1_error)
   __pyx_v_nucSet = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":267
- * 
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":168
+ *     substitution_values=[]
  *     nucSet = set(['A', 'T', 'C', 'G', 'N'])
  *     idx=0             # <<<<<<<<<<<<<<
  *     for idx_c, c in enumerate(ref_seq_al):
@@ -7675,7 +6809,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
   __pyx_v_idx = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":268
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":169
  *     nucSet = set(['A', 'T', 'C', 'G', 'N'])
  *     idx=0
  *     for idx_c, c in enumerate(ref_seq_al):             # <<<<<<<<<<<<<<
@@ -7688,9 +6822,9 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __pyx_t_3 = 0;
     __pyx_t_4 = NULL;
   } else {
-    __pyx_t_3 = -1; __pyx_t_1 = PyObject_GetIter(__pyx_v_ref_seq_al); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 268, __pyx_L1_error)
+    __pyx_t_3 = -1; __pyx_t_1 = PyObject_GetIter(__pyx_v_ref_seq_al); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 169, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
-    __pyx_t_4 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_1); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 268, __pyx_L1_error)
+    __pyx_t_4 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_1); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 169, __pyx_L1_error)
   }
   for (;;) {
     if (likely(!__pyx_t_4)) {
@@ -7698,28 +6832,28 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
         {
           Py_ssize_t __pyx_temp = __Pyx_PyList_GET_SIZE(__pyx_t_1);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 268, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 169, __pyx_L1_error)
           #endif
           if (__pyx_t_3 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
-        __pyx_t_5 = PyList_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_5); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 268, __pyx_L1_error)
+        __pyx_t_5 = PyList_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_5); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 169, __pyx_L1_error)
         #else
-        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 268, __pyx_L1_error)
+        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 169, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_5);
         #endif
       } else {
         {
           Py_ssize_t __pyx_temp = __Pyx_PyTuple_GET_SIZE(__pyx_t_1);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 268, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 169, __pyx_L1_error)
           #endif
           if (__pyx_t_3 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
-        __pyx_t_5 = PyTuple_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_5); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 268, __pyx_L1_error)
+        __pyx_t_5 = PyTuple_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_5); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 169, __pyx_L1_error)
         #else
-        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 268, __pyx_L1_error)
+        __pyx_t_5 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 169, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_5);
         #endif
       }
@@ -7729,7 +6863,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
         PyObject* exc_type = PyErr_Occurred();
         if (exc_type) {
           if (likely(__Pyx_PyErr_GivenExceptionMatches(exc_type, PyExc_StopIteration))) PyErr_Clear();
-          else __PYX_ERR(0, 268, __pyx_L1_error)
+          else __PYX_ERR(0, 169, __pyx_L1_error)
         }
         break;
       }
@@ -7740,128 +6874,128 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __pyx_v_idx_c = __pyx_t_2;
     __pyx_t_2 = (__pyx_t_2 + 1);
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":269
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":170
  *     idx=0
  *     for idx_c, c in enumerate(ref_seq_al):
  *         if c in nucSet:             # <<<<<<<<<<<<<<
  *             ref_positions.append(idx)
  *             if ref_seq_al[idx_c]!=read_seq_al[idx_c] and read_seq_al[idx_c] != '-' and read_seq_al[idx_c] != 'N':
  */
-    __pyx_t_6 = (__Pyx_PySet_ContainsTF(__pyx_v_c, __pyx_v_nucSet, Py_EQ)); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 269, __pyx_L1_error)
+    __pyx_t_6 = (__Pyx_PySet_ContainsTF(__pyx_v_c, __pyx_v_nucSet, Py_EQ)); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 170, __pyx_L1_error)
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":270
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":171
  *     for idx_c, c in enumerate(ref_seq_al):
  *         if c in nucSet:
  *             ref_positions.append(idx)             # <<<<<<<<<<<<<<
  *             if ref_seq_al[idx_c]!=read_seq_al[idx_c] and read_seq_al[idx_c] != '-' and read_seq_al[idx_c] != 'N':
  *                 all_substitution_positions.append(idx)
  */
-      __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 270, __pyx_L1_error)
+      __pyx_t_5 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 171, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_ref_positions, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 270, __pyx_L1_error)
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_ref_positions, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 171, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":271
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":172
  *         if c in nucSet:
  *             ref_positions.append(idx)
  *             if ref_seq_al[idx_c]!=read_seq_al[idx_c] and read_seq_al[idx_c] != '-' and read_seq_al[idx_c] != 'N':             # <<<<<<<<<<<<<<
  *                 all_substitution_positions.append(idx)
  *                 all_substitution_values.append(read_seq_al[idx_c])
  */
-      __pyx_t_5 = __Pyx_GetItemInt(__pyx_v_ref_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_5 = __Pyx_GetItemInt(__pyx_v_ref_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
-      __pyx_t_8 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_8 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_8);
-      __pyx_t_9 = PyObject_RichCompare(__pyx_t_5, __pyx_t_8, Py_NE); __Pyx_XGOTREF(__pyx_t_9); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_9 = PyObject_RichCompare(__pyx_t_5, __pyx_t_8, Py_NE); __Pyx_XGOTREF(__pyx_t_9); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
       __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
-      __pyx_t_10 = __Pyx_PyObject_IsTrue(__pyx_t_9); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_10 = __Pyx_PyObject_IsTrue(__pyx_t_9); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
       if (__pyx_t_10) {
       } else {
         __pyx_t_6 = __pyx_t_10;
         goto __pyx_L7_bool_binop_done;
       }
-      __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_9);
-      __pyx_t_10 = (__Pyx_PyUnicode_Equals(__pyx_t_9, __pyx_kp_u__3, Py_NE)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_10 = (__Pyx_PyUnicode_Equals(__pyx_t_9, __pyx_kp_u__3, Py_NE)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
       if (__pyx_t_10) {
       } else {
         __pyx_t_6 = __pyx_t_10;
         goto __pyx_L7_bool_binop_done;
       }
-      __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_9);
-      __pyx_t_10 = (__Pyx_PyUnicode_Equals(__pyx_t_9, __pyx_n_u_N, Py_NE)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 271, __pyx_L1_error)
+      __pyx_t_10 = (__Pyx_PyUnicode_Equals(__pyx_t_9, __pyx_n_u_N, Py_NE)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 172, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
       __pyx_t_6 = __pyx_t_10;
       __pyx_L7_bool_binop_done:;
       if (__pyx_t_6) {
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":272
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":173
  *             ref_positions.append(idx)
  *             if ref_seq_al[idx_c]!=read_seq_al[idx_c] and read_seq_al[idx_c] != '-' and read_seq_al[idx_c] != 'N':
  *                 all_substitution_positions.append(idx)             # <<<<<<<<<<<<<<
  *                 all_substitution_values.append(read_seq_al[idx_c])
  *                 if idx in _include_indx:
  */
-        __pyx_t_9 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 272, __pyx_L1_error)
+        __pyx_t_9 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 173, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_9);
-        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_substitution_positions, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 272, __pyx_L1_error)
+        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_substitution_positions, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 173, __pyx_L1_error)
         __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":273
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":174
  *             if ref_seq_al[idx_c]!=read_seq_al[idx_c] and read_seq_al[idx_c] != '-' and read_seq_al[idx_c] != 'N':
  *                 all_substitution_positions.append(idx)
  *                 all_substitution_values.append(read_seq_al[idx_c])             # <<<<<<<<<<<<<<
  *                 if idx in _include_indx:
  *                     substitution_positions.append(idx)
  */
-        __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 273, __pyx_L1_error)
+        __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 174, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_9);
-        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_substitution_values, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 273, __pyx_L1_error)
+        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_substitution_values, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 174, __pyx_L1_error)
         __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":274
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":175
  *                 all_substitution_positions.append(idx)
  *                 all_substitution_values.append(read_seq_al[idx_c])
  *                 if idx in _include_indx:             # <<<<<<<<<<<<<<
  *                     substitution_positions.append(idx)
  *                     substitution_values.append(read_seq_al[idx_c])
  */
-        __pyx_t_9 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 274, __pyx_L1_error)
+        __pyx_t_9 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 175, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_9);
-        __pyx_t_6 = (__Pyx_PySequence_ContainsTF(__pyx_t_9, __pyx_v__include_indx, Py_EQ)); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 274, __pyx_L1_error)
+        __pyx_t_6 = (__Pyx_PySequence_ContainsTF(__pyx_t_9, __pyx_v__include_indx, Py_EQ)); if (unlikely((__pyx_t_6 < 0))) __PYX_ERR(0, 175, __pyx_L1_error)
         __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
         if (__pyx_t_6) {
 
-          /* "CRISPResso2/CRISPRessoCOREResources.pyx":275
+          /* "CRISPResso2/CRISPRessoCOREResources.pyx":176
  *                 all_substitution_values.append(read_seq_al[idx_c])
  *                 if idx in _include_indx:
  *                     substitution_positions.append(idx)             # <<<<<<<<<<<<<<
  *                     substitution_values.append(read_seq_al[idx_c])
  * 
  */
-          __pyx_t_9 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 275, __pyx_L1_error)
+          __pyx_t_9 = __Pyx_PyInt_From_int(__pyx_v_idx); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 176, __pyx_L1_error)
           __Pyx_GOTREF(__pyx_t_9);
-          __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_substitution_positions, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 275, __pyx_L1_error)
+          __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_substitution_positions, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 176, __pyx_L1_error)
           __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
 
-          /* "CRISPResso2/CRISPRessoCOREResources.pyx":276
+          /* "CRISPResso2/CRISPRessoCOREResources.pyx":177
  *                 if idx in _include_indx:
  *                     substitution_positions.append(idx)
  *                     substitution_values.append(read_seq_al[idx_c])             # <<<<<<<<<<<<<<
  * 
  *             idx+=1
  */
-          __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 276, __pyx_L1_error)
+          __pyx_t_9 = __Pyx_GetItemInt(__pyx_v_read_seq_al, __pyx_v_idx_c, int, 1, __Pyx_PyInt_From_int, 0, 0, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 177, __pyx_L1_error)
           __Pyx_GOTREF(__pyx_t_9);
-          __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_substitution_values, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 276, __pyx_L1_error)
+          __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_substitution_values, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 177, __pyx_L1_error)
           __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
 
-          /* "CRISPResso2/CRISPRessoCOREResources.pyx":274
+          /* "CRISPResso2/CRISPRessoCOREResources.pyx":175
  *                 all_substitution_positions.append(idx)
  *                 all_substitution_values.append(read_seq_al[idx_c])
  *                 if idx in _include_indx:             # <<<<<<<<<<<<<<
@@ -7870,7 +7004,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
         }
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":271
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":172
  *         if c in nucSet:
  *             ref_positions.append(idx)
  *             if ref_seq_al[idx_c]!=read_seq_al[idx_c] and read_seq_al[idx_c] != '-' and read_seq_al[idx_c] != 'N':             # <<<<<<<<<<<<<<
@@ -7879,7 +7013,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
       }
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":278
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":179
  *                     substitution_values.append(read_seq_al[idx_c])
  * 
  *             idx+=1             # <<<<<<<<<<<<<<
@@ -7888,7 +7022,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
       __pyx_v_idx = (__pyx_v_idx + 1);
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":269
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":170
  *     idx=0
  *     for idx_c, c in enumerate(ref_seq_al):
  *         if c in nucSet:             # <<<<<<<<<<<<<<
@@ -7898,7 +7032,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       goto __pyx_L5;
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":281
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":182
  * 
  *         else:
  *             if idx==0:             # <<<<<<<<<<<<<<
@@ -7909,16 +7043,16 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __pyx_t_6 = (__pyx_v_idx == 0);
       if (__pyx_t_6) {
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":282
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":183
  *         else:
  *             if idx==0:
  *                 ref_positions.append(-1)             # <<<<<<<<<<<<<<
  *             else:
  *                 ref_positions.append(-idx)
  */
-        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_ref_positions, __pyx_int_neg_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 282, __pyx_L1_error)
+        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_ref_positions, __pyx_int_neg_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 183, __pyx_L1_error)
 
-        /* "CRISPResso2/CRISPRessoCOREResources.pyx":281
+        /* "CRISPResso2/CRISPRessoCOREResources.pyx":182
  * 
  *         else:
  *             if idx==0:             # <<<<<<<<<<<<<<
@@ -7928,7 +7062,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
         goto __pyx_L11;
       }
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":284
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":185
  *                 ref_positions.append(-1)
  *             else:
  *                 ref_positions.append(-idx)             # <<<<<<<<<<<<<<
@@ -7936,16 +7070,16 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  *     substitution_n = len(substitution_positions)
  */
       /*else*/ {
-        __pyx_t_9 = __Pyx_PyInt_From_int((-__pyx_v_idx)); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 284, __pyx_L1_error)
+        __pyx_t_9 = __Pyx_PyInt_From_int((-__pyx_v_idx)); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 185, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_9);
-        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_ref_positions, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 284, __pyx_L1_error)
+        __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_ref_positions, __pyx_t_9); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 185, __pyx_L1_error)
         __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
       }
       __pyx_L11:;
     }
     __pyx_L5:;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":268
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":169
  *     nucSet = set(['A', 'T', 'C', 'G', 'N'])
  *     idx=0
  *     for idx_c, c in enumerate(ref_seq_al):             # <<<<<<<<<<<<<<
@@ -7955,146 +7089,146 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   }
   __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":286
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":187
  *                 ref_positions.append(-idx)
  * 
  *     substitution_n = len(substitution_positions)             # <<<<<<<<<<<<<<
  * 
  *     #the remainder of positions are with reference to the original reference sequence indexes we calculated above
  */
-  __pyx_t_3 = __Pyx_PyList_GET_SIZE(__pyx_v_substitution_positions); if (unlikely(__pyx_t_3 == ((Py_ssize_t)-1))) __PYX_ERR(0, 286, __pyx_L1_error)
+  __pyx_t_3 = __Pyx_PyList_GET_SIZE(__pyx_v_substitution_positions); if (unlikely(__pyx_t_3 == ((Py_ssize_t)-1))) __PYX_ERR(0, 187, __pyx_L1_error)
   __pyx_v_substitution_n = __pyx_t_3;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":289
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":190
  * 
  *     #the remainder of positions are with reference to the original reference sequence indexes we calculated above
  *     all_deletion_positions=[]             # <<<<<<<<<<<<<<
  *     deletion_positions=[]
  *     deletion_coordinates=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 289, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 190, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_all_deletion_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":290
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":191
  *     #the remainder of positions are with reference to the original reference sequence indexes we calculated above
  *     all_deletion_positions=[]
  *     deletion_positions=[]             # <<<<<<<<<<<<<<
  *     deletion_coordinates=[]
  *     deletion_sizes=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 290, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 191, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_deletion_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":291
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":192
  *     all_deletion_positions=[]
  *     deletion_positions=[]
  *     deletion_coordinates=[]             # <<<<<<<<<<<<<<
  *     deletion_sizes=[]
  * 
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 291, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 192, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_deletion_coordinates = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":292
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":193
  *     deletion_positions=[]
  *     deletion_coordinates=[]
  *     deletion_sizes=[]             # <<<<<<<<<<<<<<
  * 
  *     all_insertion_positions=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 292, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 193, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_deletion_sizes = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":294
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":195
  *     deletion_sizes=[]
  * 
  *     all_insertion_positions=[]             # <<<<<<<<<<<<<<
  *     all_insertion_left_positions=[]
  *     insertion_positions=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 294, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 195, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_all_insertion_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":295
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":196
  * 
  *     all_insertion_positions=[]
  *     all_insertion_left_positions=[]             # <<<<<<<<<<<<<<
  *     insertion_positions=[]
  *     insertion_coordinates = []
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 295, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 196, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_all_insertion_left_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":296
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":197
  *     all_insertion_positions=[]
  *     all_insertion_left_positions=[]
  *     insertion_positions=[]             # <<<<<<<<<<<<<<
  *     insertion_coordinates = []
  *     insertion_sizes=[]
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 296, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 197, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_insertion_positions = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":297
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":198
  *     all_insertion_left_positions=[]
  *     insertion_positions=[]
  *     insertion_coordinates = []             # <<<<<<<<<<<<<<
  *     insertion_sizes=[]
  * 
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 297, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 198, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_insertion_coordinates = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":298
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":199
  *     insertion_positions=[]
  *     insertion_coordinates = []
  *     insertion_sizes=[]             # <<<<<<<<<<<<<<
  * 
  *     include_indx_set = set(_include_indx)
  */
-  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 298, __pyx_L1_error)
+  __pyx_t_1 = PyList_New(0); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 199, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_insertion_sizes = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":300
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":201
  *     insertion_sizes=[]
  * 
  *     include_indx_set = set(_include_indx)             # <<<<<<<<<<<<<<
  *     for p in re_find_indels.finditer(read_seq_al):
  *         st,en=p.span()
  */
-  __pyx_t_1 = PySet_New(__pyx_v__include_indx); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 300, __pyx_L1_error)
+  __pyx_t_1 = PySet_New(__pyx_v__include_indx); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 201, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __pyx_v_include_indx_set = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":301
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":202
  * 
  *     include_indx_set = set(_include_indx)
  *     for p in re_find_indels.finditer(read_seq_al):             # <<<<<<<<<<<<<<
  *         st,en=p.span()
  *         ref_st = 0
  */
-  __Pyx_GetModuleGlobalName(__pyx_t_9, __pyx_n_s_re_find_indels); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 301, __pyx_L1_error)
+  __Pyx_GetModuleGlobalName(__pyx_t_9, __pyx_n_s_re_find_indels); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 202, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_9);
-  __pyx_t_8 = __Pyx_PyObject_GetAttrStr(__pyx_t_9, __pyx_n_s_finditer); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 301, __pyx_L1_error)
+  __pyx_t_8 = __Pyx_PyObject_GetAttrStr(__pyx_t_9, __pyx_n_s_finditer); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 202, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_8);
   __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
   __pyx_t_9 = NULL;
@@ -8115,7 +7249,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     PyObject *__pyx_callargs[2] = {__pyx_t_9, __pyx_v_read_seq_al};
     __pyx_t_1 = __Pyx_PyObject_FastCall(__pyx_t_8, __pyx_callargs+1-__pyx_t_2, 1+__pyx_t_2);
     __Pyx_XDECREF(__pyx_t_9); __pyx_t_9 = 0;
-    if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 301, __pyx_L1_error)
+    if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 202, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
     __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
   }
@@ -8124,9 +7258,9 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __pyx_t_3 = 0;
     __pyx_t_4 = NULL;
   } else {
-    __pyx_t_3 = -1; __pyx_t_8 = PyObject_GetIter(__pyx_t_1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 301, __pyx_L1_error)
+    __pyx_t_3 = -1; __pyx_t_8 = PyObject_GetIter(__pyx_t_1); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 202, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_8);
-    __pyx_t_4 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_8); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 301, __pyx_L1_error)
+    __pyx_t_4 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_8); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 202, __pyx_L1_error)
   }
   __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
   for (;;) {
@@ -8135,28 +7269,28 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
         {
           Py_ssize_t __pyx_temp = __Pyx_PyList_GET_SIZE(__pyx_t_8);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 301, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 202, __pyx_L1_error)
           #endif
           if (__pyx_t_3 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
-        __pyx_t_1 = PyList_GET_ITEM(__pyx_t_8, __pyx_t_3); __Pyx_INCREF(__pyx_t_1); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 301, __pyx_L1_error)
+        __pyx_t_1 = PyList_GET_ITEM(__pyx_t_8, __pyx_t_3); __Pyx_INCREF(__pyx_t_1); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 202, __pyx_L1_error)
         #else
-        __pyx_t_1 = __Pyx_PySequence_ITEM(__pyx_t_8, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 301, __pyx_L1_error)
+        __pyx_t_1 = __Pyx_PySequence_ITEM(__pyx_t_8, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 202, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_1);
         #endif
       } else {
         {
           Py_ssize_t __pyx_temp = __Pyx_PyTuple_GET_SIZE(__pyx_t_8);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 301, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 202, __pyx_L1_error)
           #endif
           if (__pyx_t_3 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
-        __pyx_t_1 = PyTuple_GET_ITEM(__pyx_t_8, __pyx_t_3); __Pyx_INCREF(__pyx_t_1); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 301, __pyx_L1_error)
+        __pyx_t_1 = PyTuple_GET_ITEM(__pyx_t_8, __pyx_t_3); __Pyx_INCREF(__pyx_t_1); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 202, __pyx_L1_error)
         #else
-        __pyx_t_1 = __Pyx_PySequence_ITEM(__pyx_t_8, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 301, __pyx_L1_error)
+        __pyx_t_1 = __Pyx_PySequence_ITEM(__pyx_t_8, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 202, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_1);
         #endif
       }
@@ -8166,7 +7300,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
         PyObject* exc_type = PyErr_Occurred();
         if (exc_type) {
           if (likely(__Pyx_PyErr_GivenExceptionMatches(exc_type, PyExc_StopIteration))) PyErr_Clear();
-          else __PYX_ERR(0, 301, __pyx_L1_error)
+          else __PYX_ERR(0, 202, __pyx_L1_error)
         }
         break;
       }
@@ -8175,14 +7309,14 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __Pyx_XDECREF_SET(__pyx_v_p, __pyx_t_1);
     __pyx_t_1 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":302
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":203
  *     include_indx_set = set(_include_indx)
  *     for p in re_find_indels.finditer(read_seq_al):
  *         st,en=p.span()             # <<<<<<<<<<<<<<
  *         ref_st = 0
  *         if st-1 > 0:
  */
-    __pyx_t_9 = __Pyx_PyObject_GetAttrStr(__pyx_v_p, __pyx_n_s_span); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 302, __pyx_L1_error)
+    __pyx_t_9 = __Pyx_PyObject_GetAttrStr(__pyx_v_p, __pyx_n_s_span); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 203, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_9);
     __pyx_t_5 = NULL;
     __pyx_t_2 = 0;
@@ -8202,7 +7336,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       PyObject *__pyx_callargs[2] = {__pyx_t_5, NULL};
       __pyx_t_1 = __Pyx_PyObject_FastCall(__pyx_t_9, __pyx_callargs+1-__pyx_t_2, 0+__pyx_t_2);
       __Pyx_XDECREF(__pyx_t_5); __pyx_t_5 = 0;
-      if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 302, __pyx_L1_error)
+      if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 203, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_1);
       __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
     }
@@ -8212,7 +7346,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       if (unlikely(size != 2)) {
         if (size > 2) __Pyx_RaiseTooManyValuesError(2);
         else if (size >= 0) __Pyx_RaiseNeedMoreValuesError(size);
-        __PYX_ERR(0, 302, __pyx_L1_error)
+        __PYX_ERR(0, 203, __pyx_L1_error)
       }
       #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
       if (likely(PyTuple_CheckExact(sequence))) {
@@ -8225,15 +7359,15 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_INCREF(__pyx_t_9);
       __Pyx_INCREF(__pyx_t_5);
       #else
-      __pyx_t_9 = PySequence_ITEM(sequence, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 302, __pyx_L1_error)
+      __pyx_t_9 = PySequence_ITEM(sequence, 0); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 203, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_9);
-      __pyx_t_5 = PySequence_ITEM(sequence, 1); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 302, __pyx_L1_error)
+      __pyx_t_5 = PySequence_ITEM(sequence, 1); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 203, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
       #endif
       __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
     } else {
       Py_ssize_t index = -1;
-      __pyx_t_11 = PyObject_GetIter(__pyx_t_1); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 302, __pyx_L1_error)
+      __pyx_t_11 = PyObject_GetIter(__pyx_t_1); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 203, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_11);
       __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
       __pyx_t_12 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_11);
@@ -8241,7 +7375,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_GOTREF(__pyx_t_9);
       index = 1; __pyx_t_5 = __pyx_t_12(__pyx_t_11); if (unlikely(!__pyx_t_5)) goto __pyx_L15_unpacking_failed;
       __Pyx_GOTREF(__pyx_t_5);
-      if (__Pyx_IternextUnpackEndCheck(__pyx_t_12(__pyx_t_11), 2) < 0) __PYX_ERR(0, 302, __pyx_L1_error)
+      if (__Pyx_IternextUnpackEndCheck(__pyx_t_12(__pyx_t_11), 2) < 0) __PYX_ERR(0, 203, __pyx_L1_error)
       __pyx_t_12 = NULL;
       __Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
       goto __pyx_L16_unpacking_done;
@@ -8249,17 +7383,17 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
       __pyx_t_12 = NULL;
       if (__Pyx_IterFinish() == 0) __Pyx_RaiseNeedMoreValuesError(index);
-      __PYX_ERR(0, 302, __pyx_L1_error)
+      __PYX_ERR(0, 203, __pyx_L1_error)
       __pyx_L16_unpacking_done:;
     }
-    __pyx_t_2 = __Pyx_PyInt_As_int(__pyx_t_9); if (unlikely((__pyx_t_2 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 302, __pyx_L1_error)
+    __pyx_t_2 = __Pyx_PyInt_As_int(__pyx_t_9); if (unlikely((__pyx_t_2 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 203, __pyx_L1_error)
     __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
-    __pyx_t_13 = __Pyx_PyInt_As_int(__pyx_t_5); if (unlikely((__pyx_t_13 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 302, __pyx_L1_error)
+    __pyx_t_13 = __Pyx_PyInt_As_int(__pyx_t_5); if (unlikely((__pyx_t_13 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 203, __pyx_L1_error)
     __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
     __pyx_v_st = __pyx_t_2;
     __pyx_v_en = __pyx_t_13;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":303
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":204
  *     for p in re_find_indels.finditer(read_seq_al):
  *         st,en=p.span()
  *         ref_st = 0             # <<<<<<<<<<<<<<
@@ -8269,7 +7403,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __Pyx_INCREF(__pyx_int_0);
     __Pyx_XDECREF_SET(__pyx_v_ref_st, __pyx_int_0);
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":304
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":205
  *         st,en=p.span()
  *         ref_st = 0
  *         if st-1 > 0:             # <<<<<<<<<<<<<<
@@ -8279,7 +7413,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __pyx_t_6 = ((__pyx_v_st - 1) > 0);
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":305
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":206
  *         ref_st = 0
  *         if st-1 > 0:
  *           ref_st = ref_positions[st]             # <<<<<<<<<<<<<<
@@ -8291,7 +7425,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_DECREF_SET(__pyx_v_ref_st, __pyx_t_1);
       __pyx_t_1 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":304
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":205
  *         st,en=p.span()
  *         ref_st = 0
  *         if st-1 > 0:             # <<<<<<<<<<<<<<
@@ -8300,30 +7434,30 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":306
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":207
  *         if st-1 > 0:
  *           ref_st = ref_positions[st]
  *         ref_en = idx-1             # <<<<<<<<<<<<<<
  *         if en < len(ref_positions):
  *           ref_en = ref_positions[en]
  */
-    __pyx_t_1 = __Pyx_PyInt_From_long((__pyx_v_idx - 1)); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 306, __pyx_L1_error)
+    __pyx_t_1 = __Pyx_PyInt_From_long((__pyx_v_idx - 1)); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 207, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
     __Pyx_XDECREF_SET(__pyx_v_ref_en, __pyx_t_1);
     __pyx_t_1 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":307
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":208
  *           ref_st = ref_positions[st]
  *         ref_en = idx-1
  *         if en < len(ref_positions):             # <<<<<<<<<<<<<<
  *           ref_en = ref_positions[en]
  *         all_deletion_positions.extend(range(ref_st,ref_en))
  */
-    __pyx_t_14 = __Pyx_PyList_GET_SIZE(__pyx_v_ref_positions); if (unlikely(__pyx_t_14 == ((Py_ssize_t)-1))) __PYX_ERR(0, 307, __pyx_L1_error)
+    __pyx_t_14 = __Pyx_PyList_GET_SIZE(__pyx_v_ref_positions); if (unlikely(__pyx_t_14 == ((Py_ssize_t)-1))) __PYX_ERR(0, 208, __pyx_L1_error)
     __pyx_t_6 = (__pyx_v_en < __pyx_t_14);
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":308
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":209
  *         ref_en = idx-1
  *         if en < len(ref_positions):
  *           ref_en = ref_positions[en]             # <<<<<<<<<<<<<<
@@ -8335,7 +7469,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_DECREF_SET(__pyx_v_ref_en, __pyx_t_1);
       __pyx_t_1 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":307
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":208
  *           ref_st = ref_positions[st]
  *         ref_en = idx-1
  *         if en < len(ref_positions):             # <<<<<<<<<<<<<<
@@ -8344,114 +7478,114 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":309
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":210
  *         if en < len(ref_positions):
  *           ref_en = ref_positions[en]
  *         all_deletion_positions.extend(range(ref_st,ref_en))             # <<<<<<<<<<<<<<
  *         inc_del_pos = include_indx_set.intersection(range(ref_st,ref_en))
  *         if(len(inc_del_pos)>0):
  */
-    __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 309, __pyx_L1_error)
+    __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 210, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
     __Pyx_INCREF(__pyx_v_ref_st);
     __Pyx_GIVEREF(__pyx_v_ref_st);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_v_ref_st)) __PYX_ERR(0, 309, __pyx_L1_error);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_v_ref_st)) __PYX_ERR(0, 210, __pyx_L1_error);
     __Pyx_INCREF(__pyx_v_ref_en);
     __Pyx_GIVEREF(__pyx_v_ref_en);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_ref_en)) __PYX_ERR(0, 309, __pyx_L1_error);
-    __pyx_t_5 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_1, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 309, __pyx_L1_error)
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_ref_en)) __PYX_ERR(0, 210, __pyx_L1_error);
+    __pyx_t_5 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_1, NULL); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 210, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_5);
     __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
-    __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_all_deletion_positions, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 309, __pyx_L1_error)
+    __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_all_deletion_positions, __pyx_t_5); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 210, __pyx_L1_error)
     __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":310
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":211
  *           ref_en = ref_positions[en]
  *         all_deletion_positions.extend(range(ref_st,ref_en))
  *         inc_del_pos = include_indx_set.intersection(range(ref_st,ref_en))             # <<<<<<<<<<<<<<
  *         if(len(inc_del_pos)>0):
  *           deletion_positions.extend(range(ref_st,ref_en))
  */
-    __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 310, __pyx_L1_error)
+    __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 211, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_5);
     __Pyx_INCREF(__pyx_v_ref_st);
     __Pyx_GIVEREF(__pyx_v_ref_st);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_v_ref_st)) __PYX_ERR(0, 310, __pyx_L1_error);
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_v_ref_st)) __PYX_ERR(0, 211, __pyx_L1_error);
     __Pyx_INCREF(__pyx_v_ref_en);
     __Pyx_GIVEREF(__pyx_v_ref_en);
-    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_ref_en)) __PYX_ERR(0, 310, __pyx_L1_error);
-    __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 310, __pyx_L1_error)
+    if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_ref_en)) __PYX_ERR(0, 211, __pyx_L1_error);
+    __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 211, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
     __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
-    __pyx_t_5 = __Pyx_CallUnboundCMethod1(&__pyx_umethod_PySet_Type_intersection, __pyx_v_include_indx_set, __pyx_t_1); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 310, __pyx_L1_error)
+    __pyx_t_5 = __Pyx_CallUnboundCMethod1(&__pyx_umethod_PySet_Type_intersection, __pyx_v_include_indx_set, __pyx_t_1); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 211, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_5);
     __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
     __Pyx_XDECREF_SET(__pyx_v_inc_del_pos, __pyx_t_5);
     __pyx_t_5 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":311
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":212
  *         all_deletion_positions.extend(range(ref_st,ref_en))
  *         inc_del_pos = include_indx_set.intersection(range(ref_st,ref_en))
  *         if(len(inc_del_pos)>0):             # <<<<<<<<<<<<<<
  *           deletion_positions.extend(range(ref_st,ref_en))
  *           deletion_coordinates.append((ref_st,ref_en))
  */
-    __pyx_t_14 = PyObject_Length(__pyx_v_inc_del_pos); if (unlikely(__pyx_t_14 == ((Py_ssize_t)-1))) __PYX_ERR(0, 311, __pyx_L1_error)
+    __pyx_t_14 = PyObject_Length(__pyx_v_inc_del_pos); if (unlikely(__pyx_t_14 == ((Py_ssize_t)-1))) __PYX_ERR(0, 212, __pyx_L1_error)
     __pyx_t_6 = (__pyx_t_14 > 0);
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":312
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":213
  *         inc_del_pos = include_indx_set.intersection(range(ref_st,ref_en))
  *         if(len(inc_del_pos)>0):
  *           deletion_positions.extend(range(ref_st,ref_en))             # <<<<<<<<<<<<<<
  *           deletion_coordinates.append((ref_st,ref_en))
  *           deletion_sizes.append(en-st)
  */
-      __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 312, __pyx_L1_error)
+      __pyx_t_5 = PyTuple_New(2); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 213, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
       __Pyx_INCREF(__pyx_v_ref_st);
       __Pyx_GIVEREF(__pyx_v_ref_st);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_v_ref_st)) __PYX_ERR(0, 312, __pyx_L1_error);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 0, __pyx_v_ref_st)) __PYX_ERR(0, 213, __pyx_L1_error);
       __Pyx_INCREF(__pyx_v_ref_en);
       __Pyx_GIVEREF(__pyx_v_ref_en);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_ref_en)) __PYX_ERR(0, 312, __pyx_L1_error);
-      __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 312, __pyx_L1_error)
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_5, 1, __pyx_v_ref_en)) __PYX_ERR(0, 213, __pyx_L1_error);
+      __pyx_t_1 = __Pyx_PyObject_Call(__pyx_builtin_range, __pyx_t_5, NULL); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 213, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_1);
       __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
-      __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_deletion_positions, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 312, __pyx_L1_error)
+      __pyx_t_7 = __Pyx_PyList_Extend(__pyx_v_deletion_positions, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 213, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":313
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":214
  *         if(len(inc_del_pos)>0):
  *           deletion_positions.extend(range(ref_st,ref_en))
  *           deletion_coordinates.append((ref_st,ref_en))             # <<<<<<<<<<<<<<
  *           deletion_sizes.append(en-st)
  * 
  */
-      __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 313, __pyx_L1_error)
+      __pyx_t_1 = PyTuple_New(2); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 214, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_1);
       __Pyx_INCREF(__pyx_v_ref_st);
       __Pyx_GIVEREF(__pyx_v_ref_st);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_v_ref_st)) __PYX_ERR(0, 313, __pyx_L1_error);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 0, __pyx_v_ref_st)) __PYX_ERR(0, 214, __pyx_L1_error);
       __Pyx_INCREF(__pyx_v_ref_en);
       __Pyx_GIVEREF(__pyx_v_ref_en);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_ref_en)) __PYX_ERR(0, 313, __pyx_L1_error);
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_coordinates, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 313, __pyx_L1_error)
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_1, 1, __pyx_v_ref_en)) __PYX_ERR(0, 214, __pyx_L1_error);
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_coordinates, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 214, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":314
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":215
  *           deletion_positions.extend(range(ref_st,ref_en))
  *           deletion_coordinates.append((ref_st,ref_en))
  *           deletion_sizes.append(en-st)             # <<<<<<<<<<<<<<
  * 
  *     deletion_n = np.sum(deletion_sizes)
  */
-      __pyx_t_1 = __Pyx_PyInt_From_int((__pyx_v_en - __pyx_v_st)); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 314, __pyx_L1_error)
+      __pyx_t_1 = __Pyx_PyInt_From_int((__pyx_v_en - __pyx_v_st)); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 215, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_1);
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_sizes, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 314, __pyx_L1_error)
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_deletion_sizes, __pyx_t_1); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 215, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":311
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":212
  *         all_deletion_positions.extend(range(ref_st,ref_en))
  *         inc_del_pos = include_indx_set.intersection(range(ref_st,ref_en))
  *         if(len(inc_del_pos)>0):             # <<<<<<<<<<<<<<
@@ -8460,7 +7594,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":301
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":202
  * 
  *     include_indx_set = set(_include_indx)
  *     for p in re_find_indels.finditer(read_seq_al):             # <<<<<<<<<<<<<<
@@ -8470,16 +7604,16 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   }
   __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":316
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":217
  *           deletion_sizes.append(en-st)
  * 
  *     deletion_n = np.sum(deletion_sizes)             # <<<<<<<<<<<<<<
  * 
  *     for p in re_find_indels.finditer(ref_seq_al):
  */
-  __Pyx_GetModuleGlobalName(__pyx_t_1, __pyx_n_s_np); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 316, __pyx_L1_error)
+  __Pyx_GetModuleGlobalName(__pyx_t_1, __pyx_n_s_np); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 217, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
-  __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_t_1, __pyx_n_s_sum); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 316, __pyx_L1_error)
+  __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_t_1, __pyx_n_s_sum); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 217, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_5);
   __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
   __pyx_t_1 = NULL;
@@ -8500,23 +7634,23 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     PyObject *__pyx_callargs[2] = {__pyx_t_1, __pyx_v_deletion_sizes};
     __pyx_t_8 = __Pyx_PyObject_FastCall(__pyx_t_5, __pyx_callargs+1-__pyx_t_13, 1+__pyx_t_13);
     __Pyx_XDECREF(__pyx_t_1); __pyx_t_1 = 0;
-    if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 316, __pyx_L1_error)
+    if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 217, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_8);
     __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
   }
   __pyx_v_deletion_n = __pyx_t_8;
   __pyx_t_8 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":318
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":219
  *     deletion_n = np.sum(deletion_sizes)
  * 
  *     for p in re_find_indels.finditer(ref_seq_al):             # <<<<<<<<<<<<<<
  *         st,en=p.span()
  *         #sometimes insertions run off the end of the reference
  */
-  __Pyx_GetModuleGlobalName(__pyx_t_5, __pyx_n_s_re_find_indels); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 318, __pyx_L1_error)
+  __Pyx_GetModuleGlobalName(__pyx_t_5, __pyx_n_s_re_find_indels); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 219, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_5);
-  __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_t_5, __pyx_n_s_finditer); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 318, __pyx_L1_error)
+  __pyx_t_1 = __Pyx_PyObject_GetAttrStr(__pyx_t_5, __pyx_n_s_finditer); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 219, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
   __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
   __pyx_t_5 = NULL;
@@ -8537,7 +7671,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     PyObject *__pyx_callargs[2] = {__pyx_t_5, __pyx_v_ref_seq_al};
     __pyx_t_8 = __Pyx_PyObject_FastCall(__pyx_t_1, __pyx_callargs+1-__pyx_t_13, 1+__pyx_t_13);
     __Pyx_XDECREF(__pyx_t_5); __pyx_t_5 = 0;
-    if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 318, __pyx_L1_error)
+    if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 219, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_8);
     __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
   }
@@ -8546,9 +7680,9 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __pyx_t_3 = 0;
     __pyx_t_4 = NULL;
   } else {
-    __pyx_t_3 = -1; __pyx_t_1 = PyObject_GetIter(__pyx_t_8); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 318, __pyx_L1_error)
+    __pyx_t_3 = -1; __pyx_t_1 = PyObject_GetIter(__pyx_t_8); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 219, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
-    __pyx_t_4 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_1); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 318, __pyx_L1_error)
+    __pyx_t_4 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_1); if (unlikely(!__pyx_t_4)) __PYX_ERR(0, 219, __pyx_L1_error)
   }
   __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
   for (;;) {
@@ -8557,28 +7691,28 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
         {
           Py_ssize_t __pyx_temp = __Pyx_PyList_GET_SIZE(__pyx_t_1);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 318, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 219, __pyx_L1_error)
           #endif
           if (__pyx_t_3 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
-        __pyx_t_8 = PyList_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_8); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 318, __pyx_L1_error)
+        __pyx_t_8 = PyList_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_8); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 219, __pyx_L1_error)
         #else
-        __pyx_t_8 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 318, __pyx_L1_error)
+        __pyx_t_8 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 219, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_8);
         #endif
       } else {
         {
           Py_ssize_t __pyx_temp = __Pyx_PyTuple_GET_SIZE(__pyx_t_1);
           #if !CYTHON_ASSUME_SAFE_MACROS
-          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 318, __pyx_L1_error)
+          if (unlikely((__pyx_temp < 0))) __PYX_ERR(0, 219, __pyx_L1_error)
           #endif
           if (__pyx_t_3 >= __pyx_temp) break;
         }
         #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
-        __pyx_t_8 = PyTuple_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_8); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 318, __pyx_L1_error)
+        __pyx_t_8 = PyTuple_GET_ITEM(__pyx_t_1, __pyx_t_3); __Pyx_INCREF(__pyx_t_8); __pyx_t_3++; if (unlikely((0 < 0))) __PYX_ERR(0, 219, __pyx_L1_error)
         #else
-        __pyx_t_8 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 318, __pyx_L1_error)
+        __pyx_t_8 = __Pyx_PySequence_ITEM(__pyx_t_1, __pyx_t_3); __pyx_t_3++; if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 219, __pyx_L1_error)
         __Pyx_GOTREF(__pyx_t_8);
         #endif
       }
@@ -8588,7 +7722,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
         PyObject* exc_type = PyErr_Occurred();
         if (exc_type) {
           if (likely(__Pyx_PyErr_GivenExceptionMatches(exc_type, PyExc_StopIteration))) PyErr_Clear();
-          else __PYX_ERR(0, 318, __pyx_L1_error)
+          else __PYX_ERR(0, 219, __pyx_L1_error)
         }
         break;
       }
@@ -8597,14 +7731,14 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __Pyx_XDECREF_SET(__pyx_v_p, __pyx_t_8);
     __pyx_t_8 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":319
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":220
  * 
  *     for p in re_find_indels.finditer(ref_seq_al):
  *         st,en=p.span()             # <<<<<<<<<<<<<<
  *         #sometimes insertions run off the end of the reference
  *         if st == 0: # if insertion happened before ref
  */
-    __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_p, __pyx_n_s_span); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 319, __pyx_L1_error)
+    __pyx_t_5 = __Pyx_PyObject_GetAttrStr(__pyx_v_p, __pyx_n_s_span); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 220, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_5);
     __pyx_t_9 = NULL;
     __pyx_t_13 = 0;
@@ -8624,7 +7758,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       PyObject *__pyx_callargs[2] = {__pyx_t_9, NULL};
       __pyx_t_8 = __Pyx_PyObject_FastCall(__pyx_t_5, __pyx_callargs+1-__pyx_t_13, 0+__pyx_t_13);
       __Pyx_XDECREF(__pyx_t_9); __pyx_t_9 = 0;
-      if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 319, __pyx_L1_error)
+      if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 220, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_8);
       __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
     }
@@ -8634,7 +7768,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       if (unlikely(size != 2)) {
         if (size > 2) __Pyx_RaiseTooManyValuesError(2);
         else if (size >= 0) __Pyx_RaiseNeedMoreValuesError(size);
-        __PYX_ERR(0, 319, __pyx_L1_error)
+        __PYX_ERR(0, 220, __pyx_L1_error)
       }
       #if CYTHON_ASSUME_SAFE_MACROS && !CYTHON_AVOID_BORROWED_REFS
       if (likely(PyTuple_CheckExact(sequence))) {
@@ -8647,15 +7781,15 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_INCREF(__pyx_t_5);
       __Pyx_INCREF(__pyx_t_9);
       #else
-      __pyx_t_5 = PySequence_ITEM(sequence, 0); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 319, __pyx_L1_error)
+      __pyx_t_5 = PySequence_ITEM(sequence, 0); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 220, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_5);
-      __pyx_t_9 = PySequence_ITEM(sequence, 1); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 319, __pyx_L1_error)
+      __pyx_t_9 = PySequence_ITEM(sequence, 1); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 220, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_9);
       #endif
       __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
     } else {
       Py_ssize_t index = -1;
-      __pyx_t_11 = PyObject_GetIter(__pyx_t_8); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 319, __pyx_L1_error)
+      __pyx_t_11 = PyObject_GetIter(__pyx_t_8); if (unlikely(!__pyx_t_11)) __PYX_ERR(0, 220, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_11);
       __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
       __pyx_t_12 = __Pyx_PyObject_GetIterNextFunc(__pyx_t_11);
@@ -8663,7 +7797,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_GOTREF(__pyx_t_5);
       index = 1; __pyx_t_9 = __pyx_t_12(__pyx_t_11); if (unlikely(!__pyx_t_9)) goto __pyx_L23_unpacking_failed;
       __Pyx_GOTREF(__pyx_t_9);
-      if (__Pyx_IternextUnpackEndCheck(__pyx_t_12(__pyx_t_11), 2) < 0) __PYX_ERR(0, 319, __pyx_L1_error)
+      if (__Pyx_IternextUnpackEndCheck(__pyx_t_12(__pyx_t_11), 2) < 0) __PYX_ERR(0, 220, __pyx_L1_error)
       __pyx_t_12 = NULL;
       __Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
       goto __pyx_L24_unpacking_done;
@@ -8671,17 +7805,17 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
       __Pyx_DECREF(__pyx_t_11); __pyx_t_11 = 0;
       __pyx_t_12 = NULL;
       if (__Pyx_IterFinish() == 0) __Pyx_RaiseNeedMoreValuesError(index);
-      __PYX_ERR(0, 319, __pyx_L1_error)
+      __PYX_ERR(0, 220, __pyx_L1_error)
       __pyx_L24_unpacking_done:;
     }
-    __pyx_t_13 = __Pyx_PyInt_As_int(__pyx_t_5); if (unlikely((__pyx_t_13 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 319, __pyx_L1_error)
+    __pyx_t_13 = __Pyx_PyInt_As_int(__pyx_t_5); if (unlikely((__pyx_t_13 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 220, __pyx_L1_error)
     __Pyx_DECREF(__pyx_t_5); __pyx_t_5 = 0;
-    __pyx_t_2 = __Pyx_PyInt_As_int(__pyx_t_9); if (unlikely((__pyx_t_2 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 319, __pyx_L1_error)
+    __pyx_t_2 = __Pyx_PyInt_As_int(__pyx_t_9); if (unlikely((__pyx_t_2 == (int)-1) && PyErr_Occurred())) __PYX_ERR(0, 220, __pyx_L1_error)
     __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
     __pyx_v_st = __pyx_t_13;
     __pyx_v_en = __pyx_t_2;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":321
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":222
  *         st,en=p.span()
  *         #sometimes insertions run off the end of the reference
  *         if st == 0: # if insertion happened before ref             # <<<<<<<<<<<<<<
@@ -8691,7 +7825,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __pyx_t_6 = (__pyx_v_st == 0);
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":322
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":223
  *         #sometimes insertions run off the end of the reference
  *         if st == 0: # if insertion happened before ref
  *           continue             # <<<<<<<<<<<<<<
@@ -8700,7 +7834,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
       goto __pyx_L21_continue;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":321
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":222
  *         st,en=p.span()
  *         #sometimes insertions run off the end of the reference
  *         if st == 0: # if insertion happened before ref             # <<<<<<<<<<<<<<
@@ -8709,18 +7843,18 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":323
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":224
  *         if st == 0: # if insertion happened before ref
  *           continue
  *         if en == len(ref_seq_al): # if insertion happened after ref             # <<<<<<<<<<<<<<
  *           continue
  *         ref_st = ref_positions[st-1]
  */
-    __pyx_t_14 = PyObject_Length(__pyx_v_ref_seq_al); if (unlikely(__pyx_t_14 == ((Py_ssize_t)-1))) __PYX_ERR(0, 323, __pyx_L1_error)
+    __pyx_t_14 = PyObject_Length(__pyx_v_ref_seq_al); if (unlikely(__pyx_t_14 == ((Py_ssize_t)-1))) __PYX_ERR(0, 224, __pyx_L1_error)
     __pyx_t_6 = (__pyx_v_en == __pyx_t_14);
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":324
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":225
  *           continue
  *         if en == len(ref_seq_al): # if insertion happened after ref
  *           continue             # <<<<<<<<<<<<<<
@@ -8729,7 +7863,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
       goto __pyx_L21_continue;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":323
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":224
  *         if st == 0: # if insertion happened before ref
  *           continue
  *         if en == len(ref_seq_al): # if insertion happened after ref             # <<<<<<<<<<<<<<
@@ -8738,7 +7872,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":325
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":226
  *         if en == len(ref_seq_al): # if insertion happened after ref
  *           continue
  *         ref_st = ref_positions[st-1]             # <<<<<<<<<<<<<<
@@ -8751,7 +7885,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __Pyx_XDECREF_SET(__pyx_v_ref_st, __pyx_t_8);
     __pyx_t_8 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":326
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":227
  *           continue
  *         ref_st = ref_positions[st-1]
  *         ref_en = ref_positions[en]             # <<<<<<<<<<<<<<
@@ -8763,100 +7897,100 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     __Pyx_XDECREF_SET(__pyx_v_ref_en, __pyx_t_8);
     __pyx_t_8 = 0;
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":328
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":229
  *         ref_en = ref_positions[en]
  * 
  *         all_insertion_left_positions.append(ref_st)             # <<<<<<<<<<<<<<
  *         all_insertion_positions.append(ref_st)
  *         all_insertion_positions.append(ref_en)
  */
-    __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_insertion_left_positions, __pyx_v_ref_st); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 328, __pyx_L1_error)
+    __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_insertion_left_positions, __pyx_v_ref_st); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 229, __pyx_L1_error)
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":329
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":230
  * 
  *         all_insertion_left_positions.append(ref_st)
  *         all_insertion_positions.append(ref_st)             # <<<<<<<<<<<<<<
  *         all_insertion_positions.append(ref_en)
  *         if(ref_st in _include_indx or ref_en in _include_indx):
  */
-    __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_insertion_positions, __pyx_v_ref_st); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 329, __pyx_L1_error)
+    __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_insertion_positions, __pyx_v_ref_st); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 230, __pyx_L1_error)
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":330
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":231
  *         all_insertion_left_positions.append(ref_st)
  *         all_insertion_positions.append(ref_st)
  *         all_insertion_positions.append(ref_en)             # <<<<<<<<<<<<<<
  *         if(ref_st in _include_indx or ref_en in _include_indx):
  *           insertion_coordinates.append((ref_st,ref_en))
  */
-    __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_insertion_positions, __pyx_v_ref_en); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 330, __pyx_L1_error)
+    __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_all_insertion_positions, __pyx_v_ref_en); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 231, __pyx_L1_error)
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":331
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":232
  *         all_insertion_positions.append(ref_st)
  *         all_insertion_positions.append(ref_en)
  *         if(ref_st in _include_indx or ref_en in _include_indx):             # <<<<<<<<<<<<<<
  *           insertion_coordinates.append((ref_st,ref_en))
  *           insertion_positions.append(ref_st)
  */
-    __pyx_t_10 = (__Pyx_PySequence_ContainsTF(__pyx_v_ref_st, __pyx_v__include_indx, Py_EQ)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 331, __pyx_L1_error)
+    __pyx_t_10 = (__Pyx_PySequence_ContainsTF(__pyx_v_ref_st, __pyx_v__include_indx, Py_EQ)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 232, __pyx_L1_error)
     if (!__pyx_t_10) {
     } else {
       __pyx_t_6 = __pyx_t_10;
       goto __pyx_L28_bool_binop_done;
     }
-    __pyx_t_10 = (__Pyx_PySequence_ContainsTF(__pyx_v_ref_en, __pyx_v__include_indx, Py_EQ)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 331, __pyx_L1_error)
+    __pyx_t_10 = (__Pyx_PySequence_ContainsTF(__pyx_v_ref_en, __pyx_v__include_indx, Py_EQ)); if (unlikely((__pyx_t_10 < 0))) __PYX_ERR(0, 232, __pyx_L1_error)
     __pyx_t_6 = __pyx_t_10;
     __pyx_L28_bool_binop_done:;
     if (__pyx_t_6) {
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":332
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":233
  *         all_insertion_positions.append(ref_en)
  *         if(ref_st in _include_indx or ref_en in _include_indx):
  *           insertion_coordinates.append((ref_st,ref_en))             # <<<<<<<<<<<<<<
  *           insertion_positions.append(ref_st)
  *           insertion_positions.append(ref_en)
  */
-      __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 332, __pyx_L1_error)
+      __pyx_t_8 = PyTuple_New(2); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 233, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_8);
       __Pyx_INCREF(__pyx_v_ref_st);
       __Pyx_GIVEREF(__pyx_v_ref_st);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_v_ref_st)) __PYX_ERR(0, 332, __pyx_L1_error);
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 0, __pyx_v_ref_st)) __PYX_ERR(0, 233, __pyx_L1_error);
       __Pyx_INCREF(__pyx_v_ref_en);
       __Pyx_GIVEREF(__pyx_v_ref_en);
-      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_ref_en)) __PYX_ERR(0, 332, __pyx_L1_error);
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_coordinates, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 332, __pyx_L1_error)
+      if (__Pyx_PyTuple_SET_ITEM(__pyx_t_8, 1, __pyx_v_ref_en)) __PYX_ERR(0, 233, __pyx_L1_error);
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_coordinates, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 233, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":333
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":234
  *         if(ref_st in _include_indx or ref_en in _include_indx):
  *           insertion_coordinates.append((ref_st,ref_en))
  *           insertion_positions.append(ref_st)             # <<<<<<<<<<<<<<
  *           insertion_positions.append(ref_en)
  *           insertion_sizes.append(en-st)
  */
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_positions, __pyx_v_ref_st); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 333, __pyx_L1_error)
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_positions, __pyx_v_ref_st); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 234, __pyx_L1_error)
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":334
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":235
  *           insertion_coordinates.append((ref_st,ref_en))
  *           insertion_positions.append(ref_st)
  *           insertion_positions.append(ref_en)             # <<<<<<<<<<<<<<
  *           insertion_sizes.append(en-st)
  * 
  */
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_positions, __pyx_v_ref_en); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 334, __pyx_L1_error)
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_positions, __pyx_v_ref_en); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 235, __pyx_L1_error)
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":335
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":236
  *           insertion_positions.append(ref_st)
  *           insertion_positions.append(ref_en)
  *           insertion_sizes.append(en-st)             # <<<<<<<<<<<<<<
  * 
  *     insertion_n = np.sum(insertion_sizes)
  */
-      __pyx_t_8 = __Pyx_PyInt_From_int((__pyx_v_en - __pyx_v_st)); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 335, __pyx_L1_error)
+      __pyx_t_8 = __Pyx_PyInt_From_int((__pyx_v_en - __pyx_v_st)); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 236, __pyx_L1_error)
       __Pyx_GOTREF(__pyx_t_8);
-      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_sizes, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 335, __pyx_L1_error)
+      __pyx_t_7 = __Pyx_PyList_Append(__pyx_v_insertion_sizes, __pyx_t_8); if (unlikely(__pyx_t_7 == ((int)-1))) __PYX_ERR(0, 236, __pyx_L1_error)
       __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
 
-      /* "CRISPResso2/CRISPRessoCOREResources.pyx":331
+      /* "CRISPResso2/CRISPRessoCOREResources.pyx":232
  *         all_insertion_positions.append(ref_st)
  *         all_insertion_positions.append(ref_en)
  *         if(ref_st in _include_indx or ref_en in _include_indx):             # <<<<<<<<<<<<<<
@@ -8865,7 +7999,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
  */
     }
 
-    /* "CRISPResso2/CRISPRessoCOREResources.pyx":318
+    /* "CRISPResso2/CRISPRessoCOREResources.pyx":219
  *     deletion_n = np.sum(deletion_sizes)
  * 
  *     for p in re_find_indels.finditer(ref_seq_al):             # <<<<<<<<<<<<<<
@@ -8876,16 +8010,16 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   }
   __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":337
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":238
  *           insertion_sizes.append(en-st)
  * 
  *     insertion_n = np.sum(insertion_sizes)             # <<<<<<<<<<<<<<
  * 
- * 
+ *     retDict = {
  */
-  __Pyx_GetModuleGlobalName(__pyx_t_8, __pyx_n_s_np); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 337, __pyx_L1_error)
+  __Pyx_GetModuleGlobalName(__pyx_t_8, __pyx_n_s_np); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 238, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_8);
-  __pyx_t_9 = __Pyx_PyObject_GetAttrStr(__pyx_t_8, __pyx_n_s_sum); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 337, __pyx_L1_error)
+  __pyx_t_9 = __Pyx_PyObject_GetAttrStr(__pyx_t_8, __pyx_n_s_sum); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 238, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_9);
   __Pyx_DECREF(__pyx_t_8); __pyx_t_8 = 0;
   __pyx_t_8 = NULL;
@@ -8906,7 +8040,7 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
     PyObject *__pyx_callargs[2] = {__pyx_t_8, __pyx_v_insertion_sizes};
     __pyx_t_1 = __Pyx_PyObject_FastCall(__pyx_t_9, __pyx_callargs+1-__pyx_t_2, 1+__pyx_t_2);
     __Pyx_XDECREF(__pyx_t_8); __pyx_t_8 = 0;
-    if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 337, __pyx_L1_error)
+    if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 238, __pyx_L1_error)
     __Pyx_GOTREF(__pyx_t_1);
     __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
   }
@@ -8916,9 +8050,9 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   /* "CRISPResso2/CRISPRessoCOREResources.pyx":341
  * 
  *     retDict = {
- * 	    'all_insertion_positions':all_insertion_positions,             # <<<<<<<<<<<<<<
- * 	    'all_insertion_left_positions':all_insertion_left_positions,
- * 	    'insertion_positions':insertion_positions,
+ *         'all_insertion_positions':all_insertion_positions,             # <<<<<<<<<<<<<<
+ *         'all_insertion_left_positions':all_insertion_left_positions,
+ *         'insertion_positions':insertion_positions,
  */
   __pyx_t_1 = __Pyx_PyDict_NewPresized(17); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 341, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
@@ -8926,118 +8060,118 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
 
   /* "CRISPResso2/CRISPRessoCOREResources.pyx":342
  *     retDict = {
- * 	    'all_insertion_positions':all_insertion_positions,
- * 	    'all_insertion_left_positions':all_insertion_left_positions,             # <<<<<<<<<<<<<<
- * 	    'insertion_positions':insertion_positions,
- * 	    'insertion_coordinates':insertion_coordinates,
+ *         'all_insertion_positions':all_insertion_positions,
+ *         'all_insertion_left_positions':all_insertion_left_positions,             # <<<<<<<<<<<<<<
+ *         'insertion_positions':insertion_positions,
+ *         'insertion_coordinates':insertion_coordinates,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_insertion_left_positions, __pyx_v_all_insertion_left_positions) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":343
- * 	    'all_insertion_positions':all_insertion_positions,
- * 	    'all_insertion_left_positions':all_insertion_left_positions,
- * 	    'insertion_positions':insertion_positions,             # <<<<<<<<<<<<<<
- * 	    'insertion_coordinates':insertion_coordinates,
- * 	    'insertion_sizes':insertion_sizes,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":243
+ *         'all_insertion_positions':all_insertion_positions,
+ *         'all_insertion_left_positions':all_insertion_left_positions,
+ *         'insertion_positions':insertion_positions,             # <<<<<<<<<<<<<<
+ *         'insertion_coordinates':insertion_coordinates,
+ *         'insertion_sizes':insertion_sizes,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_positions, __pyx_v_insertion_positions) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":344
- * 	    'all_insertion_left_positions':all_insertion_left_positions,
- * 	    'insertion_positions':insertion_positions,
- * 	    'insertion_coordinates':insertion_coordinates,             # <<<<<<<<<<<<<<
- * 	    'insertion_sizes':insertion_sizes,
- * 	    'insertion_n':insertion_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":244
+ *         'all_insertion_left_positions':all_insertion_left_positions,
+ *         'insertion_positions':insertion_positions,
+ *         'insertion_coordinates':insertion_coordinates,             # <<<<<<<<<<<<<<
+ *         'insertion_sizes':insertion_sizes,
+ *         'insertion_n':insertion_n,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_coordinates, __pyx_v_insertion_coordinates) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":345
- * 	    'insertion_positions':insertion_positions,
- * 	    'insertion_coordinates':insertion_coordinates,
- * 	    'insertion_sizes':insertion_sizes,             # <<<<<<<<<<<<<<
- * 	    'insertion_n':insertion_n,
- * 
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":245
+ *         'insertion_positions':insertion_positions,
+ *         'insertion_coordinates':insertion_coordinates,
+ *         'insertion_sizes':insertion_sizes,             # <<<<<<<<<<<<<<
+ *         'insertion_n':insertion_n,
+ *         'all_deletion_positions':all_deletion_positions,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_sizes, __pyx_v_insertion_sizes) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":346
- * 	    'insertion_coordinates':insertion_coordinates,
- * 	    'insertion_sizes':insertion_sizes,
- * 	    'insertion_n':insertion_n,             # <<<<<<<<<<<<<<
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":246
+ *         'insertion_coordinates':insertion_coordinates,
+ *         'insertion_sizes':insertion_sizes,
+ *         'insertion_n':insertion_n,             # <<<<<<<<<<<<<<
+ *         'all_deletion_positions':all_deletion_positions,
  * 
- * 	    'all_deletion_positions':all_deletion_positions,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_insertion_n, __pyx_v_insertion_n) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":348
- * 	    'insertion_n':insertion_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":247
+ *         'insertion_sizes':insertion_sizes,
+ *         'insertion_n':insertion_n,
+ *         'all_deletion_positions':all_deletion_positions,             # <<<<<<<<<<<<<<
  * 
- * 	    'all_deletion_positions':all_deletion_positions,             # <<<<<<<<<<<<<<
- * 	    'deletion_positions':deletion_positions,
- * 	    'deletion_coordinates':deletion_coordinates,
+ *         'deletion_positions':deletion_positions,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_deletion_positions, __pyx_v_all_deletion_positions) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":349
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":249
+ *         'all_deletion_positions':all_deletion_positions,
  * 
- * 	    'all_deletion_positions':all_deletion_positions,
- * 	    'deletion_positions':deletion_positions,             # <<<<<<<<<<<<<<
- * 	    'deletion_coordinates':deletion_coordinates,
- * 	    'deletion_sizes':deletion_sizes,
+ *         'deletion_positions':deletion_positions,             # <<<<<<<<<<<<<<
+ *         'deletion_coordinates':deletion_coordinates,
+ *         'deletion_sizes':deletion_sizes,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_positions, __pyx_v_deletion_positions) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":350
- * 	    'all_deletion_positions':all_deletion_positions,
- * 	    'deletion_positions':deletion_positions,
- * 	    'deletion_coordinates':deletion_coordinates,             # <<<<<<<<<<<<<<
- * 	    'deletion_sizes':deletion_sizes,
- * 	    'deletion_n':deletion_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":250
+ * 
+ *         'deletion_positions':deletion_positions,
+ *         'deletion_coordinates':deletion_coordinates,             # <<<<<<<<<<<<<<
+ *         'deletion_sizes':deletion_sizes,
+ *         'deletion_n':deletion_n,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_coordinates, __pyx_v_deletion_coordinates) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":351
- * 	    'deletion_positions':deletion_positions,
- * 	    'deletion_coordinates':deletion_coordinates,
- * 	    'deletion_sizes':deletion_sizes,             # <<<<<<<<<<<<<<
- * 	    'deletion_n':deletion_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":251
+ *         'deletion_positions':deletion_positions,
+ *         'deletion_coordinates':deletion_coordinates,
+ *         'deletion_sizes':deletion_sizes,             # <<<<<<<<<<<<<<
+ *         'deletion_n':deletion_n,
  * 
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_sizes, __pyx_v_deletion_sizes) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":352
- * 	    'deletion_coordinates':deletion_coordinates,
- * 	    'deletion_sizes':deletion_sizes,
- * 	    'deletion_n':deletion_n,             # <<<<<<<<<<<<<<
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":252
+ *         'deletion_coordinates':deletion_coordinates,
+ *         'deletion_sizes':deletion_sizes,
+ *         'deletion_n':deletion_n,             # <<<<<<<<<<<<<<
  * 
- * 	    'all_substitution_positions':all_substitution_positions,
+ *         'all_substitution_positions':all_substitution_positions,
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_deletion_n, __pyx_v_deletion_n) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":354
- * 	    'deletion_n':deletion_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":254
+ *         'deletion_n':deletion_n,
  * 
- * 	    'all_substitution_positions':all_substitution_positions,             # <<<<<<<<<<<<<<
- * 	    'substitution_positions':substitution_positions,
- * 	    'all_substitution_values':np.array(all_substitution_values),
+ *         'all_substitution_positions':all_substitution_positions,             # <<<<<<<<<<<<<<
+ *         'substitution_positions':substitution_positions,
+ *         'all_substitution_values':np.array(all_substitution_values),
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_substitution_positions, __pyx_v_all_substitution_positions) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
   /* "CRISPResso2/CRISPRessoCOREResources.pyx":355
  * 
- * 	    'all_substitution_positions':all_substitution_positions,
- * 	    'substitution_positions':substitution_positions,             # <<<<<<<<<<<<<<
- * 	    'all_substitution_values':np.array(all_substitution_values),
- * 	    'substitution_values':np.array(substitution_values),
+ *         'all_substitution_positions':all_substitution_positions,
+ *         'substitution_positions':substitution_positions,             # <<<<<<<<<<<<<<
+ *         'all_substitution_values':np.array(all_substitution_values),
+ *         'substitution_values':np.array(substitution_values),
  */
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_substitution_positions, __pyx_v_substitution_positions) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":356
- * 	    'all_substitution_positions':all_substitution_positions,
- * 	    'substitution_positions':substitution_positions,
- * 	    'all_substitution_values':np.array(all_substitution_values),             # <<<<<<<<<<<<<<
- * 	    'substitution_values':np.array(substitution_values),
- * 	    'substitution_n':substitution_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":256
+ *         'all_substitution_positions':all_substitution_positions,
+ *         'substitution_positions':substitution_positions,
+ *         'all_substitution_values':np.array(all_substitution_values),             # <<<<<<<<<<<<<<
+ *         'substitution_values':np.array(substitution_values),
+ *         'substitution_n':substitution_n,
  */
   __Pyx_GetModuleGlobalName(__pyx_t_8, __pyx_n_s_np); if (unlikely(!__pyx_t_8)) __PYX_ERR(0, 356, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_8);
@@ -9069,11 +8203,11 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_all_substitution_values, __pyx_t_9) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
   __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":357
- * 	    'substitution_positions':substitution_positions,
- * 	    'all_substitution_values':np.array(all_substitution_values),
- * 	    'substitution_values':np.array(substitution_values),             # <<<<<<<<<<<<<<
- * 	    'substitution_n':substitution_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":257
+ *         'substitution_positions':substitution_positions,
+ *         'all_substitution_values':np.array(all_substitution_values),
+ *         'substitution_values':np.array(substitution_values),             # <<<<<<<<<<<<<<
+ *         'substitution_n':substitution_n,
  * 
  */
   __Pyx_GetModuleGlobalName(__pyx_t_5, __pyx_n_s_np); if (unlikely(!__pyx_t_5)) __PYX_ERR(0, 357, __pyx_L1_error)
@@ -9106,22 +8240,22 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_substitution_values, __pyx_t_9) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
   __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":358
- * 	    'all_substitution_values':np.array(all_substitution_values),
- * 	    'substitution_values':np.array(substitution_values),
- * 	    'substitution_n':substitution_n,             # <<<<<<<<<<<<<<
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":258
+ *         'all_substitution_values':np.array(all_substitution_values),
+ *         'substitution_values':np.array(substitution_values),
+ *         'substitution_n':substitution_n,             # <<<<<<<<<<<<<<
  * 
- * 	    'ref_positions':ref_positions,
+ *         'ref_positions':ref_positions,
  */
   __pyx_t_9 = PyInt_FromSsize_t(__pyx_v_substitution_n); if (unlikely(!__pyx_t_9)) __PYX_ERR(0, 358, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_9);
   if (PyDict_SetItem(__pyx_t_1, __pyx_n_u_substitution_n, __pyx_t_9) < 0) __PYX_ERR(0, 341, __pyx_L1_error)
   __Pyx_DECREF(__pyx_t_9); __pyx_t_9 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":360
- * 	    'substitution_n':substitution_n,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":260
+ *         'substitution_n':substitution_n,
  * 
- * 	    'ref_positions':ref_positions,             # <<<<<<<<<<<<<<
+ *         'ref_positions':ref_positions,             # <<<<<<<<<<<<<<
  *     }
  *     return retDict
  */
@@ -9129,8 +8263,8 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   __pyx_v_retDict = ((PyObject*)__pyx_t_1);
   __pyx_t_1 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":362
- * 	    'ref_positions':ref_positions,
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":262
+ *         'ref_positions':ref_positions,
  *     }
  *     return retDict             # <<<<<<<<<<<<<<
  * 
@@ -9141,9 +8275,9 @@ static PyObject *__pyx_pf_11CRISPResso2_23CRISPRessoCOREResources_2find_indels_s
   __pyx_r = __pyx_v_retDict;
   goto __pyx_L0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":238
- * 
- * 
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":138
+ *         'ref_positions': ref_positions,
+ *     }
  * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
  * @cython.nonecheck(False)
  * @cython.wraparound(False)
@@ -9252,7 +8386,7 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
           (void)__Pyx_Arg_NewRef_FASTCALL(values[0]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 365, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 265, __pyx_L3_error)
         else goto __pyx_L5_argtuple_error;
         CYTHON_FALLTHROUGH;
         case  1:
@@ -9260,7 +8394,7 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
           (void)__Pyx_Arg_NewRef_FASTCALL(values[1]);
           kw_args--;
         }
-        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 365, __pyx_L3_error)
+        else if (unlikely(PyErr_Occurred())) __PYX_ERR(0, 265, __pyx_L3_error)
         else {
           __Pyx_RaiseArgtupleInvalid("calculate_homology", 1, 2, 2, 1); __PYX_ERR(0, 365, __pyx_L3_error)
         }
@@ -9280,7 +8414,7 @@ PyObject *__pyx_args, PyObject *__pyx_kwds
   }
   goto __pyx_L6_skip;
   __pyx_L5_argtuple_error:;
-  __Pyx_RaiseArgtupleInvalid("calculate_homology", 1, 2, 2, __pyx_nargs); __PYX_ERR(0, 365, __pyx_L3_error)
+  __Pyx_RaiseArgtupleInvalid("calculate_homology", 1, 2, 2, __pyx_nargs); __PYX_ERR(0, 265, __pyx_L3_error)
   __pyx_L6_skip:;
   goto __pyx_L4_argument_unpacking_done;
   __pyx_L3_error:;
@@ -9473,6 +8607,8 @@ static int __Pyx_CreateStringTabAndInitStrings(void) {
     {&__pyx_n_s__4, __pyx_k__4, sizeof(__pyx_k__4), 0, 0, 1, 1},
     {&__pyx_n_s_a, __pyx_k_a, sizeof(__pyx_k_a), 0, 0, 1, 1},
     {&__pyx_n_s_al, __pyx_k_al, sizeof(__pyx_k_al), 0, 0, 1, 1},
+    {&__pyx_n_s_all_deletion_coordinates, __pyx_k_all_deletion_coordinates, sizeof(__pyx_k_all_deletion_coordinates), 0, 0, 1, 1},
+    {&__pyx_n_u_all_deletion_coordinates, __pyx_k_all_deletion_coordinates, sizeof(__pyx_k_all_deletion_coordinates), 0, 1, 0, 1},
     {&__pyx_n_s_all_deletion_positions, __pyx_k_all_deletion_positions, sizeof(__pyx_k_all_deletion_positions), 0, 0, 1, 1},
     {&__pyx_n_u_all_deletion_positions, __pyx_k_all_deletion_positions, sizeof(__pyx_k_all_deletion_positions), 0, 1, 0, 1},
     {&__pyx_n_s_all_insertion_left_positions, __pyx_k_all_insertion_left_positions, sizeof(__pyx_k_all_insertion_left_positions), 0, 0, 1, 1},
@@ -9593,9 +8729,9 @@ static int __Pyx_CreateStringTabAndInitStrings(void) {
 }
 /* #### Code section: cached_builtins ### */
 static CYTHON_SMALL_CODE int __Pyx_InitCachedBuiltins(void) {
-  __pyx_builtin_enumerate = __Pyx_GetBuiltinName(__pyx_n_s_enumerate); if (!__pyx_builtin_enumerate) __PYX_ERR(0, 135, __pyx_L1_error)
-  __pyx_builtin_range = __Pyx_GetBuiltinName(__pyx_n_s_range); if (!__pyx_builtin_range) __PYX_ERR(0, 172, __pyx_L1_error)
-  __pyx_builtin_sum = __Pyx_GetBuiltinName(__pyx_n_s_sum); if (!__pyx_builtin_sum) __PYX_ERR(0, 188, __pyx_L1_error)
+  __pyx_builtin_enumerate = __Pyx_GetBuiltinName(__pyx_n_s_enumerate); if (!__pyx_builtin_enumerate) __PYX_ERR(0, 58, __pyx_L1_error)
+  __pyx_builtin_range = __Pyx_GetBuiltinName(__pyx_n_s_range); if (!__pyx_builtin_range) __PYX_ERR(0, 95, __pyx_L1_error)
+  __pyx_builtin_sum = __Pyx_GetBuiltinName(__pyx_n_s_sum); if (!__pyx_builtin_sum) __PYX_ERR(0, 113, __pyx_L1_error)
   __pyx_builtin_ImportError = __Pyx_GetBuiltinName(__pyx_n_s_ImportError); if (!__pyx_builtin_ImportError) __PYX_ERR(1, 984, __pyx_L1_error)
   return 0;
   __pyx_L1_error:;
@@ -9607,7 +8743,7 @@ static CYTHON_SMALL_CODE int __Pyx_InitCachedConstants(void) {
   __Pyx_RefNannyDeclarations
   __Pyx_RefNannySetupContext("__Pyx_InitCachedConstants", 0);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":984
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":984
  *         __pyx_import_array()
  *     except Exception:
  *         raise ImportError("numpy.core.multiarray failed to import")             # <<<<<<<<<<<<<<
@@ -9618,7 +8754,7 @@ static CYTHON_SMALL_CODE int __Pyx_InitCachedConstants(void) {
   __Pyx_GOTREF(__pyx_tuple_);
   __Pyx_GIVEREF(__pyx_tuple_);
 
-  /* "../../../../opt/conda/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":990
+  /* "../../../mambaforge/envs/crispresso/lib/python3.10/site-packages/numpy/__init__.cython-30.pxd":990
  *         _import_umath()
  *     except Exception:
  *         raise ImportError("numpy.core.umath failed to import")             # <<<<<<<<<<<<<<
@@ -9629,79 +8765,32 @@ static CYTHON_SMALL_CODE int __Pyx_InitCachedConstants(void) {
   __Pyx_GOTREF(__pyx_tuple__2);
   __Pyx_GIVEREF(__pyx_tuple__2);
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":18
- * class ResultsSlotsDict():
- *     __slots__ = (
- *         'all_insertion_positions',             # <<<<<<<<<<<<<<
- *         'all_insertion_left_positions',
- *         'insertion_positions',
- */
-  __pyx_tuple__5 = PyTuple_Pack(23, __pyx_n_u_all_insertion_positions, __pyx_n_u_all_insertion_left_positions, __pyx_n_u_insertion_positions, __pyx_n_u_insertion_coordinates, __pyx_n_u_insertion_sizes, __pyx_n_u_insertion_n, __pyx_n_u_all_deletion_positions, __pyx_n_u_deletion_positions, __pyx_n_u_deletion_coordinates, __pyx_n_u_deletion_sizes, __pyx_n_u_deletion_n, __pyx_n_u_all_substitution_positions, __pyx_n_u_substitution_positions, __pyx_n_u_all_substitution_values, __pyx_n_u_substitution_values, __pyx_n_u_substitution_n, __pyx_n_u_ref_positions, __pyx_n_u_ref_name, __pyx_n_u_aln_scores, __pyx_n_u_classification, __pyx_n_u_aln_seq, __pyx_n_u_aln_ref, __pyx_n_u_aln_strand); if (unlikely(!__pyx_tuple__5)) __PYX_ERR(0, 18, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_tuple__5);
-  __Pyx_GIVEREF(__pyx_tuple__5);
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":43
- *     )
- * 
- *     def __init__(             # <<<<<<<<<<<<<<
- *         self,
- *         all_insertion_positions,
- */
-  __pyx_tuple__6 = PyTuple_Pack(18, __pyx_n_s_self, __pyx_n_s_all_insertion_positions, __pyx_n_s_all_insertion_left_positions, __pyx_n_s_insertion_positions, __pyx_n_s_insertion_coordinates, __pyx_n_s_insertion_sizes, __pyx_n_s_insertion_n, __pyx_n_s_all_deletion_positions, __pyx_n_s_deletion_positions, __pyx_n_s_deletion_coordinates, __pyx_n_s_deletion_sizes, __pyx_n_s_deletion_n, __pyx_n_s_all_substitution_positions, __pyx_n_s_substitution_positions, __pyx_n_s_all_substitution_values, __pyx_n_s_substitution_values, __pyx_n_s_substitution_n, __pyx_n_s_ref_positions); if (unlikely(!__pyx_tuple__6)) __PYX_ERR(0, 43, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_tuple__6);
-  __Pyx_GIVEREF(__pyx_tuple__6);
-  __pyx_codeobj__7 = (PyObject*)__Pyx_PyCode_New(18, 0, 0, 18, 0, CO_OPTIMIZED|CO_NEWLOCALS, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__6, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_CRISPResso2_CRISPRessoCOREResour_2, __pyx_n_s_init, 43, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__7)) __PYX_ERR(0, 43, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":87
- *         self.aln_strand = None
- * 
- *     def __getitem__(self, key):             # <<<<<<<<<<<<<<
- *         return getattr(self, key)
- * 
- */
-  __pyx_tuple__8 = PyTuple_Pack(2, __pyx_n_s_self, __pyx_n_s_key); if (unlikely(!__pyx_tuple__8)) __PYX_ERR(0, 87, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_tuple__8);
-  __Pyx_GIVEREF(__pyx_tuple__8);
-  __pyx_codeobj__9 = (PyObject*)__Pyx_PyCode_New(2, 0, 0, 2, 0, CO_OPTIMIZED|CO_NEWLOCALS, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__8, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_CRISPResso2_CRISPRessoCOREResour_2, __pyx_n_s_getitem, 87, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__9)) __PYX_ERR(0, 87, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":90
- *         return getattr(self, key)
- * 
- *     def __setitem__(self, key, value):             # <<<<<<<<<<<<<<
- *         setattr(self, key, value)
- * 
- */
-  __pyx_tuple__10 = PyTuple_Pack(3, __pyx_n_s_self, __pyx_n_s_key, __pyx_n_s_value); if (unlikely(!__pyx_tuple__10)) __PYX_ERR(0, 90, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_tuple__10);
-  __Pyx_GIVEREF(__pyx_tuple__10);
-  __pyx_codeobj__11 = (PyObject*)__Pyx_PyCode_New(3, 0, 0, 3, 0, CO_OPTIMIZED|CO_NEWLOCALS, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__10, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_CRISPResso2_CRISPRessoCOREResour_2, __pyx_n_s_setitem, 90, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__11)) __PYX_ERR(0, 90, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":94
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":16
  * 
  * 
  * re_find_indels = re.compile("(-*-)")             # <<<<<<<<<<<<<<
  * 
  * @cython.boundscheck(False)
  */
-  __pyx_tuple__13 = PyTuple_Pack(1, __pyx_kp_u__12); if (unlikely(!__pyx_tuple__13)) __PYX_ERR(0, 94, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_tuple__13);
-  __Pyx_GIVEREF(__pyx_tuple__13);
+  __pyx_tuple__6 = PyTuple_Pack(1, __pyx_kp_u__5); if (unlikely(!__pyx_tuple__6)) __PYX_ERR(0, 16, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_tuple__6);
+  __Pyx_GIVEREF(__pyx_tuple__6);
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":96
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":18
  * re_find_indels = re.compile("(-*-)")
  * 
  * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
  * @cython.nonecheck(False)
  * @cython.wraparound(False)
  */
-  __pyx_tuple__14 = PyTuple_Pack(30, __pyx_n_s_read_seq_al, __pyx_n_s_ref_seq_al, __pyx_n_s_include_indx, __pyx_n_s_ref_positions, __pyx_n_s_all_substitution_positions, __pyx_n_s_substitution_positions, __pyx_n_s_all_substitution_values, __pyx_n_s_substitution_values, __pyx_n_s_all_deletion_positions, __pyx_n_s_deletion_positions, __pyx_n_s_deletion_coordinates, __pyx_n_s_deletion_sizes, __pyx_n_s_start_deletion, __pyx_n_s_all_insertion_positions, __pyx_n_s_all_insertion_left_positions, __pyx_n_s_insertion_positions, __pyx_n_s_insertion_coordinates, __pyx_n_s_insertion_sizes, __pyx_n_s_start_insertion, __pyx_n_s_seq_len, __pyx_n_s_include_indx_set, __pyx_n_s_nucSet, __pyx_n_s_idx, __pyx_n_s_idx_c, __pyx_n_s_current_insertion_size, __pyx_n_s_c, __pyx_n_s_end_deletion, __pyx_n_s_substitution_n, __pyx_n_s_deletion_n, __pyx_n_s_insertion_n); if (unlikely(!__pyx_tuple__14)) __PYX_ERR(0, 96, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_tuple__14);
-  __Pyx_GIVEREF(__pyx_tuple__14);
-  __pyx_codeobj__15 = (PyObject*)__Pyx_PyCode_New(3, 0, 0, 30, 0, CO_OPTIMIZED|CO_NEWLOCALS, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__14, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_CRISPResso2_CRISPRessoCOREResour_2, __pyx_n_s_find_indels_substitutions, 96, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__15)) __PYX_ERR(0, 96, __pyx_L1_error)
+  __pyx_tuple__7 = PyTuple_Pack(31, __pyx_n_s_read_seq_al, __pyx_n_s_ref_seq_al, __pyx_n_s_include_indx, __pyx_n_s_ref_positions, __pyx_n_s_all_substitution_positions, __pyx_n_s_substitution_positions, __pyx_n_s_all_substitution_values, __pyx_n_s_substitution_values, __pyx_n_s_all_deletion_positions, __pyx_n_s_all_deletion_coordinates, __pyx_n_s_deletion_positions, __pyx_n_s_deletion_coordinates, __pyx_n_s_deletion_sizes, __pyx_n_s_start_deletion, __pyx_n_s_all_insertion_positions, __pyx_n_s_all_insertion_left_positions, __pyx_n_s_insertion_positions, __pyx_n_s_insertion_coordinates, __pyx_n_s_insertion_sizes, __pyx_n_s_start_insertion, __pyx_n_s_seq_len, __pyx_n_s_include_indx_set, __pyx_n_s_nucSet, __pyx_n_s_idx, __pyx_n_s_idx_c, __pyx_n_s_current_insertion_size, __pyx_n_s_c, __pyx_n_s_end_deletion, __pyx_n_s_substitution_n, __pyx_n_s_deletion_n, __pyx_n_s_insertion_n); if (unlikely(!__pyx_tuple__7)) __PYX_ERR(0, 18, __pyx_L1_error)
+  __Pyx_GOTREF(__pyx_tuple__7);
+  __Pyx_GIVEREF(__pyx_tuple__7);
+  __pyx_codeobj__8 = (PyObject*)__Pyx_PyCode_New(3, 0, 0, 31, 0, CO_OPTIMIZED|CO_NEWLOCALS, __pyx_empty_bytes, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_tuple__7, __pyx_empty_tuple, __pyx_empty_tuple, __pyx_kp_s_CRISPResso2_CRISPRessoCOREResour, __pyx_n_s_find_indels_substitutions, 18, __pyx_empty_bytes); if (unlikely(!__pyx_codeobj__8)) __PYX_ERR(0, 18, __pyx_L1_error)
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":238
- * 
- * 
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":138
+ *         'ref_positions': ref_positions,
+ *     }
  * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
  * @cython.nonecheck(False)
  * @cython.wraparound(False)
@@ -9818,33 +8907,33 @@ static int __Pyx_modinit_type_import_code(void) {
   /*--- Type import code ---*/
   __pyx_t_1 = PyImport_ImportModule(__Pyx_BUILTIN_MODULE_NAME); if (unlikely(!__pyx_t_1)) __PYX_ERR(2, 9, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
-  __pyx_ptype_7cpython_4type_type = __Pyx_ImportType_3_0_6(__pyx_t_1, __Pyx_BUILTIN_MODULE_NAME, "type", 
+  __pyx_ptype_7cpython_4type_type = __Pyx_ImportType_3_0_9(__pyx_t_1, __Pyx_BUILTIN_MODULE_NAME, "type", 
   #if defined(PYPY_VERSION_NUM) && PYPY_VERSION_NUM < 0x050B0000
-  sizeof(PyTypeObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyTypeObject),
+  sizeof(PyTypeObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyTypeObject),
   #elif CYTHON_COMPILING_IN_LIMITED_API
-  sizeof(PyTypeObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyTypeObject),
+  sizeof(PyTypeObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyTypeObject),
   #else
-  sizeof(PyHeapTypeObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyHeapTypeObject),
+  sizeof(PyHeapTypeObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyHeapTypeObject),
   #endif
-  __Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_7cpython_4type_type) __PYX_ERR(2, 9, __pyx_L1_error)
+  __Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_7cpython_4type_type) __PYX_ERR(2, 9, __pyx_L1_error)
   __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
   __pyx_t_1 = PyImport_ImportModule("numpy"); if (unlikely(!__pyx_t_1)) __PYX_ERR(1, 202, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_1);
-  __pyx_ptype_5numpy_dtype = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "dtype", sizeof(PyArray_Descr), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyArray_Descr),__Pyx_ImportType_CheckSize_Ignore_3_0_6); if (!__pyx_ptype_5numpy_dtype) __PYX_ERR(1, 202, __pyx_L1_error)
-  __pyx_ptype_5numpy_flatiter = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "flatiter", sizeof(PyArrayIterObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyArrayIterObject),__Pyx_ImportType_CheckSize_Ignore_3_0_6); if (!__pyx_ptype_5numpy_flatiter) __PYX_ERR(1, 225, __pyx_L1_error)
-  __pyx_ptype_5numpy_broadcast = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "broadcast", sizeof(PyArrayMultiIterObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyArrayMultiIterObject),__Pyx_ImportType_CheckSize_Ignore_3_0_6); if (!__pyx_ptype_5numpy_broadcast) __PYX_ERR(1, 229, __pyx_L1_error)
-  __pyx_ptype_5numpy_ndarray = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "ndarray", sizeof(PyArrayObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyArrayObject),__Pyx_ImportType_CheckSize_Ignore_3_0_6); if (!__pyx_ptype_5numpy_ndarray) __PYX_ERR(1, 238, __pyx_L1_error)
-  __pyx_ptype_5numpy_generic = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "generic", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_generic) __PYX_ERR(1, 809, __pyx_L1_error)
-  __pyx_ptype_5numpy_number = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "number", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_number) __PYX_ERR(1, 811, __pyx_L1_error)
-  __pyx_ptype_5numpy_integer = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "integer", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_integer) __PYX_ERR(1, 813, __pyx_L1_error)
-  __pyx_ptype_5numpy_signedinteger = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "signedinteger", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_signedinteger) __PYX_ERR(1, 815, __pyx_L1_error)
-  __pyx_ptype_5numpy_unsignedinteger = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "unsignedinteger", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_unsignedinteger) __PYX_ERR(1, 817, __pyx_L1_error)
-  __pyx_ptype_5numpy_inexact = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "inexact", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_inexact) __PYX_ERR(1, 819, __pyx_L1_error)
-  __pyx_ptype_5numpy_floating = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "floating", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_floating) __PYX_ERR(1, 821, __pyx_L1_error)
-  __pyx_ptype_5numpy_complexfloating = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "complexfloating", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_complexfloating) __PYX_ERR(1, 823, __pyx_L1_error)
-  __pyx_ptype_5numpy_flexible = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "flexible", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_flexible) __PYX_ERR(1, 825, __pyx_L1_error)
-  __pyx_ptype_5numpy_character = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "character", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_6); if (!__pyx_ptype_5numpy_character) __PYX_ERR(1, 827, __pyx_L1_error)
-  __pyx_ptype_5numpy_ufunc = __Pyx_ImportType_3_0_6(__pyx_t_1, "numpy", "ufunc", sizeof(PyUFuncObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_6(PyUFuncObject),__Pyx_ImportType_CheckSize_Ignore_3_0_6); if (!__pyx_ptype_5numpy_ufunc) __PYX_ERR(1, 866, __pyx_L1_error)
+  __pyx_ptype_5numpy_dtype = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "dtype", sizeof(PyArray_Descr), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyArray_Descr),__Pyx_ImportType_CheckSize_Ignore_3_0_9); if (!__pyx_ptype_5numpy_dtype) __PYX_ERR(1, 202, __pyx_L1_error)
+  __pyx_ptype_5numpy_flatiter = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "flatiter", sizeof(PyArrayIterObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyArrayIterObject),__Pyx_ImportType_CheckSize_Ignore_3_0_9); if (!__pyx_ptype_5numpy_flatiter) __PYX_ERR(1, 225, __pyx_L1_error)
+  __pyx_ptype_5numpy_broadcast = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "broadcast", sizeof(PyArrayMultiIterObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyArrayMultiIterObject),__Pyx_ImportType_CheckSize_Ignore_3_0_9); if (!__pyx_ptype_5numpy_broadcast) __PYX_ERR(1, 229, __pyx_L1_error)
+  __pyx_ptype_5numpy_ndarray = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "ndarray", sizeof(PyArrayObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyArrayObject),__Pyx_ImportType_CheckSize_Ignore_3_0_9); if (!__pyx_ptype_5numpy_ndarray) __PYX_ERR(1, 238, __pyx_L1_error)
+  __pyx_ptype_5numpy_generic = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "generic", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_generic) __PYX_ERR(1, 809, __pyx_L1_error)
+  __pyx_ptype_5numpy_number = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "number", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_number) __PYX_ERR(1, 811, __pyx_L1_error)
+  __pyx_ptype_5numpy_integer = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "integer", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_integer) __PYX_ERR(1, 813, __pyx_L1_error)
+  __pyx_ptype_5numpy_signedinteger = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "signedinteger", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_signedinteger) __PYX_ERR(1, 815, __pyx_L1_error)
+  __pyx_ptype_5numpy_unsignedinteger = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "unsignedinteger", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_unsignedinteger) __PYX_ERR(1, 817, __pyx_L1_error)
+  __pyx_ptype_5numpy_inexact = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "inexact", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_inexact) __PYX_ERR(1, 819, __pyx_L1_error)
+  __pyx_ptype_5numpy_floating = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "floating", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_floating) __PYX_ERR(1, 821, __pyx_L1_error)
+  __pyx_ptype_5numpy_complexfloating = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "complexfloating", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_complexfloating) __PYX_ERR(1, 823, __pyx_L1_error)
+  __pyx_ptype_5numpy_flexible = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "flexible", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_flexible) __PYX_ERR(1, 825, __pyx_L1_error)
+  __pyx_ptype_5numpy_character = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "character", sizeof(PyObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyObject),__Pyx_ImportType_CheckSize_Warn_3_0_9); if (!__pyx_ptype_5numpy_character) __PYX_ERR(1, 827, __pyx_L1_error)
+  __pyx_ptype_5numpy_ufunc = __Pyx_ImportType_3_0_9(__pyx_t_1, "numpy", "ufunc", sizeof(PyUFuncObject), __PYX_GET_STRUCT_ALIGNMENT_3_0_9(PyUFuncObject),__Pyx_ImportType_CheckSize_Ignore_3_0_9); if (!__pyx_ptype_5numpy_ufunc) __PYX_ERR(1, 866, __pyx_L1_error)
   __Pyx_DECREF(__pyx_t_1); __pyx_t_1 = 0;
   __Pyx_RefNannyFinishContext();
   return 0;
@@ -10059,7 +9148,7 @@ static CYTHON_SMALL_CODE int __pyx_pymod_exec_CRISPRessoCOREResources(PyObject *
   __pyx_t_1 = PyModule_Create(&__pyx_moduledef); if (unlikely(!__pyx_t_1)) __PYX_ERR(0, 1, __pyx_L1_error)
   {
     int add_module_result = PyState_AddModule(__pyx_t_1, &__pyx_moduledef);
-    __pyx_t_1 = 0; /* transfer ownership from __pyx_t_1 to CRISPRessoCOREResources pseudovariable */
+    __pyx_t_1 = 0; /* transfer ownership from __pyx_t_1 to "CRISPRessoCOREResources" pseudovariable */
     if (unlikely((add_module_result < 0))) __PYX_ERR(0, 1, __pyx_L1_error)
     pystate_addmodule_run = 1;
   }
@@ -10173,106 +9262,38 @@ if (!__Pyx_RefNanny) {
   __Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
 
   /* "CRISPResso2/CRISPRessoCOREResources.pyx":16
- *     char * PyBytes_AS_STRING(PyObject *)
- * 
- * class ResultsSlotsDict():             # <<<<<<<<<<<<<<
- *     __slots__ = (
- *         'all_insertion_positions',
- */
-  __pyx_t_2 = __Pyx_Py3MetaclassPrepare((PyObject *) NULL, __pyx_empty_tuple, __pyx_n_s_ResultsSlotsDict, __pyx_n_s_ResultsSlotsDict, (PyObject *) NULL, __pyx_n_s_CRISPResso2_CRISPRessoCOREResour, (PyObject *) NULL); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 16, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_2);
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":18
- * class ResultsSlotsDict():
- *     __slots__ = (
- *         'all_insertion_positions',             # <<<<<<<<<<<<<<
- *         'all_insertion_left_positions',
- *         'insertion_positions',
- */
-  if (__Pyx_SetNameInClass(__pyx_t_2, __pyx_n_s_slots, __pyx_tuple__5) < 0) __PYX_ERR(0, 17, __pyx_L1_error)
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":43
- *     )
- * 
- *     def __init__(             # <<<<<<<<<<<<<<
- *         self,
- *         all_insertion_positions,
- */
-  __pyx_t_3 = __Pyx_CyFunction_New(&__pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_1__init__, 0, __pyx_n_s_ResultsSlotsDict___init, NULL, __pyx_n_s_CRISPResso2_CRISPRessoCOREResour, __pyx_d, ((PyObject *)__pyx_codeobj__7)); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 43, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_3);
-  if (__Pyx_SetNameInClass(__pyx_t_2, __pyx_n_s_init, __pyx_t_3) < 0) __PYX_ERR(0, 43, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":87
- *         self.aln_strand = None
- * 
- *     def __getitem__(self, key):             # <<<<<<<<<<<<<<
- *         return getattr(self, key)
- * 
- */
-  __pyx_t_3 = __Pyx_CyFunction_New(&__pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_3__getitem__, 0, __pyx_n_s_ResultsSlotsDict___getitem, NULL, __pyx_n_s_CRISPResso2_CRISPRessoCOREResour, __pyx_d, ((PyObject *)__pyx_codeobj__9)); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 87, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_3);
-  if (__Pyx_SetNameInClass(__pyx_t_2, __pyx_n_s_getitem, __pyx_t_3) < 0) __PYX_ERR(0, 87, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":90
- *         return getattr(self, key)
- * 
- *     def __setitem__(self, key, value):             # <<<<<<<<<<<<<<
- *         setattr(self, key, value)
- * 
- */
-  __pyx_t_3 = __Pyx_CyFunction_New(&__pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_16ResultsSlotsDict_5__setitem__, 0, __pyx_n_s_ResultsSlotsDict___setitem, NULL, __pyx_n_s_CRISPResso2_CRISPRessoCOREResour, __pyx_d, ((PyObject *)__pyx_codeobj__11)); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 90, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_3);
-  if (__Pyx_SetNameInClass(__pyx_t_2, __pyx_n_s_setitem, __pyx_t_3) < 0) __PYX_ERR(0, 90, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":16
- *     char * PyBytes_AS_STRING(PyObject *)
- * 
- * class ResultsSlotsDict():             # <<<<<<<<<<<<<<
- *     __slots__ = (
- *         'all_insertion_positions',
- */
-  __pyx_t_3 = __Pyx_Py3ClassCreate(((PyObject*)&PyType_Type), __pyx_n_s_ResultsSlotsDict, __pyx_empty_tuple, __pyx_t_2, NULL, 0, 0); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 16, __pyx_L1_error)
-  __Pyx_GOTREF(__pyx_t_3);
-  if (PyDict_SetItem(__pyx_d, __pyx_n_s_ResultsSlotsDict, __pyx_t_3) < 0) __PYX_ERR(0, 16, __pyx_L1_error)
-  __Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
-  __Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
-
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":94
  * 
  * 
  * re_find_indels = re.compile("(-*-)")             # <<<<<<<<<<<<<<
  * 
  * @cython.boundscheck(False)
  */
-  __Pyx_GetModuleGlobalName(__pyx_t_2, __pyx_n_s_re); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 94, __pyx_L1_error)
+  __Pyx_GetModuleGlobalName(__pyx_t_2, __pyx_n_s_re); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 16, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_2);
-  __pyx_t_3 = __Pyx_PyObject_GetAttrStr(__pyx_t_2, __pyx_n_s_compile); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 94, __pyx_L1_error)
+  __pyx_t_3 = __Pyx_PyObject_GetAttrStr(__pyx_t_2, __pyx_n_s_compile); if (unlikely(!__pyx_t_3)) __PYX_ERR(0, 16, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_3);
   __Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
-  __pyx_t_2 = __Pyx_PyObject_Call(__pyx_t_3, __pyx_tuple__13, NULL); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 94, __pyx_L1_error)
+  __pyx_t_2 = __Pyx_PyObject_Call(__pyx_t_3, __pyx_tuple__6, NULL); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 16, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_2);
   __Pyx_DECREF(__pyx_t_3); __pyx_t_3 = 0;
-  if (PyDict_SetItem(__pyx_d, __pyx_n_s_re_find_indels, __pyx_t_2) < 0) __PYX_ERR(0, 94, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_d, __pyx_n_s_re_find_indels, __pyx_t_2) < 0) __PYX_ERR(0, 16, __pyx_L1_error)
   __Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":96
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":18
  * re_find_indels = re.compile("(-*-)")
  * 
  * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
  * @cython.nonecheck(False)
  * @cython.wraparound(False)
  */
-  __pyx_t_2 = __Pyx_CyFunction_New(&__pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions, 0, __pyx_n_s_find_indels_substitutions, NULL, __pyx_n_s_CRISPResso2_CRISPRessoCOREResour, __pyx_d, ((PyObject *)__pyx_codeobj__15)); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 96, __pyx_L1_error)
+  __pyx_t_2 = __Pyx_CyFunction_New(&__pyx_mdef_11CRISPResso2_23CRISPRessoCOREResources_1find_indels_substitutions, 0, __pyx_n_s_find_indels_substitutions, NULL, __pyx_n_s_CRISPResso2_CRISPRessoCOREResour_2, __pyx_d, ((PyObject *)__pyx_codeobj__8)); if (unlikely(!__pyx_t_2)) __PYX_ERR(0, 18, __pyx_L1_error)
   __Pyx_GOTREF(__pyx_t_2);
-  if (PyDict_SetItem(__pyx_d, __pyx_n_s_find_indels_substitutions, __pyx_t_2) < 0) __PYX_ERR(0, 96, __pyx_L1_error)
+  if (PyDict_SetItem(__pyx_d, __pyx_n_s_find_indels_substitutions, __pyx_t_2) < 0) __PYX_ERR(0, 18, __pyx_L1_error)
   __Pyx_DECREF(__pyx_t_2); __pyx_t_2 = 0;
 
-  /* "CRISPResso2/CRISPRessoCOREResources.pyx":238
- * 
- * 
+  /* "CRISPResso2/CRISPRessoCOREResources.pyx":138
+ *         'ref_positions': ref_positions,
+ *     }
  * @cython.boundscheck(False)             # <<<<<<<<<<<<<<
  * @cython.nonecheck(False)
  * @cython.wraparound(False)
@@ -11094,11 +10115,11 @@ static CYTHON_INLINE PyObject * __Pyx_GetKwValue_FASTCALL(PyObject *kwnames, PyO
     {
         int eq = __Pyx_PyUnicode_Equals(s, PyTuple_GET_ITEM(kwnames, i), Py_EQ);
         if (unlikely(eq != 0)) {
-            if (unlikely(eq < 0)) return NULL;  // error
+            if (unlikely(eq < 0)) return NULL;
             return kwvalues[i];
         }
     }
-    return NULL;  // not found (no exception set)
+    return NULL;
 }
 #if CYTHON_COMPILING_IN_CPYTHON && PY_VERSION_HEX >= 0x030d0000
 CYTHON_UNUSED static PyObject *__Pyx_KwargsAsDict_FASTCALL(PyObject *kwnames, PyObject *const *kwvalues) {
@@ -11211,7 +10232,7 @@ static int __Pyx_ParseOptionalKeywords(
         if (*name) {
             values[name-argnames] = value;
 #if CYTHON_AVOID_BORROWED_REFS
-            Py_INCREF(value); // transfer ownership of value to values
+            Py_INCREF(value);
             Py_DECREF(key);
 #endif
             key = NULL;
@@ -11230,7 +10251,7 @@ static int __Pyx_ParseOptionalKeywords(
                         && _PyString_Eq(**name, key)) {
                     values[name-argnames] = value;
 #if CYTHON_AVOID_BORROWED_REFS
-                    value = NULL;  // ownership transferred to values
+                    value = NULL;
 #endif
                     break;
                 }
@@ -11262,7 +10283,7 @@ static int __Pyx_ParseOptionalKeywords(
                 if (cmp == 0) {
                     values[name-argnames] = value;
 #if CYTHON_AVOID_BORROWED_REFS
-                    value = NULL; // ownership transferred to values
+                    value = NULL;
 #endif
                     break;
                 }
@@ -11494,9 +10515,10 @@ static CYTHON_INLINE int __Pyx_PySet_ContainsTF(PyObject* key, PyObject* set, in
 
 /* UnpackUnboundCMethod */
 static PyObject *__Pyx_SelflessCall(PyObject *method, PyObject *args, PyObject *kwargs) {
+    PyObject *result;
     PyObject *selfless_args = PyTuple_GetSlice(args, 1, PyTuple_Size(args));
     if (unlikely(!selfless_args)) return NULL;
-    PyObject *result = PyObject_Call(method, selfless_args, kwargs);
+    result = PyObject_Call(method, selfless_args, kwargs);
     Py_DECREF(selfless_args);
     return result;
 }
@@ -11921,9 +10943,10 @@ static CYTHON_INLINE void __Pyx_RaiseNeedMoreValuesError(Py_ssize_t index) {
 
 /* IterFinish */
 static CYTHON_INLINE int __Pyx_IterFinish(void) {
+    PyObject* exc_type;
     __Pyx_PyThreadState_declare
     __Pyx_PyThreadState_assign
-    PyObject* exc_type = __Pyx_PyErr_CurrentExceptionType();
+    exc_type = __Pyx_PyErr_CurrentExceptionType();
     if (unlikely(exc_type)) {
         if (unlikely(!__Pyx_PyErr_GivenExceptionMatches(exc_type, PyExc_StopIteration)))
             return -1;
@@ -11944,10 +10967,10 @@ static int __Pyx_IternextUnpackEndCheck(PyObject *retval, Py_ssize_t expected) {
 }
 
 /* TypeImport */
-#ifndef __PYX_HAVE_RT_ImportType_3_0_6
-#define __PYX_HAVE_RT_ImportType_3_0_6
-static PyTypeObject *__Pyx_ImportType_3_0_6(PyObject *module, const char *module_name, const char *class_name,
-    size_t size, size_t alignment, enum __Pyx_ImportType_CheckSize_3_0_6 check_size)
+#ifndef __PYX_HAVE_RT_ImportType_3_0_9
+#define __PYX_HAVE_RT_ImportType_3_0_9
+static PyTypeObject *__Pyx_ImportType_3_0_9(PyObject *module, const char *module_name, const char *class_name,
+    size_t size, size_t alignment, enum __Pyx_ImportType_CheckSize_3_0_9 check_size)
 {
     PyObject *result = 0;
     char warning[200];
@@ -12001,7 +11024,7 @@ static PyTypeObject *__Pyx_ImportType_3_0_6(PyObject *module, const char *module
             module_name, class_name, size, basicsize+itemsize);
         goto bad;
     }
-    if (check_size == __Pyx_ImportType_CheckSize_Error_3_0_6 &&
+    if (check_size == __Pyx_ImportType_CheckSize_Error_3_0_9 &&
             ((size_t)basicsize > size || (size_t)(basicsize + itemsize) < size)) {
         PyErr_Format(PyExc_ValueError,
             "%.200s.%.200s size changed, may indicate binary incompatibility. "
@@ -12009,7 +11032,7 @@ static PyTypeObject *__Pyx_ImportType_3_0_6(PyObject *module, const char *module
             module_name, class_name, size, basicsize, basicsize+itemsize);
         goto bad;
     }
-    else if (check_size == __Pyx_ImportType_CheckSize_Warn_3_0_6 && (size_t)basicsize > size) {
+    else if (check_size == __Pyx_ImportType_CheckSize_Warn_3_0_9 && (size_t)basicsize > size) {
         PyOS_snprintf(warning, sizeof(warning),
             "%s.%s size changed, may indicate binary incompatibility. "
             "Expected %zd from C header, got %zd from PyObject",
@@ -13268,7 +12291,7 @@ static PyObject * __Pyx_CyFunction_Vectorcall_FASTCALL_KEYWORDS(PyObject *func,
     default:
         return NULL;
     }
-    return ((_PyCFunctionFastWithKeywords)(void(*)(void))def->ml_meth)(self, args, nargs, kwnames);
+    return ((__Pyx_PyCFunctionFastWithKeywords)(void(*)(void))def->ml_meth)(self, args, nargs, kwnames);
 }
 static PyObject * __Pyx_CyFunction_Vectorcall_FASTCALL_KEYWORDS_METHOD(PyObject *func, PyObject *const *args, size_t nargsf, PyObject *kwnames)
 {
@@ -14014,7 +13037,7 @@ static PyCodeObject* __Pyx_CreateCodeObjectForTraceback(
     #else
     py_code = PyCode_NewEmpty(filename, funcname, py_line);
     #endif
-    Py_XDECREF(py_funcname);  // XDECREF since it's only set on Py3 if cline
+    Py_XDECREF(py_funcname);
     return py_code;
 bad:
     Py_XDECREF(py_funcname);
@@ -15077,7 +14100,7 @@ __Pyx_PyType_GetName(PyTypeObject* tp)
     if (unlikely(name == NULL) || unlikely(!PyUnicode_Check(name))) {
         PyErr_Clear();
         Py_XDECREF(name);
-        name = __Pyx_NewRef(__pyx_n_s__20);
+        name = __Pyx_NewRef(__pyx_n_s__13);
     }
     return name;
 }
diff --git a/CRISPResso2/CRISPRessoCOREResources.pyx b/CRISPResso2/CRISPRessoCOREResources.pyx
index 78a6dced..4b6a22f1 100644
--- a/CRISPResso2/CRISPRessoCOREResources.pyx
+++ b/CRISPResso2/CRISPRessoCOREResources.pyx
@@ -7,7 +7,6 @@ cdef extern from "stdlib.h":
     ctypedef unsigned int size_t
     size_t strlen(char* s)
 
-
 cdef extern from "Python.h":
     ctypedef void PyObject
     int _PyBytes_Resize(PyObject **, size_t)
@@ -74,6 +73,7 @@ def find_indels_substitutions(read_seq_al, ref_seq_al, _include_indx):
     substitution_values=[]
 
     all_deletion_positions = []
+    all_deletion_coordinates = []
     deletion_positions = []
     deletion_coordinates = []
     deletion_sizes = []
@@ -130,6 +130,7 @@ def find_indels_substitutions(read_seq_al, ref_seq_al, _include_indx):
         elif read_seq_al[idx_c] != '-' and start_deletion != -1:  # this is the end of a deletion
             end_deletion = ref_positions[idx_c]
             all_deletion_positions.extend(range(start_deletion, end_deletion))
+            all_deletion_coordinates.append((start_deletion, end_deletion))
             if include_indx_set.intersection(range(start_deletion, end_deletion)):
                 deletion_positions.extend(range(start_deletion, end_deletion))
                 deletion_coordinates.append((start_deletion, end_deletion))
@@ -139,6 +140,7 @@ def find_indels_substitutions(read_seq_al, ref_seq_al, _include_indx):
     if start_deletion != -1:
         end_deletion = ref_positions[seq_len - 1]
         all_deletion_positions.extend(range(start_deletion, end_deletion))
+        all_deletion_coordinates.append((start_deletion, end_deletion))
         if include_indx_set.intersection(range(start_deletion, end_deletion)):
             deletion_positions.extend(range(start_deletion, end_deletion))
             deletion_coordinates.append((start_deletion, end_deletion))
@@ -180,6 +182,7 @@ def find_indels_substitutions(read_seq_al, ref_seq_al, _include_indx):
         'insertion_n': insertion_n,
 
         'all_deletion_positions': all_deletion_positions,
+        'all_deletion_coordinates': all_deletion_coordinates,
         'deletion_positions': deletion_positions,
         'deletion_coordinates': deletion_coordinates,
         'deletion_sizes': deletion_sizes,
@@ -190,14 +193,13 @@ def find_indels_substitutions(read_seq_al, ref_seq_al, _include_indx):
         'all_substitution_values': np.array(all_substitution_values),
         'substitution_values': np.array(substitution_values),
         'substitution_n': substitution_n,
-
         'ref_positions': ref_positions,
     }
-
-
 @cython.boundscheck(False)
 @cython.nonecheck(False)
 @cython.wraparound(False)
+
+
 def find_indels_substitutions_legacy(read_seq_al, ref_seq_al, _include_indx):
 
     cdef char* sub_seq=''
@@ -222,7 +224,6 @@ def find_indels_substitutions_legacy(read_seq_al, ref_seq_al, _include_indx):
     substitution_positions=[]
     all_substitution_values=[]
     substitution_values=[]
-
     nucSet = set(['A', 'T', 'C', 'G', 'N'])
     idx=0
     for idx_c, c in enumerate(ref_seq_al):
@@ -296,28 +297,27 @@ def find_indels_substitutions_legacy(read_seq_al, ref_seq_al, _include_indx):
 
     insertion_n = np.sum(insertion_sizes)
 
-
     retDict = {
-	    'all_insertion_positions':all_insertion_positions,
-	    'all_insertion_left_positions':all_insertion_left_positions,
-	    'insertion_positions':insertion_positions,
-	    'insertion_coordinates':insertion_coordinates,
-	    'insertion_sizes':insertion_sizes,
-	    'insertion_n':insertion_n,
-
-	    'all_deletion_positions':all_deletion_positions,
-	    'deletion_positions':deletion_positions,
-	    'deletion_coordinates':deletion_coordinates,
-	    'deletion_sizes':deletion_sizes,
-	    'deletion_n':deletion_n,
-
-	    'all_substitution_positions':all_substitution_positions,
-	    'substitution_positions':substitution_positions,
-	    'all_substitution_values':np.array(all_substitution_values),
-	    'substitution_values':np.array(substitution_values),
-	    'substitution_n':substitution_n,
-
-	    'ref_positions':ref_positions,
+        'all_insertion_positions':all_insertion_positions,
+        'all_insertion_left_positions':all_insertion_left_positions,
+        'insertion_positions':insertion_positions,
+        'insertion_coordinates':insertion_coordinates,
+        'insertion_sizes':insertion_sizes,
+        'insertion_n':insertion_n,
+        'all_deletion_positions':all_deletion_positions,
+
+        'deletion_positions':deletion_positions,
+        'deletion_coordinates':deletion_coordinates,
+        'deletion_sizes':deletion_sizes,
+        'deletion_n':deletion_n,
+
+        'all_substitution_positions':all_substitution_positions,
+        'substitution_positions':substitution_positions,
+        'all_substitution_values':np.array(all_substitution_values),
+        'substitution_values':np.array(substitution_values),
+        'substitution_n':substitution_n,
+
+        'ref_positions':ref_positions,
     }
     return retDict
 
diff --git a/CRISPResso2/CRISPRessoCompareCORE.py b/CRISPResso2/CRISPRessoCompareCORE.py
index b70892ec..abccdddd 100644
--- a/CRISPResso2/CRISPRessoCompareCORE.py
+++ b/CRISPResso2/CRISPRessoCompareCORE.py
@@ -10,7 +10,6 @@
 import traceback
 import argparse
 from CRISPResso2 import CRISPRessoShared
-from CRISPResso2 import CRISPRessoPlot
 from CRISPResso2.CRISPRessoReports import CRISPRessoReport
 
 import logging
@@ -84,27 +83,16 @@ def main():
         '''
         compare_header = CRISPRessoShared.get_crispresso_header(description, compare_header)
         print(compare_header)
-
-        parser = argparse.ArgumentParser(description='CRISPRessoCompare Parameters', formatter_class=argparse.ArgumentDefaultsHelpFormatter)
-        parser.add_argument('crispresso_output_folder_1', type=str,  help='First output folder with CRISPResso analysis')
-        parser.add_argument('crispresso_output_folder_2', type=str,  help='Second output folder with CRISPResso analysis')
-
-        #OPTIONALS
-        parser.add_argument('-n', '--name',  help='Output name', default='')
-        parser.add_argument('-n1', '--sample_1_name',  help='Sample 1 name')
-        parser.add_argument('-n2', '--sample_2_name',  help='Sample 2 name')
-        parser.add_argument('-o', '--output_folder',  help='', default='')
-        parser.add_argument('--reported_qvalue_cutoff', help='Q-value cutoff for signifance in tests for differential editing. Each base position is tested (for insertions, deletions, substitutions, and all modifications) using Fisher\'s exact test, followed by Bonferonni correction. The number of bases with a significance below this threshold in the quantification window are counted and reported in the output summary.', type=float, default=0.05)
-        parser.add_argument('--min_frequency_alleles_around_cut_to_plot', type=float, help='Minimum %% reads required to report an allele in the alleles table plot.', default=0.2)
-        parser.add_argument('--max_rows_alleles_around_cut_to_plot',  type=int, help='Maximum number of rows to report in the alleles table plot. ', default=50)
-        parser.add_argument('--suppress_report',  help='Suppress output report', action='store_true')
-        parser.add_argument('--place_report_in_output_folder',  help='If true, report will be written inside the CRISPResso output folder. By default, the report will be written one directory up from the report output.', action='store_true')
-        parser.add_argument('--zip_output', help="If set, the output will be placed in a zip folder.", action='store_true')
-        parser.add_argument('--debug', help='Show debug messages', action='store_true')
-        parser.add_argument('-v', '--verbosity', type=int, help='Verbosity level of output to the console (1-4)', default=3)
+        
+        parser = CRISPRessoShared.getCRISPRessoArgParser("Compare", parser_title = 'CRISPRessoCompare Parameters')
 
         args = parser.parse_args()
 
+        if args.use_matplotlib or not CRISPRessoShared.is_C2Pro_installed():
+            from CRISPResso2 import CRISPRessoPlot
+        else:
+            from CRISPRessoPro import plot as CRISPRessoPlot
+
         CRISPRessoShared.set_console_log_level(logger, args.verbosity, args.debug)
 
         debug_flag = args.debug
@@ -154,7 +142,7 @@ def main():
 
         log_filename = _jp('CRISPRessoCompare_RUNNING_LOG.txt')
         logger.addHandler(logging.FileHandler(log_filename))
-        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoCompare_status.txt')))
+        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoCompare_status.json')))
 
         with open(log_filename, 'w+') as outfile:
             outfile.write('[Command used]:\nCRISPRessoCompare %s\n\n[Execution log]:\n' % ' '.join(sys.argv))
diff --git a/CRISPResso2/CRISPRessoMetaCORE.py b/CRISPResso2/CRISPRessoMetaCORE.py
index e2e0b843..a0e3936e 100644
--- a/CRISPResso2/CRISPRessoMetaCORE.py
+++ b/CRISPResso2/CRISPRessoMetaCORE.py
@@ -13,7 +13,6 @@
 import traceback
 import json
 from CRISPResso2 import CRISPRessoShared
-from CRISPResso2 import CRISPRessoPlot
 from CRISPResso2 import CRISPRessoMultiProcessing
 from CRISPResso2.CRISPRessoReports import CRISPRessoReport
 
@@ -87,7 +86,7 @@ def main():
         '''
         print(CRISPRessoShared.get_crispresso_header(description, meta_string))
 
-        parser = CRISPRessoShared.getCRISPRessoArgParser(parser_title = 'CRISPRessoMeta Parameters')
+        parser = CRISPRessoShared.getCRISPRessoArgParser("Meta", parser_title = 'CRISPRessoMeta Parameters')
 
         #batch specific params
         parser.add_argument('--metadata', type=str, help='Metadata file according to NIST specification', required=True)
@@ -96,11 +95,16 @@ def main():
 
         args = parser.parse_args()
 
+        if args.use_matplotlib or not CRISPRessoShared.is_C2Pro_installed():
+            from CRISPResso2 import CRISPRessoPlot
+        else:
+            from CRISPRessoPro import plot as CRISPRessoPlot
+
         CRISPRessoShared.set_console_log_level(logger, args.verbosity, args.debug)
 
         debug_flag = args.debug
 
-        crispresso_options = CRISPRessoShared.get_crispresso_options()
+        crispresso_options = CRISPRessoShared.get_core_crispresso_options()
         options_to_ignore = {'name', 'output_folder'}
         crispresso_options_for_meta = list(crispresso_options-options_to_ignore)
 
@@ -123,7 +127,7 @@ def main():
         print('table:')
         print(meta_params)
         #rename column "a" to "amplicon_seq", etc
-        meta_params.rename(index=str, columns=CRISPRessoShared.get_crispresso_options_lookup(), inplace=True)
+        meta_params.rename(index=str, columns=CRISPRessoShared.get_crispresso_options_lookup("Core"), inplace=True)
         meta_count = meta_params.shape[0]
         meta_params.index = range(meta_count)
 
@@ -229,7 +233,7 @@ def main():
 
         log_filename=_jp('CRISPRessoMeta_RUNNING_LOG.txt')
         logger.addHandler(logging.FileHandler(log_filename))
-        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoMeta_status.txt')))
+        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoMeta_status.json')))
 
         with open(log_filename, 'w+') as outfile:
             outfile.write('[Command used]:\n%s\n\n[Execution log]:\n' % ' '.join(sys.argv))
diff --git a/CRISPResso2/CRISPRessoPlot.py b/CRISPResso2/CRISPRessoPlot.py
index 8da1d450..cc886b66 100644
--- a/CRISPResso2/CRISPRessoPlot.py
+++ b/CRISPResso2/CRISPRessoPlot.py
@@ -8,12 +8,12 @@
 import numpy as np
 import pandas as pd
 import matplotlib
+import json
 matplotlib.use('AGG')
 import matplotlib.pyplot as plt
 import matplotlib.patches as patches
 import matplotlib.cm as cm
 import matplotlib.gridspec as gridspec
-import plotly.express as px
 from collections import defaultdict
 from copy import deepcopy
 import re
@@ -95,7 +95,7 @@ def hex_to_rgb(value):
     lv = len(value)
     return tuple(int(value[i:i + lv // 3], 16) for i in range(0, lv, lv // 3))
 
-def plot_nucleotide_quilt(nuc_pct_df,mod_pct_df,fig_filename_root, custom_colors, save_also_png=False,sgRNA_intervals=None,min_text_pct=0.5,max_text_pct=0.95,quantification_window_idxs=None,sgRNA_names=None,sgRNA_mismatches=None,shade_unchanged=True,group_column='Batch'):
+def plot_nucleotide_quilt(nuc_pct_df,mod_pct_df,fig_filename_root, custom_colors, save_also_png=False,sgRNA_intervals=None,min_text_pct=0.5,max_text_pct=0.95,quantification_window_idxs=None,sgRNA_names=None,sgRNA_mismatches=None,shade_unchanged=True,group_column='Batch', **kwargs):
     """
     Plots a nucleotide quilt with each square showing the percentage of each base at that position in the reference
     nuc_pct_df: dataframe with percents of each base (ACTGN-) at each position
@@ -240,7 +240,7 @@ def plot_nucleotide_quilt(nuc_pct_df,mod_pct_df,fig_filename_root, custom_colors
 
     plot_y_start = ref_y_start - 0.1
 
-    if sgRNA_intervals and len(sgRNA_intervals) > 0:
+    if sgRNA_intervals:
         sgRNA_rows = get_rows_for_sgRNA_annotation(sgRNA_intervals, amp_len)
         num_sgRNA_rows = max(sgRNA_rows) + 1
         sgRNA_y_height = num_sgRNA_rows * 0.3
@@ -332,6 +332,7 @@ def plot_indel_size_distribution(
     title,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(10, 10))
     densityPct_0 = 0.0
@@ -381,7 +382,9 @@ def plot_frequency_deletions_insertions(
     xmax_del,
     xmax_ins,
     xmax_mut,
+    custom_colors,
     save_also_png=False,
+    **kwargs,
 ):
     y_values_mut = ref['y_values_mut']
     x_bins_mut = ref['x_bins_mut']
@@ -517,6 +520,7 @@ def plot_amplicon_modifications(
     plot_root,
     custom_colors,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(10, 10))
 
@@ -669,6 +673,7 @@ def plot_modification_frequency(
     plot_root,
     custom_colors,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(10, 10))
 
@@ -838,6 +843,7 @@ def plot_quantification_window_locations(
     plot_root,
     custom_colors,
     save_also_png,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(10, 10))
 
@@ -1005,6 +1011,7 @@ def plot_position_dependent_indels(
     plot_titles,
     plot_root,
     save_also_png,
+    **kwargs,
 ):
     fig, ax = plt.subplots(1, 2, figsize=(24, 10))
     ax1 = ax[0]
@@ -1110,6 +1117,7 @@ def plot_global_modifications_reference(
     plot_root,
     custom_colors,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(10, 10))
     ref1_all_insertion_positions = ref1_all_insertion_count_vectors
@@ -1268,6 +1276,7 @@ def plot_frameshift_analysis(
     ref_name,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     """Plot 5: Plot a pie chart to plot_root showing classification of reads with regard to coding region for a specific reference sequence, also including a diagram of where the coding region is within the amplicon.
 
@@ -1416,6 +1425,7 @@ def plot_frameshift_frequency(
     plot_titles,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(1, 2, figsize=(22, 10))
     ax1 = ax[0]
@@ -1511,6 +1521,7 @@ def plot_global_frameshift_analysis(
     global_non_modified_non_frameshift,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(12, 12))
 
@@ -1547,6 +1558,7 @@ def plot_global_frameshift_in_frame_mutations(
     global_hists_inframe,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     fig, axs = plt.subplots(2, 1, figsize=(22, 10))
     ax1 = axs[0]
@@ -1643,6 +1655,7 @@ def plot_impact_on_splice_sites(
     global_count_total,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(12, 12))
     patches, texts, autotexts = ax.pie(
@@ -1682,6 +1695,7 @@ def plot_non_coding_mutations(
     plot_root,
     custom_colors,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(10, 10))
     ax.plot(
@@ -1822,6 +1836,7 @@ def plot_potential_splice_sites(
     count_total,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     fig, ax = plt.subplots(figsize=(12, 12))
     patches, texts, autotexts = ax.pie(
@@ -1852,6 +1867,7 @@ def plot_scaffold_indel_lengths(
     df_scaffold_insertion_sizes,
     plot_root,
     save_also_png=False,
+    **kwargs,
 ):
     colors = ['b', 'g']
     fig, ax = plt.subplots(figsize=(12, 6))
@@ -1996,7 +2012,7 @@ def add_sgRNA_to_ax(ax,sgRNA_intervals,sgRNA_y_start,sgRNA_y_height,amp_len,x_of
         else:
             ax.text(x_offset+min_sgRNA_x, this_sgRNA_y_start + this_sgRNA_y_height/2, 'sgRNA ', horizontalalignment='right', verticalalignment='center', fontsize=font_size)
 
-def plot_conversion_map(nuc_pct_df,fig_filename_root,conversion_nuc_from,conversion_nuc_to,save_also_png,custom_colors,plotPct = 0.9,min_text_pct=0.3,max_text_pct=0.9,conversion_scale_max=None,sgRNA_intervals=None,quantification_window_idxs=None,sgRNA_names=None,sgRNA_mismatches=None):
+def plot_conversion_map(nuc_pct_df,fig_filename_root,conversion_nuc_from,conversion_nuc_to,save_also_png,custom_colors,plotPct = 0.9,min_text_pct=0.3,max_text_pct=0.9,conversion_scale_max=None,sgRNA_intervals=None,quantification_window_idxs=None,sgRNA_names=None,sgRNA_mismatches=None,**kwargs):
     """
     Plots a heatmap of conversion across several sequences
     :param nuc_pct_df combined df of multiple batches
@@ -2168,7 +2184,7 @@ def plot_conversion_map(nuc_pct_df,fig_filename_root,conversion_nuc_from,convers
     plt.close(fig)
 
 
-def plot_subs_across_ref(ref_len, ref_seq, ref_name, ref_count, all_substitution_base_vectors, plot_title, fig_filename_root, save_also_png, custom_colors, quantification_window_idxs=None):
+def plot_subs_across_ref(ref_len, ref_seq, ref_name, ref_count, all_substitution_base_vectors, plot_title, fig_filename_root, save_also_png, custom_colors, quantification_window_idxs=None,**kwargs):
     """
     Plots substitutions across the reference sequece - each position on the x axis reprsents a nucleotide in the reference
     bars at each x posion show the number of times the reference nucleotide was substituted for another reference
@@ -2233,7 +2249,7 @@ def plot_subs_across_ref(ref_len, ref_seq, ref_name, ref_count, all_substitution
         fig.savefig(fig_filename_root + '.png', bbox_extra_artists=(lgd,), bbox_inches='tight')
     plt.close(fig)
 
-def plot_sub_freqs(alt_nuc_counts, plot_title, fig_filename_root, save_also_png, custom_colors):
+def plot_sub_freqs(alt_nuc_counts, plot_title, fig_filename_root, save_also_png, custom_colors,**kwargs):
     """
     Plots histogram of substitution frequencies for each nucleotide (from nuc X to nuc Y)
     input:
@@ -2263,7 +2279,7 @@ def plot_sub_freqs(alt_nuc_counts, plot_title, fig_filename_root, save_also_png,
         fig.savefig(fig_filename_root + '.png', bbox_inches='tight')
     plt.close(fig)
 
-def plot_nuc_freqs(df_nuc_freq, tot_aln_reads, plot_title, fig_filename_root, save_also_png):
+def plot_nuc_freqs(df_nuc_freq, tot_aln_reads, plot_title, fig_filename_root, save_also_png,**kwargs):
     """
     Plots a heatmap of the percentage of reads that had each nucletide at each base in the reference
     Positions in the reference that have more than one allele can be spotted using this plot
@@ -2279,7 +2295,7 @@ def plot_nuc_freqs(df_nuc_freq, tot_aln_reads, plot_title, fig_filename_root, sa
         plt.savefig(fig_filename_root + '.png', bbox_inches='tight')
     plt.close()
 
-def plot_log_nuc_freqs(df_nuc_freq,tot_aln_reads,plot_title,fig_filename_root,save_also_png,quantification_window_idxs=None):
+def plot_log_nuc_freqs(df_nuc_freq,tot_aln_reads,plot_title,fig_filename_root,save_also_png,quantification_window_idxs=None,**kwargs):
     """
     Plots a heatmap of the percentage of reads that had each nucletide at each base in the reference
     Positions in the reference that have more than one allele can be spotted using this plot
@@ -2317,7 +2333,7 @@ def plot_log_nuc_freqs(df_nuc_freq,tot_aln_reads,plot_title,fig_filename_root,sa
     plt.close(fig)
 
 
-def plot_conversion_at_sel_nucs(df_subs, ref_name, ref_sequence, plot_title, conversion_nuc_from, fig_filename_root, save_also_png, custom_colors):
+def plot_conversion_at_sel_nucs(df_subs, ref_name, ref_sequence, plot_title, conversion_nuc_from, fig_filename_root, save_also_png, custom_colors,**kwargs):
     '''
     Plots the conversion at selected nucleotides
     Looks for the 'conversion_nuc_from' in the ref_sequence and sets those as 'selected nucleotides'
@@ -2379,7 +2395,7 @@ def plot_conversion_at_sel_nucs(df_subs, ref_name, ref_sequence, plot_title, con
         fig.savefig(fig_filename_root+'.png', bbox_inches='tight', pad_inches=0.1)
     plt.close(fig)
 
-def plot_conversion_at_sel_nucs_not_include_ref(df_subs, ref_name, ref_sequence, plot_title, conversion_nuc_from, fig_filename_root, save_also_png, custom_colors):
+def plot_conversion_at_sel_nucs_not_include_ref(df_subs, ref_name, ref_sequence, plot_title, conversion_nuc_from, fig_filename_root, save_also_png, custom_colors, **kwargs):
     '''
     Plots the conversion at selected nucleotides but ignores non-substitutions (for example at nucs that are 'C' in the reference, bars show the proportion of A T G (not C))
     Looks for the 'conversion_nuc_from' in the ref_sequence and sets those as 'selected nucleotides'
@@ -2451,7 +2467,7 @@ def plot_conversion_at_sel_nucs_not_include_ref(df_subs, ref_name, ref_sequence,
         fig.savefig(fig_filename_root+'.png', bbox_inches='tight', pad_inches=0.1)
     plt.close(fig)
 
-def plot_conversion_at_sel_nucs_not_include_ref_scaled(df_subs, ref_name, ref_sequence, plot_title, conversion_nuc_from, fig_filename_root, save_also_png, custom_colors):
+def plot_conversion_at_sel_nucs_not_include_ref_scaled(df_subs, ref_name, ref_sequence, plot_title, conversion_nuc_from, fig_filename_root, save_also_png, custom_colors, **kwargs):
     '''
     Plots the conversion at selected nucleotides not including reference base, scaled by number of events
     Looks for the 'conversion_nuc_from' in the ref_sequence and sets those as 'selected nucleotides'
@@ -2721,7 +2737,21 @@ def prep_alleles_table_compare(df_alleles, sample_name_1, sample_name_2, MAX_N_R
 
     return X, annot, y_labels, insertion_dict, per_element_annot_kws
 
-def plot_alleles_heatmap(reference_seq,fig_filename_root,X,annot,y_labels,insertion_dict,per_element_annot_kws,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,custom_colors=None):
+def plot_alleles_heatmap(
+        reference_seq,
+        fig_filename_root,
+        X,
+        annot,
+        y_labels,
+        insertion_dict,
+        per_element_annot_kws,
+        custom_colors,
+        SAVE_ALSO_PNG=False,
+        plot_cut_point=True,
+        sgRNA_intervals=None,
+        sgRNA_names=None,
+        sgRNA_mismatches=None,
+        **kwargs):
     """
     Plots alleles in a heatmap (nucleotides color-coded for easy visualization)
     input:
@@ -2890,7 +2920,7 @@ def plot_alleles_heatmap(reference_seq,fig_filename_root,X,annot,y_labels,insert
         fig.savefig(fig_filename_root+'.png', bbox_inches='tight', bbox_extra_artists=(lgd,))
     plt.close(fig)
 
-def plot_alleles_heatmap_hist(reference_seq,fig_filename_root,X,annot,y_labels,insertion_dict,per_element_annot_kws,count_values,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,custom_colors=None):
+def plot_alleles_heatmap_hist(reference_seq,fig_filename_root,X,annot,y_labels,insertion_dict,per_element_annot_kws,count_values,custom_colors,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,**kwargs):
     """
     Plots alleles in a heatmap (nucleotides color-coded for easy visualization)
     input:
@@ -3025,7 +3055,7 @@ def plot_alleles_heatmap_hist(reference_seq,fig_filename_root,X,annot,y_labels,i
         plt.savefig(fig_filename_root+'.png', bbox_inches='tight', bbox_extra_artists=(lgd,), pad_inches=0.1)
     plt.close()
 
-def plot_alleles_table(reference_seq,df_alleles,fig_filename_root,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,custom_colors=None,annotate_wildtype_allele='****'):
+def plot_alleles_table(reference_seq,df_alleles,fig_filename_root,custom_colors,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,annotate_wildtype_allele='****',**kwargs):
     """
     plots an allele table for a dataframe with allele frequencies
     input:
@@ -3047,9 +3077,9 @@ def plot_alleles_table(reference_seq,df_alleles,fig_filename_root,MIN_FREQUENCY=
         for ix, is_ref in enumerate(is_reference):
             if is_ref:
                 y_labels[ix] += annotate_wildtype_allele
-    plot_alleles_heatmap(reference_seq, fig_filename_root, X, annot, y_labels, insertion_dict, per_element_annot_kws, SAVE_ALSO_PNG, plot_cut_point, sgRNA_intervals, sgRNA_names, sgRNA_mismatches, custom_colors)
+    plot_alleles_heatmap(reference_seq, fig_filename_root, X, annot, y_labels, insertion_dict, per_element_annot_kws, custom_colors, SAVE_ALSO_PNG, plot_cut_point, sgRNA_intervals, sgRNA_names, sgRNA_mismatches)
 
-def plot_alleles_table_from_file(alleles_file_name,fig_filename_root,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,custom_colors=None,annotate_wildtype_allele=''):
+def plot_alleles_table_from_file(alleles_file_name,fig_filename_root,custom_colors,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,annotate_wildtype_allele='',**kwargs):
     """
     plots an allele table for a dataframe with allele frequencies
     infers the reference sequence by finding reference sequences without gaps (-)
@@ -3083,9 +3113,9 @@ def plot_alleles_table_from_file(alleles_file_name,fig_filename_root,MIN_FREQUEN
         for ix, is_ref in enumerate(is_reference):
             if is_ref:
                 y_labels[ix] += annotate_wildtype_allele
-    plot_alleles_heatmap(reference_seq, fig_filename_root, X, annot, y_labels, insertion_dict, per_element_annot_kws, SAVE_ALSO_PNG, plot_cut_point, sgRNA_intervals, sgRNA_names, sgRNA_mismatches, custom_colors)
+    plot_alleles_heatmap(reference_seq, fig_filename_root, X, annot, y_labels, insertion_dict, per_element_annot_kws, custom_colors, SAVE_ALSO_PNG, plot_cut_point, sgRNA_intervals, sgRNA_names, sgRNA_mismatches)
 
-def plot_alleles_tables_from_folder(crispresso_output_folder,fig_filename_root,MIN_FREQUENCY=None,MAX_N_ROWS=None,SAVE_ALSO_PNG=False,custom_colors=None,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None):
+def plot_alleles_tables_from_folder(crispresso_output_folder,fig_filename_root,custom_colors,MIN_FREQUENCY=None,MAX_N_ROWS=None,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,**kwargs):
     """
     plots an allele table for each sgRNA/amplicon in a CRISPresso run (useful for plotting after running using the plot harness)
     This function is only used for one-off plotting purposes and not for the general CRISPResso analysis
@@ -3152,11 +3182,11 @@ def plot_alleles_tables_from_folder(crispresso_output_folder,fig_filename_root,M
                 new_sgRNA_intervals += [(int_start - new_sel_cols_start - 1, int_end - new_sel_cols_start - 1)]
 
             X, annot, y_labels, insertion_dict, per_element_annot_kws, is_reference = prep_alleles_table(df_alleles, ref_seq_around_cut, MAX_N_ROWS, MIN_FREQUENCY)
-            plot_alleles_heatmap(ref_seq_around_cut, fig_filename_root+"_"+ref_name+"_"+sgRNA_label, X, annot, y_labels, insertion_dict, per_element_annot_kws, SAVE_ALSO_PNG, plot_cut_point, new_sgRNA_intervals, sgRNA_names, sgRNA_mismatches, custom_colors)
+            plot_alleles_heatmap(ref_seq_around_cut, fig_filename_root+"_"+ref_name+"_"+sgRNA_label, X, annot, y_labels, insertion_dict, per_element_annot_kws, custom_colors, SAVE_ALSO_PNG, plot_cut_point, new_sgRNA_intervals, sgRNA_names, sgRNA_mismatches)
             plot_count += 1
     print('Plotted ' + str(plot_count) + ' plots')
 
-def plot_alleles_table_compare(reference_seq,df_alleles,sample_name_1,sample_name_2,fig_filename_root,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,custom_colors=None):
+def plot_alleles_table_compare(reference_seq,df_alleles,sample_name_1,sample_name_2,fig_filename_root,custom_colors=None,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,**kwargs):
     """
     plots an allele table for a dataframe with allele frequencies from two CRISPResso runs
     input:
@@ -3174,9 +3204,9 @@ def plot_alleles_table_compare(reference_seq,df_alleles,sample_name_1,sample_nam
     custom_colors: dict of colors to plot (e.g. colors['A'] = (1,0,0,0.4) # red,blue,green,alpha )
     """
     X, annot, y_labels, insertion_dict, per_element_annot_kws = prep_alleles_table_compare(df_alleles, sample_name_1, sample_name_2, MAX_N_ROWS, MIN_FREQUENCY)
-    plot_alleles_heatmap(reference_seq, fig_filename_root, X, annot, y_labels, insertion_dict, per_element_annot_kws, SAVE_ALSO_PNG, plot_cut_point, sgRNA_intervals, sgRNA_names, sgRNA_mismatches, custom_colors)
+    plot_alleles_heatmap(reference_seq, fig_filename_root, X, annot, y_labels, insertion_dict, per_element_annot_kws, custom_colors, SAVE_ALSO_PNG, plot_cut_point, sgRNA_intervals, sgRNA_names, sgRNA_mismatches)
 
-def plot_nucleotide_quilt_from_folder(crispresso_output_folder,fig_filename_root,save_also_png=False,sgRNA_intervals=None,min_text_pct=0.5,max_text_pct=0.95,quantification_window_idxs=None,sgRNA_names=None,sgRNA_mismatches=None,shade_unchanged=True):
+def plot_nucleotide_quilt_from_folder(crispresso_output_folder,fig_filename_root,save_also_png=False,sgRNA_intervals=None,min_text_pct=0.5,max_text_pct=0.95,quantification_window_idxs=None,sgRNA_names=None,sgRNA_mismatches=None,shade_unchanged=True,**kwargs):
     """
     plots an allele table for each sgRNA/amplicon in a CRISPresso run (useful for plotting after running using the plot harness)
     This function is only used for one-off plotting purposes and not for the general CRISPResso analysis
@@ -3252,7 +3282,7 @@ def plot_nucleotide_quilt_from_folder(crispresso_output_folder,fig_filename_root
             plot_count += 1
     print('Plotted ' + str(plot_count) + ' plots')
 
-def plot_unmod_mod_pcts(fig_filename_root,df_summary_quantification,save_png,cutoff=None,max_samples_to_include_unprocessed=20):
+def plot_unmod_mod_pcts(fig_filename_root,df_summary_quantification,save_png,cutoff=None,max_samples_to_include_unprocessed=20,**kwargs):
     """
     plots a stacked horizontal barplot for summarizing number of reads, and the percent that are modified and unmodified
     params:
@@ -3311,7 +3341,7 @@ def plot_unmod_mod_pcts(fig_filename_root,df_summary_quantification,save_png,cut
         fig.savefig(fig_filename_root+'.png', bbox_inches='tight')
     plt.close(fig)
 
-def plot_reads_total(fig_filename_root,df_summary_quantification,save_png,cutoff=None):
+def plot_reads_total(fig_filename_root,df_summary_quantification,save_png,cutoff=None,**kwargs):
     """
     plots a horizontal barplot for summarizing number of reads aligned to each sample
     """
@@ -3344,7 +3374,7 @@ def plot_reads_total(fig_filename_root,df_summary_quantification,save_png,cutoff
 
 
 def plot_read_barplot(N_READS_INPUT, N_READS_AFTER_PREPROCESSING, N_TOTAL,
-                      plot_root, save_png
+                      plot_root, save_png,**kwargs
                       ):
     """Plot barplot of total, processed, and aligned reads.
 
@@ -3399,7 +3429,7 @@ def plot_read_barplot(N_READS_INPUT, N_READS_AFTER_PREPROCESSING, N_TOTAL,
 
 def plot_class_piechart_and_barplot(class_counts_order, class_counts, ref_names,
                                     expected_hdr_amplicon_seq, N_TOTAL,
-                                    piechart_plot_root, barplot_plot_root, save_png):
+                                    piechart_plot_root, barplot_plot_root, custom_colors, save_png,**kwargs):
     """Plot a pie chart and barplot of class assignments for reads.
 
        Class assignments include: 'MODIFIED','UNMODIFIED','HDR',etc.
@@ -3494,7 +3524,7 @@ def plot_class_piechart_and_barplot(class_counts_order, class_counts, ref_names,
     plt.close()
 
 
-def plot_class_dsODN_piechart(sizes, labels, plot_root, save_also_png=False):
+def plot_class_dsODN_piechart(sizes, labels, plot_root, save_also_png=False,**kwargs):
     fig, ax = plt.subplots(figsize=(12, 12))
     patches, texts, autotexts =ax.pie(sizes, labels=labels, autopct='%1.2f%%')
 
@@ -3519,6 +3549,7 @@ def plot_quantification_comparison_barchart(
     plot_titles,
     plot_path,
     save_also_png=False,
+    **kwargs
 ):
     fig, axs = plt.subplots(1, 2, figsize=(30, 15))
     n_groups = 2
@@ -3597,6 +3628,7 @@ def plot_quantification_positions(
     plot_title,
     plot_path,
     save_also_png=False,
+    **kwargs,
 ):
     fig, axs = plt.subplots(2, 1, figsize=(20, 10))
     ax1 = axs[0]
@@ -3737,85 +3769,3 @@ def plot_quantification_positions(
         )
 
     plt.close(fig)
-
-
-def plot_allele_modification_heatmap(
-    sample_values, sample_sgRNA_intervals, plot_path, title,
-):
-    fig = px.imshow(
-        sample_values,
-        labels={
-            'x': 'Amplicon Nucleotide (Position)',
-            'y': 'Sample (Index)',
-            'color': '{0} (%)'.format(title),
-        },
-        aspect='auto',
-    )
-    for sample_id, sgRNA_intervals in zip(
-        range(sample_values.shape[0]), sample_sgRNA_intervals,
-    ):
-        for sgRNA_interval in sgRNA_intervals:
-            fig.add_shape(
-                type='rect',
-                x0=sgRNA_interval[0],
-                y0=sample_id - 0.5,
-                x1=sgRNA_interval[1],
-                y1=sample_id + 0.5,
-                line={'color': 'Black'},
-            )
-
-    fig.update_layout(
-        autosize=True,
-    )
-    fig['layout']['yaxis']['scaleanchor'] = 'x'
-    fig['layout']['yaxis']['gridcolor'] = 'rgba(0, 0, 0, 0)'
-    fig['layout']['xaxis']['gridcolor'] = 'rgba(0, 0, 0, 0)'
-    return fig.write_html(
-        plot_path,
-        config={
-            'responsive': True,
-            'displaylogo': False,
-        },
-        include_plotlyjs='cdn',
-        full_html=False,
-        div_id='allele-modification-heatmap-{0}'.format(title.lower()),
-    )
-
-
-def plot_allele_modification_line(
-    sample_values, sample_sgRNA_intervals, plot_path, title,
-):
-    fig = px.line(sample_values.transpose())
-    sgRNA_intervals = set(
-        tuple(sgRNA_interval)
-        for sample_sgRNA_interval in sample_sgRNA_intervals
-        for sgRNA_interval in sample_sgRNA_interval
-    )
-    for sgRNA_interval in sgRNA_intervals:
-        fig.add_shape(
-            type='rect',
-            x0=sgRNA_interval[0],
-            y0=0,
-            x1=sgRNA_interval[1],
-            y1=0.5,
-            fillcolor='Gray',
-            opacity=0.2,
-            line={'color': 'gray'},
-        )
-
-    fig.update_layout(
-        autosize=True,
-        xaxis_title='Amplicon Nucleotide (Position)',
-        yaxis_title='{0} (%)'.format(title),
-        legend_title='Samples',
-    )
-    return fig.write_html(
-        plot_path,
-        config={
-            'responsive': True,
-            'displaylogo': False,
-        },
-        include_plotlyjs='cdn',
-        full_html=False,
-        div_id='allele-modification-line-{0}'.format(title.lower()),
-    )
diff --git a/CRISPResso2/CRISPRessoPooledCORE.py b/CRISPResso2/CRISPRessoPooledCORE.py
index d84b987e..8c63dc42 100644
--- a/CRISPResso2/CRISPRessoPooledCORE.py
+++ b/CRISPResso2/CRISPRessoPooledCORE.py
@@ -19,7 +19,7 @@
 from CRISPResso2 import CRISPRessoShared
 from CRISPResso2 import CRISPRessoMultiProcessing
 from CRISPResso2.CRISPRessoReports import CRISPRessoReport
-from CRISPResso2 import CRISPRessoPlot
+
 import traceback
 
 import logging
@@ -107,7 +107,7 @@ def summarize_region_fastq_chunk(input_arr):
     for input in input_arr:
 #        print('doing region ' + str(input))
         region_fastq, uncompressed_reference = input.split(" ")
-        #region format: REGION_chr8_1077_1198.fastq.gz
+        # region format: REGION_chr8_1077_1198.fastq.gz
         #But if the chr has underscores, it could look like this:
         #    REGION_chr8_KI270812v1_alt_1077_1198.fastq.gz
         region_info = os.path.basename(region_fastq).replace('.fastq.gz', '').replace('.fastq', '').split('_')
@@ -294,50 +294,18 @@ def main():
             ))
             sys.exit()
 
-        parser = CRISPRessoShared.getCRISPRessoArgParser(parser_title = 'CRISPRessoPooled Parameters')
-        parser.add_argument('-f', '--amplicons_file', type=str,  help='Amplicons description file. This file is a tab-delimited text file with up to 14 columns (2 required):\
-        \namplicon_name:  an identifier for the amplicon (must be unique).\
-        \namplicon_seq:  amplicon sequence used in the experiment.\
-        \nguide_seq (OPTIONAL):  sgRNA sequence used for this amplicon without the PAM sequence. Multiple guides can be given separated by commas and not spaces.\
-        \nexpected_hdr_amplicon_seq (OPTIONAL): expected amplicon sequence in case of HDR.\
-        \ncoding_seq (OPTIONAL): Subsequence(s) of the amplicon corresponding to coding sequences. If more than one separate them by commas and not spaces.\
-        \nprime_editing_pegRNA_spacer_seq (OPTIONAL): pegRNA spacer sgRNA sequence used in prime editing. The spacer should not include the PAM sequence. The sequence should be given in the RNA 5\'->3\' order, so for Cas9, the PAM would be on the right side of the given sequence.\
-        \nprime_editing_nicking_guide_seq (OPTIONAL): Nicking sgRNA sequence used in prime editing. The sgRNA should not include the PAM sequence. The sequence should be given in the RNA 5\'->3\' order, so for Cas9, the PAM would be on the right side of the sequence.\
-        \nprime_editing_pegRNA_extension_seq (OPTIONAL): Extension sequence used in prime editing. The sequence should be given in the RNA 5\'->3\' order, such that the sequence starts with the RT template including the edit, followed by the Primer-binding site (PBS).\
-        \nprime_editing_pegRNA_scaffold_seq (OPTIONAL): If given, reads containing any of this scaffold sequence before extension sequence (provided by --prime_editing_extension_seq) will be classified as \'Scaffold-incorporated\'. The sequence should be given in the 5\'->3\' order such that the RT template directly follows this sequence. A common value ends with \'GGCACCGAGUCGGUGC\'.\
-        \nprime_editing_pegRNA_scaffold_min_match_length (OPTIONAL): Minimum number of bases matching scaffold sequence for the read to be counted as \'Scaffold-incorporated\'. If the scaffold sequence matches the reference sequence at the incorporation site, the minimum number of bases to match will be minimally increased (beyond this parameter) to disambiguate between prime-edited and scaffold-incorporated sequences.\
-        \nprime_editing_override_prime_edited_ref_seq (OPTIONAL): If given, this sequence will be used as the prime-edited reference sequence. This may be useful if the prime-edited reference sequence has large indels or the algorithm cannot otherwise infer the correct reference sequence.\
-        \nquantification_window_coordinates (OPTIONAL): Bp positions in the amplicon sequence specifying the quantification window. This parameter overrides values of the "--quantification_window_center", "-- cleavage_offset", "--window_around_sgrna" or "-- window_around_sgrna" values. Any indels/substitutions outside this window are excluded. Indexes are 0-based, meaning that the first nucleotide is position 0. Ranges are separated by the dash sign like "start-stop", and multiple ranges can be separated by the underscore (\_). A value of 0 disables this filter. (can be comma-separated list of values, corresponding to amplicon sequences given in --amplicon_seq e.g. 5-10,5-10_20-30 would specify the 5th-10th bp in the first reference and the 5th-10th and 20th-30th bp in the second reference) (default: None)\
-        \nquantification_window_size (OPTIONAL): Defines the size (in bp) of the quantification window extending from the position specified by the "--cleavage_offset" or "--quantification_window_center" parameter in relation to the provided guide RNA sequence(s) (--sgRNA). Mutations within this number of bp from the quantification window center are used in classifying reads as modified or unmodified. A value of 0 disables this window and indels in the entire amplicon are considered. Default is 1, 1bp on each side of the cleavage position for a total length of 2bp.\
-        \nquantification_window_center (OPTIONAL): Center of quantification window to use within respect to the 3\' end of the provided sgRNA sequence. Remember that the sgRNA sequence must be entered without the PAM. For cleaving nucleases, this is the predicted cleavage position. The default is -3 and is suitable for the Cas9 system. For alternate nucleases, other cleavage offsets may be appropriate, for example, if using Cpf1 this parameter would be set to 1. For base editors, this could be set to -17.', default='')
-
-        #tool specific optional
-        parser.add_argument('--gene_annotations', type=str, help='Gene Annotation Table from UCSC Genome Browser Tables (http://genome.ucsc.edu/cgi-bin/hgTables?command=start), \
-        please select as table "knownGene", as output format "all fields from selected table" and as file returned "gzip compressed"', default='')
-        # rationale for setting the default scores:
-        # --end-to-end - no clipping, match bonus -ma is set to 0
-        # -N 0 number of mismatches allowed in seed alignment
-        # --np 0 where read (or ref have ambiguous character (N)) penalty is 0
-        # -mp 3,2 mismatch penalty - set max mismatch to -3 to coincide with the gap extension penalty (2 is the default min mismatch penalty)
-        # --score-min L,-5,-3*(1-H) For a given homology score, we allow up to (1-H) mismatches (-3) or gap extensions (-3) and one gap open (-5). This score translates to -5 + -3(1-H)L where L is the sequence length
-        parser.add_argument('--bowtie2_options_string', type=str, help='Override options for the Bowtie2 alignment command. By default, this is " --end-to-end -N 0 --np 0 -mp 3,2 --score-min L,-5,-3(1-H)" where H is the default homology score.', default='')
-        parser.add_argument('--use_legacy_bowtie2_options_string', help='Use legacy (more stringent) Bowtie2 alignment parameters: " -k 1 --end-to-end -N 0 --np 0 ".', action='store_true')
-        parser.add_argument('--min_reads_to_use_region',  type=float, help='Minimum number of reads that align to a region to perform the CRISPResso analysis', default=1000)
-        parser.add_argument('--skip_failed',  help='Continue with pooled analysis even if one sample fails', action='store_true')
-        parser.add_argument('--skip_reporting_problematic_regions', help='Skip reporting of problematic regions. By default, when both amplicons (-f) and genome (-x) are provided, problematic reads that align to the genome but to positions other than where the amplicons align are reported as problematic', action='store_true')
-        parser.add_argument('--crispresso_command', help='CRISPResso command to call', default='CRISPResso')
-        parser.add_argument('--compile_postrun_references', help='If set, a file will be produced which compiles the reference sequences of frequent amplicons.', action='store_true')
-        parser.add_argument('--compile_postrun_reference_allele_cutoff', type=float, help='Only alleles with at least this percentage frequency in the population will be reported in the postrun analysis. This parameter is given as a percent, so 30 is 30%%.', default=30)
-        parser.add_argument('--alternate_alleles', type=str, help='Path to tab-separated file with alternate allele sequences for pooled experiments. This file has the columns "region_name","reference_seqs", and "reference_names" and gives the reference sequences of alternate alleles that will be passed to CRISPResso for each individual region for allelic analysis. Multiple reference alleles and reference names for a given region name are separated by commas (no spaces).', default='')
-        parser.add_argument('--limit_open_files_for_demux', help='If set, only one file will be opened during demultiplexing of read alignment locations. This will be slightly slower as the reads must be sorted, but may be necessary if the number of amplicons is greater than the number of files that can be opened due to OS constraints.', action='store_true')
-        parser.add_argument('--aligned_pooled_bam', type=str, help='Path to aligned input for CRISPRessoPooled processing. If this parameter is specified, the alignments in the given bam will be used to demultiplex reads. If this parameter is not set (default), input reads provided by --fastq_r1 (and optionally --fastq_r2) will be aligned to the reference genome using bowtie2. If the input bam is given, the corresponding reference fasta must also be given to extract reference genomic sequences via the parameter --bowtie2_index. Note that if the aligned reads are paired-end sequenced, they should already be merged into 1 read (e.g. via Flash) before alignment.', default=None)
-        parser.add_argument('--demultiplex_only_at_amplicons', help='If set, and an amplicon file (--amplicons_file) and reference sequence (--bowtie2_index) are provided, reads overlapping alignment positions of amplicons will be demultiplexed and assigned to that amplicon. If this flag is not set, the entire genome will be demultiplexed and reads with the same start and stop coordinates as an amplicon will be assigned to that amplicon.', action='store_true')
+        parser = CRISPRessoShared.getCRISPRessoArgParser("Pooled", parser_title = 'CRISPRessoPooled Parameters')
 
         args = parser.parse_args()
 
+        if args.use_matplotlib or not CRISPRessoShared.is_C2Pro_installed():
+            from CRISPResso2 import CRISPRessoPlot
+        else:
+            from CRISPRessoPro import plot as CRISPRessoPlot
+
         CRISPRessoShared.set_console_log_level(logger, args.verbosity, args.debug)
 
-        crispresso_options = CRISPRessoShared.get_crispresso_options()
+        crispresso_options = CRISPRessoShared.get_core_crispresso_options()
         options_to_ignore = {'fastq_r1', 'fastq_r2', 'amplicon_seq', 'amplicon_name', 'output_folder', 'name', 'zip_output', 'split_interleaved_input'}
         crispresso_options_for_pooled = list(crispresso_options-options_to_ignore)
 
@@ -359,7 +327,7 @@ def main():
 
         log_filename = _jp('CRISPRessoPooled_RUNNING_LOG.txt')
         logger.addHandler(logging.FileHandler(log_filename))
-        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoPooled_status.txt')))
+        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoPooled_status.json')))
 
         if args.zip_output and not args.place_report_in_output_folder:
             logger.warn('Invalid arguement combination: If zip_output is True then place_report_in_output_folder must also be True. Setting place_report_in_output_folder to True.')
@@ -533,87 +501,72 @@ def main():
                 CRISPRessoShared.force_symlink(os.path.abspath(args.fastq_r1), symlink_filename)
                 output_forward_filename = symlink_filename
             else:
+                info('Trimming sequences with fastp...')
                 output_forward_filename = _jp('reads.trimmed.fq.gz')
-                # Trimming with trimmomatic
-                info('Trimming sequences with Trimmomatic...', {'percent_complete': 7})
-                cmd = '%s SE -phred33 %s %s %s >>%s 2>&1'\
-                    % (args.trimmomatic_command, args.fastq_r1,
-                        output_forward_filename,
-                        args.trimmomatic_options_string,
-                        log_filename)
-                # print cmd
-                TRIMMOMATIC_STATUS = sb.call(cmd, shell=True)
-
-                if TRIMMOMATIC_STATUS:
-                    raise TrimmomaticException('TRIMMOMATIC failed to run, please check the log file.')
+                cmd = '{command} -i {r1} -o {out} {options} --json {json_report} --html {html_report} >> {log} 2>&1'.format(
+                    command=args.fastp_command,
+                    r1=args.fastq_r1,
+                    out=output_forward_filename,
+                    options=args.fastp_options_string,
+                    json_report=_jp('fastp_report.json'),
+                    html_report=_jp('fastp_report.html'),
+                    log=log_filename,
+                )
+                fastp_status = sb.call(cmd, shell=True)
+
+                if fastp_status:
+                    raise CRISPRessoShared.FastpException('FASTP failed to run, please check the log file.')
+                info('Done!', {'percent_complete': 7})
 
             processed_output_filename = output_forward_filename
 
         else:  # paired end reads case
             if not args.trim_sequences:
-                output_forward_paired_filename = args.fastq_r1
-                output_reverse_paired_filename = args.fastq_r2
+                args.fastp_options_string += ' --disable_adapter_trimming --disable_trim_poly_g --disable_quality_filtering --disable_length_filtering'
             else:
-                info('Trimming sequences with Trimmomatic...', {'percent_complete': 7})
-                output_forward_paired_filename = _jp('output_forward_paired.fq.gz')
-                output_forward_unpaired_filename = _jp('output_forward_unpaired.fq.gz')
-                output_reverse_paired_filename = _jp('output_reverse_paired.fq.gz')
-                output_reverse_unpaired_filename = _jp('output_reverse_unpaired.fq.gz')
-
-                # Trimming with trimmomatic
-                cmd = '%s PE -phred33 %s  %s %s  %s  %s  %s %s >>%s 2>&1'\
-                    % (args.trimmomatic_command,
-                        args.fastq_r1, args.fastq_r2, output_forward_paired_filename,
-                        output_forward_unpaired_filename, output_reverse_paired_filename,
-                        output_reverse_unpaired_filename, args.trimmomatic_options_string, log_filename)
-                # print cmd
-                TRIMMOMATIC_STATUS = sb.call(cmd, shell=True)
-                if TRIMMOMATIC_STATUS:
-                    raise TrimmomaticException('TRIMMOMATIC failed to run, please check the log file.')
-
-                info('Done!')
-
-            max_overlap_string = ""
-            min_overlap_string = ""
-            if args.max_paired_end_reads_overlap:
-                max_overlap_string = "--max-overlap " + str(args.max_paired_end_reads_overlap)
-            if args.min_paired_end_reads_overlap:
-                min_overlap_string = "--min-overlap " + str(args.min_paired_end_reads_overlap)
-            # Merging with Flash
-            info('Merging paired sequences with Flash...', {'percent_complete': 10})
-            cmd = args.flash_command+' --allow-outies %s %s %s %s -z -d %s >>%s 2>&1' %\
-                (output_forward_paired_filename,
-                 output_reverse_paired_filename,
-                 max_overlap_string,
-                 min_overlap_string,
-                 OUTPUT_DIRECTORY, log_filename)
-
-            if args.debug:
-                info('Flash command: %s'%cmd)
+                args.fastp_options_string += ' --detect_adapter_for_pe'
 
-            FLASH_STATUS = sb.call(cmd, shell=True)
-            if FLASH_STATUS:
-                raise FlashException('Flash failed to run, please check the log file.')
+            processed_output_filename = _jp('out.extendedFrags.fastq.gz')
+            not_combined_1_filename = _jp('out.notCombined_1.fastq.gz')
+            not_combined_2_filename = _jp('out.notCombined_2.fastq.gz')
+
+            info('Merging paired sequences with fastp...')
+            fastp_cmd = '{command} -i {r1} -I {r2} --merge --merged_out {out_merged} --unpaired1 {unpaired1} --unpaired2 {unpaired2} --overlap_len_require {min_overlap} --thread {num_threads} --json {json_report} --html {html_report} {options} >> {log} 2>&1'.format(
+                command=args.fastp_command,
+                r1=args.fastq_r1,
+                r2=args.fastq_r2,
+                out_merged=processed_output_filename,
+                unpaired1=not_combined_1_filename,
+                unpaired2=not_combined_2_filename,
+                min_overlap=args.min_paired_end_reads_overlap,
+                num_threads=n_processes_for_pooled,
+                json_report=_jp('fastp_report.json'),
+                html_report=_jp('fastp_report.html'),
+                options=args.fastp_options_string,
+                log=log_filename,
+            )
+            fastp_status = sb.call(fastp_cmd, shell=True)
 
-            flash_hist_filename = _jp('out.hist')
-            flash_histogram_filename = _jp('out.histogram')
-            flash_not_combined_1_filename = _jp('out.notCombined_1.fastq.gz')
-            flash_not_combined_2_filename = _jp('out.notCombined_2.fastq.gz')
+            if args.debug:
+                info('Fastp command: {0}'.format(fastp_cmd))
 
-            processed_output_filename = _jp('out.extendedFrags.fastq.gz')
+            if fastp_status:
+                raise CRISPRessoShared.FastpException('Fastp failed to run, please check the log file.')
+            crispresso2_info['running_info']['fastp_command'] = fastp_cmd
 
             if args.force_merge_pairs:
-                old_flashed_filename = processed_output_filename
                 new_merged_filename = _jp('out.forcemerged_uncombined.fastq.gz')
-                num_reads_force_merged = CRISPRessoShared.force_merge_pairs(flash_not_combined_1_filename, flash_not_combined_2_filename, new_merged_filename)
+                num_reads_force_merged = CRISPRessoShared.force_merge_pairs(not_combined_1_filename, not_combined_2_filename, new_merged_filename)
                 new_output_filename = _jp('out.forcemerged.fastq.gz')
-                merge_command = "cat %s %s > %s"%(processed_output_filename, new_merged_filename, new_output_filename)
-                MERGE_STATUS = sb.call(merge_command, shell=True)
-                if MERGE_STATUS:
-                    raise FlashException('Force-merging read pairs failed to run, please check the log file.')
+                merge_command = "cat {0} {1} > {2}".format(processed_output_filename, new_merged_filename, new_output_filename)
+                merge_status = sb.call(merge_command, shell=True)
+                if merge_status:
+                    raise CRISPRessoShared.FastpException('Force-merging read pairs failed to run, please check the log file.')
+                else:
+                    info(f'Forced {num_reads_force_merged} read pairs together.')
                 processed_output_filename = new_output_filename
 
-            info('Done!')
+            info('Done!', {'percent_complete': 7})
 
         if can_finish_incomplete_run and 'count_input_reads' in crispresso2_info['running_info']['finished_steps']:
             (N_READS_INPUT, N_READS_AFTER_PREPROCESSING) = crispresso2_info['running_info']['finished_steps']['count_input_reads']
@@ -660,7 +613,7 @@ def main():
                     head_line = amplicons_fin.readline()
                 header_els = head_line.split('\t')
 
-            head_lookup = CRISPRessoShared.get_crispresso_options_lookup()  # dict of qwc -> quantification_window_coordinates
+            head_lookup = CRISPRessoShared.get_crispresso_options_lookup("Core")  # dict of qwc -> quantification_window_coordinates
 
             # add legacy CRISPRessoPooled headers to the head_lookup
             # lowercase input header names for matching - they'll get fixed in the matching to default_input_amplicon_headers
@@ -891,7 +844,6 @@ def main():
 
                 else:
                     warn('Skipping amplicon [%s] because no reads align to it\n'% idx)
-
             CRISPRessoMultiProcessing.run_crispresso_cmds(crispresso_cmds, n_processes_for_pooled, 'amplicon', args.skip_failed, start_end_percent=(16, 80))
             # Initialize array to track failed runs
             failed_batch_arr = []
diff --git a/CRISPResso2/CRISPRessoPooledWGSCompareCORE.py b/CRISPResso2/CRISPRessoPooledWGSCompareCORE.py
index abac3cea..09cdd33f 100644
--- a/CRISPResso2/CRISPRessoPooledWGSCompareCORE.py
+++ b/CRISPResso2/CRISPRessoPooledWGSCompareCORE.py
@@ -231,7 +231,7 @@ def main():
 
         log_filename = _jp('CRISPRessoPooledWGSCompare_RUNNING_LOG.txt')
         logger.addHandler(logging.FileHandler(log_filename))
-        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoPooledWGSCompare_status.txt')))
+        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoPooledWGSCompare_status.json')))
 
         with open(log_filename, 'w+') as outfile:
             outfile.write(
diff --git a/CRISPResso2/CRISPRessoReports/CRISPRessoReport.py b/CRISPResso2/CRISPRessoReports/CRISPRessoReport.py
index c1e11c7c..c4c17fd7 100644
--- a/CRISPResso2/CRISPRessoReports/CRISPRessoReport.py
+++ b/CRISPResso2/CRISPRessoReports/CRISPRessoReport.py
@@ -5,10 +5,23 @@
 '''
 
 import os
-from jinja2 import Environment, FileSystemLoader
+from jinja2 import Environment, FileSystemLoader, PackageLoader, ChoiceLoader
 from jinja_partials import generate_render_partial, render_partial
 from CRISPResso2 import CRISPRessoShared
 
+if CRISPRessoShared.is_C2Pro_installed():
+    from CRISPRessoPro import __version__ as CRISPRessoProVersion
+    C2PRO_INSTALLED = True
+else:
+    C2PRO_INSTALLED = False
+
+
+def get_jinja_loader(_ROOT):
+    if CRISPRessoShared.is_C2Pro_installed():
+        return Environment(loader=ChoiceLoader([FileSystemLoader(os.path.join(_ROOT, 'CRISPRessoReports', 'templates')), PackageLoader('CRISPRessoPro', 'templates')]))    
+    else:
+        return Environment(loader=FileSystemLoader(os.path.join(_ROOT, 'CRISPRessoReports', 'templates')))
+
 
 def render_template(template_name, jinja2_env, **data):
     """Render a template with partials.
@@ -36,6 +49,7 @@ def custom_partial_render(partial_template_name, **partial_data):
             ),
             is_default_user=False,
             is_web=False,
+            C2PRO_INSTALLED=C2PRO_INSTALLED,
         )
         return template.render(**partial_data)
     return render_partial(
@@ -59,8 +73,8 @@ def make_report_from_folder(crispresso_report_file, crispresso_folder, _ROOT):
     make_report(run_data, crispresso_report_file, crispresso_folder, _ROOT)
 
 
-def add_fig_if_exists(fig_name, fig_root, fig_title, fig_caption, fig_data,
-                      amplicon_fig_names, amplicon_figures, crispresso_folder):
+def add_fig_if_exists(fig, fig_name, fig_root, fig_title, fig_caption, fig_data,
+                      amplicon_fig_names, amplicon_figures, crispresso_folder, d3_nuc_quilt_names):
     """
         Helper function to add figure if the file exists
         if fig at filename exists,
@@ -69,8 +83,9 @@ def add_fig_if_exists(fig_name, fig_root, fig_title, fig_caption, fig_data,
     # fullpath=os.path.join(crispresso_folder,fig_root+'.png')
     pngfullpath = os.path.join(crispresso_folder, fig_root + '.png')
     htmlfullpath = os.path.join(crispresso_folder, fig_root + '.html')
+    jsonfullpath = os.path.join(crispresso_folder, f'plot_{fig_root}.json')
     #            print('adding file ' + fig_root + ' at ' + fullpath)
-    if os.path.exists(pngfullpath) or os.path.exists(htmlfullpath):
+    if os.path.exists(pngfullpath) or os.path.exists(htmlfullpath) or os.path.exists(jsonfullpath):
         amplicon_fig_names.append(fig_name)
         # amplicon_fig_locs[fig_name]=os.path.basename(fig_root+'.png')
         amplicon_figures['locs'][fig_name] = os.path.basename(fig_root)
@@ -86,6 +101,14 @@ def add_fig_if_exists(fig_name, fig_root, fig_title, fig_caption, fig_data,
                 html_string += html.read()
                 html_string += "</div>"
             amplicon_figures['htmls'][fig_name] = html_string
+        elif os.path.exists(jsonfullpath) and C2PRO_INSTALLED:
+            root_name = fig_root.replace('.', '_').replace('-', '_')
+            d3_nuc_quilt_names.append(f"nuc_quilt_{root_name}")
+            with open(jsonfullpath) as fig_json_fh:
+                amplicon_figures['htmls'][fig_name] = f"""
+                <div class="d-flex justify-content-between" style="max-height: 80vh; overflow-y: auto;" id="{f"nuc_quilt_{root_name}"}"></div>
+                <script type="text/javascript">const {f"nuc_quilt_{root_name}"} = {fig_json_fh.read().strip()}</script>
+                    """
 
 
 def assemble_figs(run_data, crispresso_folder):
@@ -93,15 +116,16 @@ def assemble_figs(run_data, crispresso_folder):
         Helper function create the data structre for the figures
     """
     figures = {'names': {}, 'locs': {}, 'titles': {}, 'captions': {}, 'datas': {}, 'htmls': {}, 'sgRNA_based_names': {}}
+    d3_nuc_quilt_names = []
 
     global_fig_names = []
     for fig in ['1a', '1b', '1c', '1d', '5a', '6a', '8a', '11c']:
         fig_name = 'plot_' + fig
         if fig_name + '_root' in run_data['results']['general_plots']:
-            add_fig_if_exists(fig_name, run_data['results']['general_plots'][fig_name + '_root'], 'Figure ' + fig,
+            add_fig_if_exists(fig, fig_name, run_data['results']['general_plots'][fig_name + '_root'], 'Figure ' + fig,
                               run_data['results']['general_plots'][fig_name + '_caption'],
                               run_data['results']['general_plots'][fig_name + '_data'],
-                              global_fig_names, figures, crispresso_folder)
+                              global_fig_names, figures, crispresso_folder, d3_nuc_quilt_names)
 
     amplicons = []
     for amplicon_name in run_data['results']['ref_names']:
@@ -112,11 +136,11 @@ def assemble_figs(run_data, crispresso_folder):
                     '11a']:
             fig_name = 'plot_' + fig
             if fig_name + '_root' in run_data['results']['refs'][amplicon_name]:
-                add_fig_if_exists(fig_name, run_data['results']['refs'][amplicon_name][fig_name + '_root'],
+                add_fig_if_exists(fig, fig_name, run_data['results']['refs'][amplicon_name][fig_name + '_root'],
                                   'Figure ' + fig_name,
                                   run_data['results']['refs'][amplicon_name][fig_name + '_caption'],
                                   run_data['results']['refs'][amplicon_name][fig_name + '_data'],
-                                  global_fig_names, amplicon_figures, crispresso_folder)
+                                  global_fig_names, amplicon_figures, crispresso_folder, d3_nuc_quilt_names)
 
         this_sgRNA_based_fig_names = {}
         for fig in ['2b', '9', '10d', '10e', '10f', '10g', '11b']:
@@ -125,10 +149,10 @@ def assemble_figs(run_data, crispresso_folder):
             if 'plot_' + fig + '_roots' in run_data['results']['refs'][amplicon_name]:
                 for idx, plot_root in enumerate(run_data['results']['refs'][amplicon_name]['plot_' + fig + '_roots']):
                     fig_name = "plot_" + fig + "_" + str(idx)
-                    add_fig_if_exists(fig_name, plot_root, 'Figure ' + fig_name + ' sgRNA ' + str(idx + 1),
+                    add_fig_if_exists(fig, fig_name, plot_root, 'Figure ' + fig_name + ' sgRNA ' + str(idx + 1),
                                       run_data['results']['refs'][amplicon_name]['plot_' + fig + '_captions'][idx],
                                       run_data['results']['refs'][amplicon_name]['plot_' + fig + '_datas'][idx],
-                                      this_fig_names, amplicon_figures, crispresso_folder)
+                                      this_fig_names, amplicon_figures, crispresso_folder, d3_nuc_quilt_names)
             this_sgRNA_based_fig_names[fig] = this_fig_names
 
         figures['names'][amplicon_name] = amplicon_figures['names']
@@ -139,7 +163,7 @@ def assemble_figs(run_data, crispresso_folder):
         figures['captions'][amplicon_name] = amplicon_figures['captions']
         figures['datas'][amplicon_name] = amplicon_figures['datas']
         figures['htmls'][amplicon_name] = amplicon_figures['htmls']
-    data = {'amplicons': amplicons, 'figures': figures}
+    data = {'amplicons': amplicons, 'figures': figures, 'nuc_quilt_names': d3_nuc_quilt_names}
     return data
 
 
@@ -166,9 +190,10 @@ def make_report(run_data, crispresso_report_file, crispresso_folder, _ROOT):
         'run_data': run_data,
         'report_display_name': report_display_name,
         'crispresso_data_path': crispresso_data_path,
+        'nuc_quilt_names': data['nuc_quilt_names'],
     }
 
-    j2_env = Environment(loader=FileSystemLoader(os.path.join(_ROOT, 'CRISPRessoReports', 'templates')))
+    j2_env = get_jinja_loader(_ROOT)
 
     #    dest_dir = os.path.dirname(crispresso_report_file)
     #    shutil.copy2(os.path.join(_ROOT,'templates','CRISPResso_justcup.png'),dest_dir)
@@ -176,7 +201,7 @@ def make_report(run_data, crispresso_report_file, crispresso_folder, _ROOT):
 
     with open(crispresso_report_file, 'w', encoding="utf-8") as outfile:
         outfile.write(render_template(
-            'report.html', j2_env, report_data=report_data,
+            'report.html', j2_env, report_data=report_data, C2PRO_INSTALLED=C2PRO_INSTALLED,
         ))
 
 
@@ -259,6 +284,15 @@ def make_batch_report_from_folder(crispressoBatch_report_file, crispresso2_info,
         with open(line_plot_path, encoding="utf-8") as fh:
             allele_modification_line_plot['htmls'][line_plot_name] = fh.read()
 
+    summary_plot_htmls = {}
+    for plot_name in window_nuc_pct_quilts + nuc_pct_quilts:
+        if os.path.exists(os.path.join(batch_folder, f'{plot_name}.json')):
+            with open(os.path.join(batch_folder, f'{plot_name}.json')) as window_nuc_pct_json_fh:
+                summary_plot_htmls[plot_name] = f"""
+            <div class="d-flex justify-content-between" style="max-height: 80vh; overflow-y: auto;" id="{plot_name}"></div>
+            <script type="text/javascript">const {plot_name} = {window_nuc_pct_json_fh.read().strip()}</script>
+            """
+
     #find path between the report and the data (if the report is in another directory vs in the same directory as the data)
     crispresso_data_path = os.path.relpath(batch_folder, os.path.dirname(crispressoBatch_report_file))
     if crispresso_data_path == ".":
@@ -302,6 +336,7 @@ def make_batch_report_from_folder(crispressoBatch_report_file, crispresso2_info,
             'titles': summary_plot_titles,
             'labels': summary_plot_labels,
             'datas': summary_plot_datas,
+            'htmls': summary_plot_htmls,
         },
         window_nuc_pct_quilts=window_nuc_pct_quilts,
         nuc_pct_quilts=nuc_pct_quilts,
@@ -490,9 +525,8 @@ def fill_default(dictionary, key, default_type=list):
         if key not in dictionary:
             dictionary[key] = default_type()
 
-    j2_env = Environment(
-        loader=FileSystemLoader(os.path.join(_ROOT, 'CRISPRessoReports', 'templates')),
-    )
+    j2_env = get_jinja_loader(_ROOT)
+
     j2_env.filters['dirname'] = dirname
     if crispresso_tool == 'batch':
         template = 'batchReport.html'
@@ -538,6 +572,7 @@ def fill_default(dictionary, key, default_type=list):
             'titles': [],
             'labels': [],
             'datas': [],
+            'htmls': [],
         }
 
     for html in sub_html_files:
@@ -556,7 +591,7 @@ def fill_default(dictionary, key, default_type=list):
                 'titles': summary_plots['titles'],
                 'labels': summary_plots['labels'],
                 'datas': summary_plots['datas'],
-                'htmls': [],
+                'htmls': summary_plots['htmls'] if 'htmls' in summary_plots else [],
                 'crispresso_data_path': crispresso_data_path,
             },
             run_names=run_names,
@@ -575,6 +610,7 @@ def fill_default(dictionary, key, default_type=list):
             allele_modification_line_plot_titles=allele_modification_line_plot['titles'],
             allele_modification_line_plot_labels=allele_modification_line_plot['labels'],
             allele_modification_line_plot_datas=allele_modification_line_plot['datas'],
+            C2PRO_INSTALLED=C2PRO_INSTALLED,
         ))
 
 
diff --git a/CRISPResso2/CRISPRessoReports/templates/batchReport.html b/CRISPResso2/CRISPRessoReports/templates/batchReport.html
index 49a6c9ea..fe4a0200 100644
--- a/CRISPResso2/CRISPRessoReports/templates/batchReport.html
+++ b/CRISPResso2/CRISPRessoReports/templates/batchReport.html
@@ -76,8 +76,12 @@ <h5>Nucleotide percentages around guides</h5>
               </div>
               <div class='card-body'>
                 {% for plot_name in window_nuc_pct_quilts %}
-                    <h5>{{report_data['titles'][plot_name]}}</h5>
-		            {{ render_partial('shared/partials/fig_summaries.html', report_data=report_data, plot_name=plot_name) }}
+                  <h5>{{report_data['titles'][plot_name]}}</h5>
+                  {% if plot_name in report_data['htmls'] %}
+                    {{ report_data['htmls'][plot_name]|safe }}
+                  {% else %}
+                    {{ render_partial('shared/partials/fig_summaries.html', report_data=report_data, plot_name=plot_name) }}
+                  {% endif %}
                 {% endfor %}
               </div>
             </div>
@@ -90,8 +94,12 @@ <h5>Nucleotide percentages in the entire amplicon</h5>
               </div>
               <div class='card-body'>
                 {% for plot_name in nuc_pct_quilts %}
-                    <h5>{{report_data['titles'][plot_name]}}</h5>
-		            {{ render_partial('shared/partials/fig_summaries.html', report_data=report_data, plot_name=plot_name) }}
+                  <h5>{{report_data['titles'][plot_name]}}</h5>
+                  {% if plot_name in report_data['htmls'] %}
+                    {{ report_data['htmls'][plot_name]|safe }}
+                  {% else %}
+                    {{ render_partial('shared/partials/fig_summaries.html', report_data=report_data, plot_name=plot_name) }}
+                  {% endif %}
                 {% endfor %}
               </div>
             </div>
@@ -257,4 +265,8 @@ <h5>{{allele_modification_heatmap_plot_titles[heatmap_plot_name]}}</h5>
 {% endblock %}
 
 {% block foot %}
+{% if C2PRO_INSTALLED %}
+  <script src="https://unpkg.com/d3@5"></script>
+  {{ render_partial('partials/batch_d3.html', nucleotide_quilt_slugs=(window_nuc_pct_quilts + nuc_pct_quilts))}}
+{% endif %}
 {% endblock %}
diff --git a/CRISPResso2/CRISPRessoReports/templates/layout.html b/CRISPResso2/CRISPRessoReports/templates/layout.html
index a028254c..f7a616a4 100644
--- a/CRISPResso2/CRISPRessoReports/templates/layout.html
+++ b/CRISPResso2/CRISPRessoReports/templates/layout.html
@@ -9,7 +9,6 @@
     <link href='https://fonts.googleapis.com/css?family=Montserrat|Ranga:700' rel='stylesheet' type='text/css'>
         <link rel="stylesheet" href="https://cdnjs.cloudflare.com/ajax/libs/bootstrap/5.1.3/css/bootstrap.min.css" integrity="sha512-GQGU0fMMi238uA+a/bdWJfpUGKUkBdgfFdgBm72SUQ6BeyWjoY/ton0tEjH+OSH9iP4Dfh+7HM0I9f5eR0L/4w==" crossorigin="anonymous" referrerpolicy="no-referrer" />    <link rel="stylesheet" href="https://cdnjs.cloudflare.com/ajax/libs/fancybox/3.3.5/jquery.fancybox.min.css" />
     <link rel="stylesheet" href="https://use.fontawesome.com/releases/v5.0.13/css/all.css" integrity="sha384-DNOHZ68U8hZfKXOrtjWvjxusGo9WQnrNx2sqG0tfsghAvtVlRW3tvkXWZh58N9jp" crossorigin="anonymous">
-
     <style>
       body {
         font-family: 'Montserrat', sans-serif !important;
@@ -63,9 +62,6 @@
     <!-- Replace favicon.ico & apple-touch-icon.png in the root of your domain and delete these references -->
     {% if is_web %}
     <link rel="shortcut icon" href="/static/favicon.ico">
-    <link rel="stylesheet" href="/static/css/main.css">
-    <script src="/static/js/htmx-1.9.1.min.js"></script>
-    <link rel="apple-touch-icon" href="/apple-touch-icon.png">
     {% else %}
     <link rel="shortcut icon" href="http://crispresso.pinellolab.org/static/favicon.ico" />
     {% endif %}
diff --git a/CRISPResso2/CRISPRessoReports/templates/pooledReport.html b/CRISPResso2/CRISPRessoReports/templates/pooledReport.html
index 899f39c1..ea95254f 100644
--- a/CRISPResso2/CRISPRessoReports/templates/pooledReport.html
+++ b/CRISPResso2/CRISPRessoReports/templates/pooledReport.html
@@ -40,7 +40,9 @@
 	}
 }
 </style>
-
+{% if C2PRO_INSTALLED %}
+<script src="https://cdn.plot.ly/plotly-2.11.1.min.js"></script>
+{% endif %}
 {% endblock %}
 
 {% block content %}
diff --git a/CRISPResso2/CRISPRessoReports/templates/report.html b/CRISPResso2/CRISPRessoReports/templates/report.html
index 9214d168..0650b56f 100644
--- a/CRISPResso2/CRISPRessoReports/templates/report.html
+++ b/CRISPResso2/CRISPRessoReports/templates/report.html
@@ -73,7 +73,9 @@
  }
 }
 </style>
-
+{% if C2PRO_INSTALLED %}
+<script src="https://cdn.plot.ly/plotly-2.11.1.min.js"></script>
+{% endif %}
 {% endblock %}
 
 {% block content %}
@@ -86,6 +88,7 @@
 					{% if report_data['report_display_name'] != '' %}
 					<h5>{{report_data['report_display_name']}}</h5>
 					{% endif %}
+					{{ render_partial('shared/partials/guardrail_warnings.html', report_data=report_data) }}
 					<h5>CRISPResso2 run information</h5>
 					<ul class="nav nav-tabs justify-content-center card-header-tabs" id="log-tab" role="tablist">
 						<li class="nav-item">
@@ -176,7 +179,7 @@ <h5>Global splicing analysis</h5>
 			{# end of global coding sequence analysis #}
 
 			{# start hdr summary #}
-			{% if report_data['figures']['locs'][report_data.amplicons[0]]['plot_4g'] %}
+			{% if report_data['figures']['locs'][report_data.amplicons[0]]['plot_4g'] or 'plot_4g' in report_data['figures']['htmls'][amplicon_name] %}
 			<div class='card text-center mb-2 breakinpage'>
 				<div class='card-header'>
 					{% if report_data.amplicons|length == 1 %} {# if only one amplicon #}
@@ -186,7 +189,11 @@ <h5>HDR summary report (all reads aligned to {{report_data.amplicons[0]}})</h5>
 					{% endif %}
 				</div>
 				<div class='card-body'>
-					{{ render_partial('shared/partials/fig_reports.html', report_data=report_data, fig_name='plot_4g', amplicon_name=report_data.amplicons[0])}}
+					{% if 'plot_4g' in report_data['figures']['htmls'][amplicon_name] %}
+						{{ report_data['figures']['htmls'][amplicon_name]['plot_4g']|safe }}
+					{% else %}
+						{{ render_partial('shared/partials/fig_reports.html', report_data=report_data, fig_name='plot_4g', amplicon_name=report_data.amplicons[0])}}
+					{% endif %}
 				</div>
 			</div>
 			{% endif %}
@@ -291,28 +298,33 @@ <h5>Nucleotide composition for {{amplicon_name}}</h5>
 								{% endif %}
       							</div>
       							<div class='card-body'>
-								{% if report_data['figures']['locs'][amplicon_name]['plot_2a'] %}
-								<div class='div_zoom_outer d-none d-md-block' style="height:100px;border:1px solid #DDDDDD;position:relative">
-									<div id="zoomview_nucs_{{amplicon_name}}" style="position:absolute;left:0;height:100%;width:100%;background-image: url({{report_data['crispresso_data_path']}}{{report_data['figures']['locs'][amplicon_name]['plot_2a']}}.png);background-size:auto 100%;background-repeat:no-repeat;"></div>
-  										<div class="d-lg-none" style="overflow-x:scroll;overflow-y:hidden;position:absolute;width:100%;height:100%">
-	  										<img src="{{report_data['crispresso_data_path']}}{{report_data['figures']['locs'][amplicon_name]['plot_2a']}}.png" style='height:100%'>
-  										</div>
-								</div>
+
+								{% if 'plot_2a' in report_data['figures']['htmls'][amplicon_name] %}
+								  	{{ report_data['figures']['htmls'][amplicon_name]['plot_2a']|safe }}
+								{% elif report_data['figures']['locs'][amplicon_name]['plot_2a'] %}
+									<div class='div_zoom_outer d-none d-md-block' style="height:100px;border:1px solid #DDDDDD;position:relative">
+										<div id="zoomview_nucs_{{amplicon_name}}" style="position:absolute;left:0;height:100%;width:100%;background-image: url({{report_data['crispresso_data_path']}}{{report_data['figures']['locs'][amplicon_name]['plot_2a']}}.png);background-size:auto 100%;background-repeat:no-repeat;"></div>
+											<div class="d-lg-none" style="overflow-x:scroll;overflow-y:hidden;position:absolute;width:100%;height:100%">
+												<img src="{{report_data['crispresso_data_path']}}{{report_data['figures']['locs'][amplicon_name]['plot_2a']}}.png" style='height:100%'>
+											</div>
+									</div>
 									<div style='position:relative;display:inline-block;width:95%'>
 										<a href="{{report_data['crispresso_data_path']}}{{report_data['figures']['locs'][amplicon_name]['plot_2a']}}.pdf">
     									<div id='zoomlens_nucs_{{amplicon_name}}' class="d-none d-lg-block" style='float: left;position: absolute;left: 0px;top: 0px;z-index: 1000;border: 1px solid #DDDDDD;height:100%;width:10%'></div>
     										<img id='tozoom_nucs_{{amplicon_name}}' src="{{report_data['crispresso_data_path']}}{{report_data['figures']['locs'][amplicon_name]['plot_2a']}}.png" width='100%' style='position:relative'></a>
-										</div>
-										<label class="labelpadding">
-  										<span class='d-none d-md-block'>Hover your mouse over the bottom image to zoom in on a specific region.</span><br>
-  											{{report_data['figures']['captions'][amplicon_name]['plot_2a']}}
-										</label>
-							  			{% for (data_label,data_path) in report_data['figures']['datas'][amplicon_name]['plot_2a'] %}
-							  			<p class="m-0"><small>Data: <a href="{{report_data['crispresso_data_path']}}{{data_path}}">{{data_label}}</a></small></p>
-                						{% endfor %}
+									</div>
+									<label class="labelpadding">
+										<span class='d-none d-md-block'>Hover your mouse over the bottom image to zoom in on a specific region.</span><br>
+											{{report_data['figures']['captions'][amplicon_name]['plot_2a']}}
+									</label>
 								{% endif %}
-
-								{% if report_data['figures']['sgRNA_based_names'][amplicon_name] and  report_data['figures']['sgRNA_based_names'][amplicon_name]['2b']%}
+								{% for (data_label,data_path) in report_data['figures']['datas'][amplicon_name]['plot_2a'] %}
+									<p class="m-0"><small>Data: <a href="{{report_data['crispresso_data_path']}}{{data_path}}">{{data_label}}</a></small></p>
+								{% endfor %}
+								
+								{% if 'plot_2b' in report_data['figures']['htmls'][amplicon_name] %}
+								  	{{ report_data['figures']['htmls'][amplicon_name]['plot_2b']|safe }}
+								{% elif report_data['figures']['sgRNA_based_names'][amplicon_name] and  report_data['figures']['sgRNA_based_names'][amplicon_name]['2b']%}
   									{% for fig_name in report_data['figures']['sgRNA_based_names'][amplicon_name]['2b'] %}
 									{{ render_partial('shared/partials/fig_reports.html', report_data=report_data, fig_name=fig_name, amplicon_name=amplicon_name)}}
   									{% endfor %}
@@ -711,4 +723,11 @@ <h5>Base editing for {{amplicon_name}}</h5>
 		{% endif %}
 	{% endfor %}
 	</script>
+
+
+{% if C2PRO_INSTALLED %}
+  <script src="https://unpkg.com/d3@5"></script>
+  {{ render_partial('partials/batch_d3.html', nucleotide_quilt_slugs=(report_data['nuc_quilt_names'])) }}
+{% endif %}
+
 {% endblock %}
diff --git a/CRISPResso2/CRISPRessoReports/templates/shared/partials/guardrail_warnings.html b/CRISPResso2/CRISPRessoReports/templates/shared/partials/guardrail_warnings.html
new file mode 100644
index 00000000..2e7f6cad
--- /dev/null
+++ b/CRISPResso2/CRISPRessoReports/templates/shared/partials/guardrail_warnings.html
@@ -0,0 +1,5 @@
+{% if 'guardrails_htmls' in report_data['run_data']['results'] and report_data['run_data']['results']['guardrails_htmls']|length > 0 %}
+	{% for message in report_data['run_data']['results']['guardrails_htmls'] %}
+		{{message}}
+	{% endfor %}
+{% endif %}
\ No newline at end of file
diff --git a/CRISPResso2/CRISPRessoShared.py b/CRISPResso2/CRISPRessoShared.py
index 8e82c4e3..036d48d9 100644
--- a/CRISPResso2/CRISPRessoShared.py
+++ b/CRISPResso2/CRISPRessoShared.py
@@ -11,6 +11,7 @@
 import json
 import sys
 import importlib.util
+from pathlib import Path
 
 import numpy as np
 import os
@@ -27,15 +28,11 @@
 from CRISPResso2 import CRISPResso2Align
 from CRISPResso2 import CRISPRessoCOREResources
 
-__version__ = "2.2.15"
+__version__ = "2.3.0"
 
 
 ###EXCEPTIONS############################
-class FlashException(Exception):
-    pass
-
-
-class TrimmomaticException(Exception):
+class FastpException(Exception):
     pass
 
 
@@ -91,7 +88,7 @@ class StatusFormatter(logging.Formatter):
     def format(self, record):
         record.percent_complete = ''
         if record.args and 'percent_complete' in record.args:
-            record.percent_complete = '{0:.2f}% '.format(record.args['percent_complete'])
+            record.percent_complete = float(record.args['percent_complete'])
             self.last_percent_complete = record.percent_complete
         elif hasattr(self, 'last_percent_complete'): # if we don't have a percent complete, use the last one
             record.percent_complete = self.last_percent_complete
@@ -101,7 +98,7 @@ def format(self, record):
 class StatusHandler(logging.FileHandler):
     def __init__(self, filename):
         super().__init__(filename, 'w')
-        self.setFormatter(StatusFormatter('%(percent_complete)s%(message)s'))
+        self.setFormatter(StatusFormatter('{\n  "message": "%(message)s",\n  "percent_complete": %(percent_complete)s\n}'))
 
     def emit(self, record):
         """Overwrite the existing file and write the new log."""
@@ -137,263 +134,52 @@ def set_console_log_level(logger, level, debug=False):
             break
 
 
-def getCRISPRessoArgParser(parser_title="CRISPResso Parameters", required_params=[], suppress_params=[]):
+def getCRISPRessoArgParser(tool, parser_title="CRISPResso Parameters"):
     parser = argparse.ArgumentParser(description=parser_title, formatter_class=argparse.ArgumentDefaultsHelpFormatter)
     parser.add_argument('--version', action='version', version='%(prog)s ' + __version__)
-    if 'fastq_r1' not in suppress_params:
-        parser.add_argument('-r1', '--fastq_r1', type=str, help='First fastq file', default='',
-                            required='fastq_r1' in required_params)
-    if 'fastq_r2' not in suppress_params:
-        parser.add_argument('-r2', '--fastq_r2', type=str, help='Second fastq file for paired end reads', default='')
-    if 'amplicon_seq' not in suppress_params:
-        parser.add_argument('-a', '--amplicon_seq', type=str,
-                            help='Amplicon Sequence (can be comma-separated list of multiple sequences)',
-                            required='amplicon_seq' in required_params)
-    if 'amplicon_name' not in suppress_params:
-        parser.add_argument('-an', '--amplicon_name', type=str,
-                            help='Amplicon Name (can be comma-separated list of multiple names, corresponding to amplicon sequences given in --amplicon_seq',
-                            default='Reference')
-    parser.add_argument('-amas', '--amplicon_min_alignment_score', type=str,
-                        help='Amplicon Minimum Alignment Score; score between 0 and 100; sequences must have at least this homology score with the amplicon to be aligned (can be comma-separated list of multiple scores, corresponding to amplicon sequences given in --amplicon_seq)',
-                        default="")
-    parser.add_argument('--default_min_aln_score', '--min_identity_score', type=int,
-                        help='Default minimum homology score for a read to align to a reference amplicon', default=60)
-    parser.add_argument('--expand_ambiguous_alignments',
-                        help='If more than one reference amplicon is given, reads that align to multiple reference amplicons will count equally toward each amplicon. Default behavior is to exclude ambiguous alignments.',
-                        action='store_true')
-    parser.add_argument('--assign_ambiguous_alignments_to_first_reference',
-                        help='If more than one reference amplicon is given, ambiguous reads that align with the same score to multiple amplicons will be assigned to the first amplicon. Default behavior is to exclude ambiguous alignments.',
-                        action='store_true')
-    parser.add_argument('-g', '--guide_seq', '--sgRNA',
-                        help="sgRNA sequence, if more than one, please separate by commas. Note that the sgRNA needs to be input as the guide RNA sequence (usually 20 nt) immediately adjacent to but not including the PAM sequence (5' of NGG for SpCas9). If the PAM is found on the opposite strand with respect to the Amplicon Sequence, ensure the sgRNA sequence is also found on the opposite strand. The CRISPResso convention is to depict the expected cleavage position using the value of the parameter '--quantification_window_center' nucleotides from the 3' end of the guide. In addition, the use of alternate nucleases besides SpCas9 is supported. For example, if using the Cpf1 system, enter the sequence (usually 20 nt) immediately 3' of the PAM sequence and explicitly set the '--cleavage_offset' parameter to 1, since the default setting of -3 is suitable only for SpCas9.",
-                        default='')
-    parser.add_argument('-gn', '--guide_name', help="sgRNA names, if more than one, please separate by commas.",
-                        default='')
-    parser.add_argument('-fg', '--flexiguide_seq',
-                        help="sgRNA sequence (flexible) (can be comma-separated list of multiple flexiguides). The flexiguide sequence will be aligned to the amplicon sequence(s), as long as the guide sequence has homology as set by --flexiguide_homology.")
-    parser.add_argument('-fh', '--flexiguide_homology', type=int,
-                        help="flexiguides will yield guides in amplicons with at least this homology to the flexiguide sequence.",
-                        default=80)
-    parser.add_argument('-fgn', '--flexiguide_name', help="flexiguide name", default='')
-    parser.add_argument('--discard_guide_positions_overhanging_amplicon_edge',
-                        help="If set, for guides that align to multiple positions, guide positions will be discarded if plotting around those regions would included bp that extend beyond the end of the amplicon. ",
-                        action='store_true')
-    parser.add_argument('-e', '--expected_hdr_amplicon_seq', help='Amplicon sequence expected after HDR', default='')
-    parser.add_argument('-c', '--coding_seq',
-                        help='Subsequence/s of the amplicon sequence covering one or more coding sequences for frameshift analysis. If more than one (for example, split by intron/s), please separate by commas.',
-                        default='')
-
-    # quality filtering options
-    parser.add_argument('-q', '--min_average_read_quality', type=int,
-                        help='Minimum average quality score (phred33) to keep a read', default=0)
-    parser.add_argument('-s', '--min_single_bp_quality', type=int,
-                        help='Minimum single bp score (phred33) to keep a read', default=0)
-    parser.add_argument('--min_bp_quality_or_N', type=int,
-                        help='Bases with a quality score (phred33) less than this value will be set to "N"', default=0)
-
-    # output options
-    parser.add_argument('--file_prefix', help='File prefix for output plots and tables', default='')
-    parser.add_argument('-n', '--name',
-                        help='Output name of the report (default: the name is obtained from the filename of the fastq file/s used in input)',
-                        default='')
-    parser.add_argument("--suppress_amplicon_name_truncation",help="If set, amplicon names will not be truncated when creating output filename prefixes. If not set, amplicon names longer than 21 characters will be truncated when creating filename prefixes.",
-                        action='store_true')
-    parser.add_argument('-o', '--output_folder', help='Output folder to use for the analysis (default: current folder)',
-                        default='')
-    parser.add_argument('-v', '--verbosity', type=int, help='Verbosity level of output to the console (1-4), 4 is the most verbose', default=3)
-
-    ## read preprocessing params
-    if 'split_interleaved_input' not in suppress_params:
-        parser.add_argument('--split_interleaved_input', '--split_paired_end',
-                            help='Splits a single fastq file containing paired end reads into two files before running CRISPResso',
-                            action='store_true')
-    parser.add_argument('--trim_sequences', help='Enable the trimming of Illumina adapters with Trimmomatic',
-                        action='store_true')
-    parser.add_argument('--trimmomatic_command', type=str, help='Command to run trimmomatic', default='trimmomatic')
-    parser.add_argument('--trimmomatic_options_string', type=str,
-                        help='Override options for Trimmomatic, e.g. "ILLUMINACLIP:/data/NexteraPE-PE.fa:0:90:10:0:true"',
-                        default='')
-    parser.add_argument('--flash_command', type=str, help='Command to run flash', default='flash')
-    parser.add_argument('--min_paired_end_reads_overlap', type=int,
-                        help='Parameter for the FLASH read merging step. Minimum required overlap length between two reads to provide a confident overlap. ',
-                        default=10)
-    parser.add_argument('--max_paired_end_reads_overlap', type=int,
-                        help='Parameter for the FLASH merging step.  Maximum overlap length expected in approximately 90%% of read pairs. Please see the FLASH manual for more information.',
-                        default=100)
-    parser.add_argument('--stringent_flash_merging',
-                        help='Use stringent parameters for flash merging. In the case where flash could merge R1 and R2 reads ambiguously, the expected overlap is calculated as 2*average_read_length - amplicon_length. The flash parameters for --min-overlap and --max-overlap will be set to prefer merged reads with length within 10bp of the expected overlap. These values override the --min_paired_end_reads_overlap or --max_paired_end_reads_overlap CRISPResso parameters.',
-                        action='store_true')
-    parser.add_argument('--force_merge_pairs', help=argparse.SUPPRESS,
-                        action='store_true')  # help=Force-merges R1 and R2 if they cannot be merged using flash (use with caution -- may create non-biological apparent indels at the joining site)
-
-    # quantification window params
-    parser.add_argument('-w', '--quantification_window_size', '--window_around_sgrna', type=str,
-                        help='Defines the size (in bp) of the quantification window extending from the position specified by the "--cleavage_offset" or "--quantification_window_center" parameter in relation to the provided guide RNA sequence(s) (--sgRNA). Mutations within this number of bp from the quantification window center are used in classifying reads as modified or unmodified. A value of 0 disables this window and indels in the entire amplicon are considered. Default is 1, 1bp on each side of the cleavage position for a total length of 2bp. Multiple quantification window sizes (corresponding to each guide specified by --guide_seq) can be specified with a comma-separated list.',
-                        default='1')
-    parser.add_argument('-wc', '--quantification_window_center', '--cleavage_offset', type=str,
-                        help="Center of quantification window to use within respect to the 3' end of the provided sgRNA sequence. Remember that the sgRNA sequence must be entered without the PAM. For cleaving nucleases, this is the predicted cleavage position. The default is -3 and is suitable for the Cas9 system. For alternate nucleases, other cleavage offsets may be appropriate, for example, if using Cpf1 this parameter would be set to 1. For base editors, this could be set to -17 to only include mutations near the 5' end of the sgRNA. Multiple quantification window centers (corresponding to each guide specified by --guide_seq) can be specified with a comma-separated list.",
-                        default='-3')
-    #    parser.add_argument('--cleavage_offset', type=str, help="Predicted cleavage position for cleaving nucleases with respect to the 3' end of the provided sgRNA sequence. Remember that the sgRNA sequence must be entered without the PAM. The default value of -3 is suitable for the Cas9 system. For alternate nucleases, other cleavage offsets may be appropriate, for example, if using Cpf1 this parameter would be set to 1. To suppress the cleavage offset, enter 'N'.", default=-3)
-    parser.add_argument('--exclude_bp_from_left', type=int,
-                        help='Exclude bp from the left side of the amplicon sequence for the quantification of the indels',
-                        default=15)
-    parser.add_argument('--exclude_bp_from_right', type=int,
-                        help='Exclude bp from the right side of the amplicon sequence for the quantification of the indels',
-                        default=15)
-    parser.add_argument('--use_legacy_insertion_quantification',
-                        help='If set, the legacy insertion quantification method will be used (i.e. with a 1bp quantification window, indels at the cut site and 1bp away from the cut site would be quantified). By default (if this parameter is not set) with a 1bp quantification window, only insertions at the cut site will be quantified.',
-                        action='store_true')
-
-    parser.add_argument('--ignore_substitutions',
-                        help='Ignore substitutions events for the quantification and visualization',
-                        action='store_true')
-    parser.add_argument('--ignore_insertions', help='Ignore insertions events for the quantification and visualization',
-                        action='store_true')
-    parser.add_argument('--ignore_deletions', help='Ignore deletions events for the quantification and visualization',
-                        action='store_true')
-    parser.add_argument('--discard_indel_reads',
-                        help='Discard reads with indels in the quantification window from analysis',
-                        action='store_true')
-
-    # alignment parameters
-    parser.add_argument('--needleman_wunsch_gap_open', type=int, help='Gap open option for Needleman-Wunsch alignment',
-                        default=-20)
-    parser.add_argument('--needleman_wunsch_gap_extend', type=int,
-                        help='Gap extend option for Needleman-Wunsch alignment', default=-2)
-    parser.add_argument('--needleman_wunsch_gap_incentive', type=int,
-                        help='Gap incentive value for inserting indels at cut sites', default=1)
-    parser.add_argument('--needleman_wunsch_aln_matrix_loc', type=str,
-                        help='Location of the matrix specifying substitution scores in the NCBI format (see ftp://ftp.ncbi.nih.gov/blast/matrices/)',
-                        default='EDNAFULL')
-    parser.add_argument('--aln_seed_count', type=int, default=5,
-                        help=argparse.SUPPRESS)  # help='Number of seeds to test whether read is forward or reverse',default=5)
-    parser.add_argument('--aln_seed_len', type=int, default=10,
-                        help=argparse.SUPPRESS)  # help='Length of seeds to test whether read is forward or reverse',default=10)
-    parser.add_argument('--aln_seed_min', type=int, default=2,
-                        help=argparse.SUPPRESS)  # help='number of seeds that must match to call the read forward/reverse',default=2)
-
-    # plotting parameters
-    parser.add_argument('--plot_histogram_outliers',
-                        help="If set, all values will be shown on histograms. By default (if unset), histogram ranges are limited to plotting data within the 99 percentile.",
-                        action='store_true')
-
-    # allele plot parameters
-    parser.add_argument('--plot_window_size', '--offset_around_cut_to_plot', type=int,
-                        help='Defines the size of the window extending from the quantification window center to plot. Nucleotides within plot_window_size of the quantification_window_center for each guide are plotted.',
-                        default=20)
-    parser.add_argument('--min_frequency_alleles_around_cut_to_plot', type=float,
-                        help='Minimum %% reads required to report an allele in the alleles table plot.', default=0.2)
-    parser.add_argument('--expand_allele_plots_by_quantification',
-                        help='If set, alleles with different modifications in the quantification window (but not necessarily in the plotting window (e.g. for another sgRNA)) are plotted on separate lines, even though they may have the same apparent sequence. To force the allele plot and the allele table to be the same, set this parameter. If unset, all alleles with the same sequence will be collapsed into one row.',
-                        action='store_true')
-    parser.add_argument('--allele_plot_pcts_only_for_assigned_reference',
-                        help='If set, in the allele plots, the percentages will show the percentage as a percent of reads aligned to the assigned reference. Default behavior is to show percentage as a percent of all reads.',
-                        action='store_true')
-    parser.add_argument('-qwc', '--quantification_window_coordinates', type=str,
-                        help='Bp positions in the amplicon sequence specifying the quantification window. This parameter overrides values of the "--quantification_window_center", "--cleavage_offset", "--window_around_sgrna" or "--window_around_sgrna" values. Any indels/substitutions outside this window are excluded. Indexes are 0-based, meaning that the first nucleotide is position 0. Ranges are separted by the dash sign (e.g. "start-stop"), and multiple ranges can be separated by the underscore (_) (can be comma-separated list of values, corresponding to amplicon sequences given in --amplicon_seq e.g. 5-10,5-10_20-30 would specify the 6th-11th bp in the first reference and the 6th-11th and 21st-31st bp in the second reference). ' +
-                             'A value of 0 disables this filter for a particular amplicon (e.g. 0,90-110 This would disable the quantification window for the first amplicon and specify the quantification window of 90-110 for the second).' +
-                             'Note that if there are multiple amplicons provided, and only one quantification window coordinate is provided, the same quantification window will be used for all amplicons and be adjusted to account for insertions/deletions.',
-                        default=None)
-    parser.add_argument('--annotate_wildtype_allele', type=str,
-                        help='Wildtype alleles in the allele table plots will be marked with this string (e.g. **).',
-                        default='')
-
-    # output parameters
-    parser.add_argument('--keep_intermediate', help='Keep all the  intermediate files', action='store_true')
-    parser.add_argument('--dump', help='Dump numpy arrays and pandas dataframes to file for debugging purposes',
-                        action='store_true')
-    parser.add_argument('--write_detailed_allele_table',
-                        help='If set, a detailed allele table will be written including alignment scores for each read sequence.',
-                        action='store_true')
-    parser.add_argument('--fastq_output', help='If set, a fastq file with annotations for each read will be produced.',
-                        action='store_true')
-    parser.add_argument('--bam_output', help='If set, a bam file with alignments for each read will be produced.',
-                        action='store_true')
-    parser.add_argument('-x', '--bowtie2_index', type=str, help='Basename of Bowtie2 index for the reference genome',
-                        default='')
-    parser.add_argument('--zip_output', help="If set, the output will be placed in a zip folder.", action='store_true')
-
-    # report style parameters
-    parser.add_argument('--max_rows_alleles_around_cut_to_plot', type=int,
-                        help='Maximum number of rows to report in the alleles table plot.', default=50)
-    parser.add_argument('--suppress_report', help='Suppress output report', action='store_true')
-    parser.add_argument('--place_report_in_output_folder',
-                        help='If true, report will be written inside the CRISPResso output folder. By default, the report will be written one directory up from the report output.',
-                        action='store_true')
-    parser.add_argument('--suppress_plots', help='Suppress output plots', action='store_true')
-    parser.add_argument('--write_cleaned_report', action='store_true',
-                        help=argparse.SUPPRESS)  # trims working directories from output in report (for web access)
-    parser.add_argument('--config_file', help='File path to JSON file with config elements', type=str)
-
-    # base editor parameters
-    parser.add_argument('--base_editor_output',
-                        help='Outputs plots and tables to aid in analysis of base editor studies.', action='store_true')
-    parser.add_argument('--conversion_nuc_from',
-                        help='For base editor plots, this is the nucleotide targeted by the base editor', default='C')
-    parser.add_argument('--conversion_nuc_to',
-                        help='For base editor plots, this is the nucleotide produced by the base editor', default='T')
-
-    # prime editing parameters
-    parser.add_argument('--prime_editing_pegRNA_spacer_seq', type=str,
-                        help="pegRNA spacer sgRNA sequence used in prime editing. The spacer should not include the PAM sequence. The sequence should be given in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the given sequence.",
-                        default='')
-    parser.add_argument('--prime_editing_pegRNA_extension_seq', type=str,
-                        help="Extension sequence used in prime editing. The sequence should be given in the RNA 5'->3' order, such that the sequence starts with the RT template including the edit, followed by the Primer-binding site (PBS).",
-                        default='')
-    parser.add_argument('--prime_editing_pegRNA_extension_quantification_window_size', type=int,
-                        help="Quantification window size (in bp) at flap site for measuring modifications anchored at the right side of the extension sequence. Similar to the --quantification_window parameter, the total length of the quantification window will be 2x this parameter. Default: 5bp (10bp total window size)",
-                        default=5)
-    parser.add_argument('--prime_editing_pegRNA_scaffold_seq', type=str,
-                        help="If given, reads containing any of this scaffold sequence before extension sequence (provided by --prime_editing_extension_seq) will be classified as 'Scaffold-incorporated'. The sequence should be given in the 5'->3' order such that the RT template directly follows this sequence. A common value is 'GGCACCGAGUCGGUGC'.",
-                        default='')
-    parser.add_argument('--prime_editing_pegRNA_scaffold_min_match_length', type=int,
-                        help="Minimum number of bases matching scaffold sequence for the read to be counted as 'Scaffold-incorporated'. If the scaffold sequence matches the reference sequence at the incorporation site, the minimum number of bases to match will be minimally increased (beyond this parameter) to disambiguate between prime-edited and scaffold-incorporated sequences.",
-                        default=1)
-    parser.add_argument('--prime_editing_nicking_guide_seq', type=str,
-                        help="Nicking sgRNA sequence used in prime editing. The sgRNA should not include the PAM sequence. The sequence should be given in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the sequence",
-                        default='')
-    parser.add_argument('--prime_editing_override_prime_edited_ref_seq', type=str,
-                        help="If given, this sequence will be used as the prime-edited reference sequence. This may be useful if the prime-edited reference sequence has large indels or the algorithm cannot otherwise infer the correct reference sequence.",
-                        default='')
-    parser.add_argument('--prime_editing_override_sequence_checks',
-                        help="If set, checks to assert that the prime editing guides and extension sequence are in the proper orientation are not performed. This may be useful if the checks are failing inappropriately, but the user is confident that the sequences are correct.",
-                        action='store_true')
-    parser.add_argument('--prime_editing_gap_open_penalty',
-                        help=argparse.SUPPRESS, type=int, default=-50)
-                        # help="If set, adjusts the alignment gap open penalty for calculating alignment between pegRNA components (e.g. spacer and extension)."
-    parser.add_argument('--prime_editing_gap_extend_penalty',
-                        help=argparse.SUPPRESS, type=int, default=0)
-                        # help="If set, adjusts the alignment gap extension penalty for calculating alignment between pegRNA components (e.g. spacer and extension). Because prime editing may introduce large insertions/deletions, this is set to 0 to preference these large insertions."
-
-    # special running modes
-    parser.add_argument('--crispresso1_mode', help='Parameter usage as in CRISPResso 1', action='store_true')
-    parser.add_argument('--dsODN', help='Label reads with the dsODN sequence provided', default='')
-    parser.add_argument('--auto', help='Infer amplicon sequence from most common reads', action='store_true')
-    parser.add_argument('--debug', help='Show debug messages', action='store_true')
-    parser.add_argument('--no_rerun',
-                        help="Don't rerun CRISPResso2 if a run using the same parameters has already been finished.",
-                        action='store_true')
-    parser.add_argument('-p', '--n_processes', type=str, help='Specify the number of processes to use for analysis.\
-    Please use with caution since increasing this parameter will significantly increase the memory required to run CRISPResso. Can be set to \'max\'.',
-                        default='1')
-
-    # processing of aligned bam files
-    if 'bam_input' not in suppress_params:
-        parser.add_argument('--bam_input', type=str, help='Aligned reads for processing in bam format', default='')
-    if 'bam_chr_loc' not in suppress_params:
-        parser.add_argument('--bam_chr_loc', type=str,
-                        help='Chromosome location in bam for reads to process. For example: "chr1:50-100" or "chrX".',
-                        default='')
-
-    # deprecated params
-    parser.add_argument('--save_also_png', default=False,
-                        help=argparse.SUPPRESS)  # help='Save also .png images in addition to .pdf files') #depreciated -- now pngs are automatically created. Pngs can be suppressed by '--suppress_report'
 
+    # Getting the directory of the current script
+    current_dir = Path(__file__).parent
+
+    # Adjusting the path to point directly to the args.json file
+    json_path = current_dir / 'args.json'
+
+    with open(json_path, 'r') as json_file:
+        args_dict = json.load(json_file)
+        args_dict = args_dict["CRISPResso_args"]
+    type_mapper = {
+        "str": str,
+        "int": int,
+        "float": float,
+    }
+
+    for key, value in args_dict.items():
+        # print(key, value)
+        tools = value.get('tools', [])  # Default to empty list if 'tools' is not found
+        if tool in tools:
+            action = value.get('action')  # Use None as default if 'action' is not found
+            required = value.get('required', False)  # Use False as default if 'required' is not found
+            default = value.get('default')  # Use None as default if 'default' is not found
+            type_value = value.get('type', 'str')  # Assume 'str' as default type if 'type' is not specified
+            arg_help = value.get('help', '') if value.get('help') != "SUPPRESS" else argparse.SUPPRESS
+
+            # Determine the correct function based on conditions
+            if action:
+                parser.add_argument(*value['keys'], help=arg_help, action=action)
+            elif required and default is None:  # Checks if 'required' is true and 'default' is not provided
+                parser.add_argument(*value['keys'], help=arg_help, type=type_mapper[type_value], required=True)
+            elif required:  # Checks if 'required' is true (default is provided, as checked above)
+                parser.add_argument(*value['keys'], help=arg_help, default=default, type=type_mapper[type_value], required=True)
+            else:  # Case when neither 'action' nor 'required' conditions are met
+                # Here, it handles the case where default might be None, which is a valid scenario
+                kwargs = {'help': arg_help, 'type': type_mapper[type_value]}
+                if default is not None: kwargs['default'] = default  # Add 'default' only if it's specified
+                parser.add_argument(*value['keys'], **kwargs)
     return parser
 
 
-def get_crispresso_options():
-    parser = getCRISPRessoArgParser(parser_title="Temp Params", required_params=[])
+def get_core_crispresso_options():
+    parser = getCRISPRessoArgParser("Core")
     crispresso_options = set()
     d = parser.__dict__['_option_string_actions']
     for key in d.keys():
@@ -403,7 +189,7 @@ def get_crispresso_options():
     return crispresso_options
 
 
-def get_crispresso_options_lookup():
+def get_crispresso_options_lookup(tool):
     ##dict to lookup abbreviated params
     #    crispresso_options_lookup = {
     #    'r1':'fastq_r1',
@@ -413,7 +199,7 @@ def get_crispresso_options_lookup():
     #    .....
     # }
     crispresso_options_lookup = {}
-    parser = getCRISPRessoArgParser(parser_title="Temp Params", required_params=[])
+    parser = getCRISPRessoArgParser(tool)
     d = parser.__dict__['_option_string_actions']
     for key in d.keys():
         d2 = d[key].__dict__['dest']
@@ -896,7 +682,7 @@ def write_crispresso_info(crispresso_output_file, crispresso2_info):
 
     """
     with open(crispresso_output_file, 'w') as fh:
-        json.dump(crispresso2_info, fh, cls=CRISPRessoJSONEncoder)
+        json.dump(crispresso2_info, fh, cls=CRISPRessoJSONEncoder, indent=2)
 
 
 def get_command_output(command):
@@ -923,7 +709,7 @@ def get_command_output(command):
             break
 
 
-def get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, flash_command, max_paired_end_reads_overlap, min_paired_end_reads_overlap, split_interleaved_input=False, debug=False):
+def get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, fastp_command, min_paired_end_reads_overlap, split_interleaved_input=False, debug=False):
     """
     Get the most frequent amplicon from a fastq file (or after merging a r1 and r2 fastq file).
 
@@ -933,8 +719,7 @@ def get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, fla
     fastq_r1: path to fastq r1 (can be gzipped)
     fastq_r2: path to fastq r2 (can be gzipped)
     number_of_reads_to_consider: number of reads from the top of the file to examine
-    min_paired_end_reads_overlap: min overlap in bp for flashing (merging) r1 and r2
-    max_paired_end_reads_overlap: max overlap in bp for flashing (merging) r1 and r2
+    min_paired_end_reads_overlap: min overlap in bp for merging r1 and r2
 
     returns:
     list of amplicon strings sorted by order in format:
@@ -993,15 +778,22 @@ def get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, fla
         view_cmd_2 = 'cat'
         if fastq_r2.endswith('.gz'):
             view_cmd_2 = 'zcat'
-        max_overlap_param = ""
         min_overlap_param = ""
-        if max_paired_end_reads_overlap:
-            max_overlap_param = "--max-overlap=" + str(max_paired_end_reads_overlap)
         if min_paired_end_reads_overlap:
-            min_overlap_param = "--min-overlap=" + str(min_paired_end_reads_overlap)
-        file_generation_command = "bash -c 'paste <(%s \"%s\") <(%s \"%s\")' | head -n %d | paste - - - - | awk -v OFS=\"\\n\" -v FS=\"\\t\" '{print($1,$3,$5,$7,$2,$4,$6,$8)}' | %s - --interleaved-input --allow-outies %s %s --to-stdout 2>/dev/null " % (
-        view_cmd_1, fastq_r1, view_cmd_2, fastq_r2, number_of_reads_to_consider * 4, flash_command, max_overlap_param,
-        min_overlap_param)
+            min_overlap_param = "--overlap_len_require {0}".format(min_paired_end_reads_overlap)
+        file_generation_command = "{paste} | {head} | paste - - - - | {awk} | {fastp}".format(
+            paste="bash -c 'paste <({view_cmd_1} \"{fastq_r1}\") <({view_cmd_2} \"{fastq_r2}\")'".format(
+                view_cmd_1=view_cmd_1, fastq_r1=fastq_r1, view_cmd_2=view_cmd_2, fastq_r2=fastq_r2,
+            ),
+            head='head -n {num_reads}'.format(
+                num_reads=number_of_reads_to_consider * 4,
+            ),
+            awk="awk -v OFS=\"\\n\" -v FS=\"\\t\" '{{print($1,$3,$5,$7,$2,$4,$6,$8)}}'",
+            fastp='{fastp_command} --disable_adapter_trimming --disable_trim_poly_g --disable_quality_filtering --disable_length_filtering --stdin --interleaved_in --merge {min_overlap_param} --stdout 2>/dev/null'.format(
+                fastp_command=fastp_command,
+                min_overlap_param=min_overlap_param,
+            ),
+        )
     count_frequent_cmd = file_generation_command + " | awk '((NR-2)%4==0){print $1}' | sort | uniq -c | sort -nr "
 
     def default_sigpipe():
@@ -1045,7 +837,7 @@ def check_if_failed_run(folder_name, info):
     """
 
     run_data_file = os.path.join(folder_name, 'CRISPResso2_info.json')
-    status_info = os.path.join(folder_name, 'CRISPResso_status.txt')
+    status_info = os.path.join(folder_name, 'CRISPResso_status.json')
     if not os.path.isfile(run_data_file) or not os.path.isfile(status_info):
         info("Skipping folder '%s'. Cannot find run data status file at '%s'."%(folder_name, run_data_file))
         if "CRISPRessoPooled" in folder_name:
@@ -1059,32 +851,42 @@ def check_if_failed_run(folder_name, info):
     else:
         with open(status_info) as fh:
             try:
-                file_contents = fh.read()
-                search_result = re.search(r'(\d+\.\d+)% (.+)', file_contents)
-                if search_result:
-                    percent_complete, status = search_result.groups()
-                    if percent_complete != '100.00':
-                        info("Skipping folder '%s'. Run is not complete (%s)." % (folder_name, status))
-                        return True, status
+                status_dict = json.load(fh)
+                if status_dict['percent_complete'] != 100.0:
+                    info("Skipping folder '%s'. Run is not complete (%s)." % (folder_name, status_dict['status']))
+                    return True, str(status_dict['message'])
                 else:
-                    return True, file_contents
-            except Exception as e:
-                print(e)
-                info("Skipping folder '%s'. Cannot parse status file '%s'." % (folder_name, status_info))
-                return True, "Cannot parse status file '%s'." % (status_info)
-    return False, ""
+                    return False, ""
+            except:
+                pass
 
+        with open(status_info) as fh:
+                try:
+                    file_contents = fh.read()
+                    search_result = re.search(r'(\d+\.\d+)% (.+)', file_contents)
+                    if search_result:
+                        percent_complete, status = search_result.groups()
+                        if percent_complete != '100.00':
+                            info("Skipping folder '%s'. Run is not complete (%s)." % (folder_name, status))
+                            return True, status
+                    else:
+                        return True, file_contents
+                except Exception as e:
+                    print(e)
+                    info("Skipping folder '%s'. Cannot parse status file '%s'." % (folder_name, status_info))
+                    return True, "Cannot parse status file '%s'." % (status_info)
+        return False, ""
 
-def guess_amplicons(fastq_r1,fastq_r2,number_of_reads_to_consider,flash_command,max_paired_end_reads_overlap,min_paired_end_reads_overlap,aln_matrix,needleman_wunsch_gap_open,needleman_wunsch_gap_extend,split_interleaved_input=False,min_freq_to_consider=0.2,amplicon_similarity_cutoff=0.95):
+
+def guess_amplicons(fastq_r1, fastq_r2, number_of_reads_to_consider, fastp_command, min_paired_end_reads_overlap, aln_matrix, needleman_wunsch_gap_open, needleman_wunsch_gap_extend, split_interleaved_input=False, min_freq_to_consider=0.2, amplicon_similarity_cutoff=0.95):
     """
     guesses the amplicons used in an experiment by examining the most frequent read (giant caveat -- most frequent read should be unmodified)
     input:
     fastq_r1: path to fastq r1 (can be gzipped)
     fastq_r2: path to fastq r2 (can be gzipped)
     number_of_reads_to_consider: number of reads from the top of the file to examine
-    flash_command: command to call flash
-    min_paired_end_reads_overlap: min overlap in bp for flashing (merging) r1 and r2
-    max_paired_end_reads_overlap: max overlap in bp for flashing (merging) r1 and r2
+    fastp_command: command to call fastp
+    min_paired_end_reads_overlap: min overlap in bp for merging r1 and r2
     aln_matrix: matrix specifying alignment substitution scores in the NCBI format
     needleman_wunsch_gap_open: alignment penalty assignment used to determine similarity of two sequences
     needleman_wunsch_gap_extend: alignment penalty assignment used to determine similarity of two sequences
@@ -1095,7 +897,7 @@ def guess_amplicons(fastq_r1,fastq_r2,number_of_reads_to_consider,flash_command,
     returns:
     list of putative amplicons
     """
-    seq_lines = get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, flash_command, max_paired_end_reads_overlap, min_paired_end_reads_overlap, split_interleaved_input=split_interleaved_input)
+    seq_lines = get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, fastp_command, min_paired_end_reads_overlap, split_interleaved_input=split_interleaved_input)
 
     curr_amplicon_id = 1
 
@@ -1140,11 +942,11 @@ def guess_amplicons(fastq_r1,fastq_r2,number_of_reads_to_consider,flash_command,
     return amplicon_seq_arr
 
 
-def guess_guides(amplicon_sequence,fastq_r1,fastq_r2,number_of_reads_to_consider,flash_command,max_paired_end_reads_overlap,
-            min_paired_end_reads_overlap,exclude_bp_from_left,exclude_bp_from_right,
-            aln_matrix,needleman_wunsch_gap_open,needleman_wunsch_gap_extend,
-            min_edit_freq_to_consider=0.1,min_edit_fold_change_to_consider=3,
-            pam_seq="NGG", min_pct_subs_in_base_editor_win=0.8,split_interleaved_input=False):
+def guess_guides(amplicon_sequence, fastq_r1, fastq_r2, number_of_reads_to_consider, fastp_command,
+            min_paired_end_reads_overlap, exclude_bp_from_left, exclude_bp_from_right,
+            aln_matrix, needleman_wunsch_gap_open, needleman_wunsch_gap_extend,
+            min_edit_freq_to_consider=0.1, min_edit_fold_change_to_consider=3,
+            pam_seq="NGG", min_pct_subs_in_base_editor_win=0.8, split_interleaved_input=False):
     """
     guesses the guides used in an experiment by identifying the most-frequently edited positions, editing types, and PAM sites
     input:
@@ -1152,9 +954,8 @@ def guess_guides(amplicon_sequence,fastq_r1,fastq_r2,number_of_reads_to_consider
     fastq_r1: path to fastq r1 (can be gzipped)
     fastq_r2: path to fastq r2 (can be gzipped)
     number_of_reads_to_consider: number of reads from the top of the file to examine
-    flash_command: command to call flash
+    fastp_command: command to call fastp
     min_paired_end_reads_overlap: min overlap in bp for flashing (merging) r1 and r2
-    max_paired_end_reads_overlap: max overlap in bp for flashing (merging) r1 and r2
     exclude_bp_from_left: number of bp to exclude from the left side of the amplicon sequence for the quantification of the indels
     exclude_bp_from_right: number of bp to exclude from the right side of the amplicon sequence for the quantification of the indels
     aln_matrix: matrix specifying alignment substitution scores in the NCBI format
@@ -1170,7 +971,7 @@ def guess_guides(amplicon_sequence,fastq_r1,fastq_r2,number_of_reads_to_consider
     tuple of (putative guide, boolean is_base_editor)
     or (None, None)
     """
-    seq_lines = get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, flash_command, max_paired_end_reads_overlap, min_paired_end_reads_overlap,split_interleaved_input=split_interleaved_input)
+    seq_lines = get_most_frequent_reads(fastq_r1, fastq_r2, number_of_reads_to_consider, fastp_command, min_paired_end_reads_overlap,split_interleaved_input=split_interleaved_input)
 
     amp_len = len(amplicon_sequence)
     gap_incentive = np.zeros(amp_len + 1, dtype=int)
@@ -1677,7 +1478,7 @@ def set_guide_array(vals, guides, property_name):
     for idx, val in enumerate(vals_array):
         if val != '':
             ret_array[idx] = int(val)
-    return ret_array        
+    return ret_array
 
 
 def get_relative_coordinates(to_sequence, from_sequence):
@@ -1900,7 +1701,7 @@ def get_crispresso_header(description, header_str):
                 term_width) + "\n" + output_line
 
     output_line += '\n' + ('[CRISPResso version ' + __version__ + ']').center(term_width) + '\n' + (
-        '[Note that starting in version 2.3.0 FLASh and Trimmomatic will be replaced by fastp for read merging and trimming. Accordingly, the --flash_command and --trimmomatic_command parameters will be replaced with --fastp_command. Also, --trimmomatic_options_string will be replaced with --fastp_options_string.\n\nAlso in version 2.3.0, when running CRISPRessoPooled in mixed-mode (amplicon file and genome are provided) the default behavior will be as if the --demultiplex_only_at_amplicons parameter is provided. This change means that reads and amplicons do not need to align to the exact locations.]').center(
+        '[Note that as of version 2.3.0 FLASh and Trimmomatic have been replaced by fastp for read merging and trimming. Accordingly, the --flash_command and --trimmomatic_command parameters have been replaced with --fastp_command. Also, --trimmomatic_options_string has been replaced with --fastp_options_string.\n\nAlso in version 2.3.1, when running CRISPRessoPooled in mixed-mode (amplicon file and genome are provided) the default behavior will be as if the --demultiplex_only_at_amplicons parameter is provided. This change means that reads and amplicons do not need to align to the exact locations.]').center(
         term_width) + "\n" + ('[For support contact k.clement@utah.edu or support@edilytics.com]').center(term_width) + "\n"
 
     description_str = ""
@@ -1976,7 +1777,7 @@ def zip_results(results_folder):
 
 def is_C2Pro_installed():
     try:
-        spec = importlib.util.find_spec("crispressoPro")
+        spec = importlib.util.find_spec("CRISPRessoPro")
         if spec is None:
             return False
         else:
@@ -1995,50 +1796,497 @@ def check_custom_config(args):
 
     Returns:
     -------------
-    style : dict
-        A dict with a 'colors' key that contains hex color values for different report items.
-
-    -OR-
-
-    custom_style : dict
-        A dict with a 'colors' key that contains hex color values for different report items loaded from a user provided json file.
-
+    config : dict
+        A dict with a 'colors' key that contains hex color values for different report items as well as a 'guardrails' key that contains the guardrail values.
     """
     config =  {
         "colors": {
-                'Substitution': '#0000FF',
-                'Insertion': '#008000',
-                'Deletion': '#FF0000',
-                'A': '#7FC97F',
-                'T': '#BEAED4',
-                'C': '#FDC086',
-                'G': '#FFFF99',
-                'N': '#C8C8C8',
-                '-': '#1E1E1E',
-                }
-            }
+            'Substitution': '#0000FF',
+            'Insertion': '#008000',
+            'Deletion': '#FF0000',
+            'A': '#7FC97F',
+            'T': '#BEAED4',
+            'C': '#FDC086',
+            'G': '#FFFF99',
+            'N': '#C8C8C8',
+            '-': '#1E1E1E',
+        },
+        "guardrails": {
+            'min_total_reads': 10000,
+            'aligned_cutoff': 0.9,
+            'alternate_alignment': 0.3,
+            'min_ratio_of_mods_in_to_out': 0.01,
+            'modifications_at_ends': 0.01,
+            'outside_window_max_sub_rate': 0.002,
+            'max_rate_of_subs': 0.3,
+            'guide_len': 19,
+            'amplicon_len': 50,
+            'amplicon_to_read_length': 1.5
+        }
+    }
 
     logger = logging.getLogger(getmodule(stack()[1][0]).__name__)
-
-    #Check if crispresso.pro is installed
     if not is_C2Pro_installed():
         return config
+
     if args.config_file:
         try:
             with open(args.config_file, "r") as json_file:
                 custom_config = json.load(json_file)
 
-            if 'colors' not in custom_config.keys():
+            if 'guardrails' in custom_config.keys():
+                for key in config['guardrails']:
+                    if key not in custom_config['guardrails']:
+                        logger.warn(f"Value for {key} not provided, defaulting.")
+                        custom_config['guardrails'][key] = config['guardrails'][key]
+                for key in custom_config['guardrails']:
+                    if key not in config['guardrails']:
+                        logger.warn(f"Key {key} is not a recognized guardrail parameter, skipping.")
+            else:
+                logger.warn("Json file does not contain the guardrails key. Defaulting all values.")
+                custom_config['guardrails'] = config['guardrails']
+
+            if 'colors' in custom_config.keys():
+                for key in config['colors']:
+                    if key not in custom_config['colors']:
+                        logger.warn(f"Value for {key} not provided, defaulting")
+                        custom_config['colors'][key] = config['colors'][key]
+            else:
                 logger.warn("Json file does not contain the colors key. Defaulting all values.")
-                return config
-
-            for key in config['colors']:
-                if key not in custom_config['colors']:
-                    logger.warn(f"Value for {key} not provided, defaulting")
-                    custom_config['colors'][key] = config['colors'][key]
+                custom_config['colors'] = config['colors']
 
             return custom_config
         except Exception as e:
-            logger.warn("Cannot read json file '%s', defaulting style parameters." % args.config_file)
+            logger.warn("Cannot read json file '%s', defaulting config parameters." % args.config_file)
             print(e)
     return config
+
+
+def safety_check(crispresso2_info, aln_stats, guardrails):
+    """Check the results of analysis for potential issues and warns the user.
+
+    Parameters
+    ----------
+    crispresso2_info : dict
+        Dictionary of values describing the analysis
+    aln_stats : dict
+        Dictionary of alignment statistics and modification frequency and location
+    guardrails : dict
+        Contains the following:
+            min_total_reads : int
+                Cutoff value for total reads aligned
+            alignedCutoff : float
+                Check value for the percentage of reads aligned vs not aligned
+            alternateAlignment : float
+                Percentage of variance from expected reads to trigger guardrail
+            minRatioOfModsInToOut : float
+                Float representing the acceptable ratio of modifications in the window to out
+            modificationsAtEnds : float
+                The ratio of reads with modifications at the 0 or -1 spot
+            outsideWindowMaxSubRate : float
+                Ratio of subs allowed outside of the window
+            maxRateOfSubs : float
+                Allowed rate of subs accross the entire read
+            guide_len : int
+                Minimum guide length
+            amplicon_len : int
+                Minimum amplicon length
+            ampliconToReadLen : float
+                Comparison value between amplicons and reads
+    """
+    logger = logging.getLogger(getmodule(stack()[1][0]).__name__)
+    messageHandler = GuardrailMessageHandler(logger)
+
+    # Get amplicon and guide sequences and lengths
+    amplicons = {}
+    guide_groups = set()
+    for name in crispresso2_info['results']['ref_names']:
+        amplicons[name] = crispresso2_info['results']['refs'][name]['sequence_length']
+        guide_groups.update(crispresso2_info['results']['refs'][name]['sgRNA_sequences'])
+    unique_guides = {guide: len(guide) for guide in guide_groups}
+
+    totalReadsGuardrail = TotalReadsGuardrail(messageHandler, guardrails['min_total_reads'])
+    totalReadsGuardrail.safety(aln_stats['N_TOT_READS'])
+
+    overallReadsAlignedGuard = OverallReadsAlignedGuardrail(messageHandler, guardrails['aligned_cutoff'])
+    overallReadsAlignedGuard.safety(aln_stats['N_TOT_READS'], (aln_stats['N_CACHED_ALN'] + aln_stats['N_COMPUTED_ALN']))
+
+    disproportionateReadsAlignedGuardrail = DisproportionateReadsAlignedGuardrail(messageHandler, guardrails['aligned_cutoff'])
+    disproportionateReadsAlignedGuardrail.safety(aln_stats['N_TOT_READS'], crispresso2_info['results']['alignment_stats']['counts_total'])
+
+    lowRatioOfModsInWindowToOut = LowRatioOfModsInWindowToOutGuardrail(messageHandler, guardrails['min_ratio_of_mods_in_to_out'])
+    lowRatioOfModsInWindowToOut.safety(aln_stats['N_MODS_IN_WINDOW'], aln_stats['N_MODS_OUTSIDE_WINDOW'])
+
+    highRateOfModificationAtEndsGuardrail = HighRateOfModificationAtEndsGuardrail(messageHandler, guardrails['modifications_at_ends'])
+    highRateOfModificationAtEndsGuardrail.safety((aln_stats['N_CACHED_ALN'] + aln_stats['N_COMPUTED_ALN']), aln_stats['N_READS_IRREGULAR_ENDS'])
+
+    highRateOfSubstitutionsOutsideWindowGuardrail = HighRateOfSubstitutionsOutsideWindowGuardrail(messageHandler, guardrails['outside_window_max_sub_rate'])
+    highRateOfSubstitutionsOutsideWindowGuardrail.safety(aln_stats['N_GLOBAL_SUBS'], aln_stats['N_SUBS_OUTSIDE_WINDOW'])
+
+    highRateOfSubstitutions = HighRateOfSubstitutionsGuardrail(messageHandler, guardrails['max_rate_of_subs'])
+    highRateOfSubstitutions.safety(aln_stats['N_MODS_IN_WINDOW'], aln_stats['N_MODS_OUTSIDE_WINDOW'], aln_stats['N_GLOBAL_SUBS'])
+
+    shortAmpliconSequence = ShortSequenceGuardrail(messageHandler, guardrails['amplicon_len'], 'amplicon')
+    shortAmpliconSequence.safety(amplicons)
+
+    shortGuideSequence = ShortSequenceGuardrail(messageHandler, guardrails['guide_len'], 'guide')
+    shortGuideSequence.safety(unique_guides)
+
+    longAmpliconShortReadsGuardrail = LongAmpliconShortReadsGuardrail(messageHandler, guardrails['amplicon_to_read_length'])
+    longAmpliconShortReadsGuardrail.safety(amplicons, aln_stats['READ_LENGTH'])
+
+    crispresso2_info['results']['guardrails'] = messageHandler.get_messages()
+
+    return messageHandler.get_html_messages()
+
+
+class GuardrailMessageHandler:
+    """Class to handle message storage and display for guardrails"""
+    def __init__(self, logger):
+        """Create the message handler with an empty message array to collect html divs for the report
+
+        Parameters:
+        ------------
+        logger : logger
+            logger object used to display messages
+        """
+        self.logger = logger
+        self.html_messages = []
+        self.messages = {}
+
+    def display_warning(self, guardrail, message):
+        """Send the message to the logger to be displayed
+
+        Parameters:
+        -----------
+        message : string
+            Related guardrail message
+        """
+        self.logger.warning(message)
+        self.messages[guardrail] = message
+
+    def report_warning(self, message):
+        """Create and store the html message to display on the report
+
+        Parameters:
+        -----------
+        message : string
+            Related guardrail message
+        """
+        html_warning = '<div class="alert alert-danger"><strong>Guardrail Warning!</strong>{0}</div>'.format(message)
+        self.html_messages.append(html_warning)
+
+    def get_messages(self):
+        """Return the messages accumulated by the message handler"""
+        return self.messages
+
+    def get_html_messages(self):
+        """Return the html messages accumulated by the message handler"""
+        return self.html_messages
+
+
+class TotalReadsGuardrail:
+    """Guardrail class: check that the number of reads are above a minimum"""
+    def __init__(self, messageHandler, minimum):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        minimum : int
+            The comparison integer to determine if there are sufficent reads
+        """
+        self.messageHandler = messageHandler
+        self.minimum = minimum
+        self.message = " Low number of total reads: <{}.".format(minimum)
+
+    def safety(self, total_reads):
+        """Safety check, if total is below minimum send warnings
+
+        Parameters:
+        -----------
+        total_reads : int
+            The total reads, unaligned and aligned
+        """
+        if total_reads < self.minimum:
+            self.message = self.message + " Total reads: {}.".format(total_reads)
+            self.messageHandler.display_warning('TotalReadsGuardrail', self.message)
+            self.messageHandler.report_warning(self.message)
+
+
+class OverallReadsAlignedGuardrail:
+    """Guardrail class: check if enough reads are aligned"""
+    def __init__(self, messageHandler, cutoff):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        cutoff : float
+            The float representation of percentage of minimum reads to be aligned
+        """
+        self.messageHandler = messageHandler
+        self.message = " <={val}% of reads were aligned.".format(val=(cutoff * 100))
+        self.cutoff = cutoff
+
+    def safety(self, total_reads, n_read_aligned):
+        """Safety check, if total_reads divided by n_reads_aligned is lower than the cutoff
+
+        Parameters:
+        -----------
+        total_reads : int
+            Total reads, unaligned and aligned
+        n_read_aligned : int
+            Total aligned reads
+        """
+        if total_reads == 0:
+            return
+        if (n_read_aligned/total_reads) <= self.cutoff:
+            self.message = self.message + " Total reads: {}, Aligned reads: {}.".format(total_reads, n_read_aligned)
+            self.messageHandler.display_warning('OverallReadsAlignedGuardrail', self.message)
+            self.messageHandler.report_warning(self.message)
+
+
+class DisproportionateReadsAlignedGuardrail:
+    """Guardrail class: check if the distribution of reads is roughly even across amplicons"""
+    def __init__(self, messageHandler, cutoff):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        cutoff : float
+            The float representation of the accepted percentage deviation from the expected distribution
+        """
+        self.messageHandler = messageHandler
+        self.message = " Disproportionate percentages of reads were aligned to amplicon: "
+        self.cutoff = cutoff
+
+    def safety(self, n_read_aligned, reads_aln_amplicon):
+        """Safety check, if total_reads divided by n_reads_aligned is higher or lower than the total_reads divided by the number of amplicons
+
+        Parameters:
+        -----------
+        total_reads : int
+            Total reads, unaligned and aligned
+        reads_aln_amplicon : dict
+            A dictionary with the names of amplicons as the key and the number of reads aligned as the value
+        """
+        if len(reads_aln_amplicon.keys()) <= 1:
+            return
+        expected_per_amplicon = n_read_aligned / len(reads_aln_amplicon.keys())
+        for amplicon, aligned in reads_aln_amplicon.items():
+            if aligned <= (expected_per_amplicon * self.cutoff) or aligned >= (expected_per_amplicon * (1 - self.cutoff)):
+                amplicon_message = self.message + amplicon + ", Percent of aligned reads aligned to this amplicon: {}%.".format(round((aligned/n_read_aligned) * 100, 2))
+                self.messageHandler.display_warning('DisproportionateReadsAlignedGuardrail', amplicon_message)
+                self.messageHandler.report_warning(amplicon_message)
+
+
+class LowRatioOfModsInWindowToOutGuardrail:
+    """Guardrail class: check the ratio of modifications in the quantification window to out of it"""
+    def __init__(self, messageHandler, cutoff):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        cutoff : float
+            The float representation of the maximum percentage of modifications outside of the quantification window
+        """
+        self.messageHandler = messageHandler
+        self.message = " <={}% of modifications were inside of the quantification window.".format(cutoff * 100)
+        self.cutoff = cutoff
+
+    def safety(self, mods_in_window, mods_outside_window):
+        """Safety check, if the modifications in the window are below a ratio of the total
+
+        Parameters:
+        -----------
+        mods_in_window : int
+            The number of mods in the quantification window
+        mods_outside_window : int
+            The number of mods outside of the quantification window
+        """
+        total_mods = mods_in_window + mods_outside_window
+        if total_mods == 0:
+            return
+        if ((mods_in_window / total_mods) <= self.cutoff):
+            self.message = self.message + " Total modifications: {}, Modifications in window: {}, Modifications outside window: {}.".format(total_mods, mods_in_window, mods_outside_window)
+            self.messageHandler.display_warning('LowRatioOfModsInWindowToOutGuardrail', self.message)
+            self.messageHandler.report_warning(self.message)
+
+
+class HighRateOfModificationAtEndsGuardrail:
+    """Guardrail class: check the ratio of modifications in the quantification window to out of it"""
+    def __init__(self, messageHandler, percentage_start_end):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        percentage_start_end : float
+            The float representation of the maximum percentage reads that have modifications on either end
+        """
+        self.messageHandler = messageHandler
+        self.message = " >={}% of reads have modifications at the start or end.".format(round(percentage_start_end * 100, 2))
+        self.percent = percentage_start_end
+
+    def safety(self, total_reads, irregular_reads):
+        """Safety check, comparison between the number of irregular reads to total reads
+
+        Parameters:
+        -----------
+        total_reads : int
+            The number of mods in the quantification window
+        irregular_reads : int
+            The number of mods outside of the quantification window
+        """
+        if total_reads == 0:
+            return
+        if (irregular_reads / total_reads) >= self.percent:
+            self.message = self.message + " Total reads: {}, Irregular reads: {}.".format(total_reads, irregular_reads)
+            self.messageHandler.display_warning('HighRateOfModificationAtEndsGuardrail', self.message)
+            self.messageHandler.report_warning(self.message)
+
+
+class HighRateOfSubstitutionsOutsideWindowGuardrail:
+    """Guardrail class: check the ratio of global substitutions to substitutions outside of the quantification window"""
+    def __init__(self, messageHandler, cutoff):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        cutoff : float
+            The float representation of how many of the total substitutions can be outside of the quantification window
+        """
+        self.messageHandler = messageHandler
+        self.message = " >={}% of substitutions were outside of the quantification window.".format(cutoff * 100)
+        self.cutoff = cutoff
+
+    def safety(self, global_subs, subs_outside_window):
+        """Safety check, comparison between the number of global subs to subs outside of the quantification window
+
+        Parameters:
+        -----------
+        global_subs : int
+            The number of mods in the quantification window
+        subs_outside_window : int
+            The number of mods outside of the quantification window
+        """
+        if global_subs == 0:
+            return
+        if ((subs_outside_window / global_subs) >= self.cutoff):
+            self.message = self.message + " Total substitutions: {}, Substitutions outside window: {}.".format(global_subs, subs_outside_window)
+            self.messageHandler.display_warning('HighRateOfSubstitutionsOutsideWindowGuardrail', self.message)
+            self.messageHandler.report_warning(self.message)
+
+
+class HighRateOfSubstitutionsGuardrail:
+    """Guardrail class: check the ratio of global substitutions to total modifications"""
+    def __init__(self, messageHandler, cutoff):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        cutoff : float
+            The float representation of how many of the total modifications can be subsitutions
+        """
+        self.messageHandler = messageHandler
+        self.message = " >={}% of modifications were substitutions. This could potentially indicate poor sequencing quality.".format(cutoff * 100)
+        self.cutoff = cutoff
+
+    def safety(self, mods_in_window, mods_outside_window, global_subs):
+        """Safety check, comparison between subsitutions and total modifications
+
+        Parameters:
+        -----------
+        mods_in_window : int
+            Modifications inside of the quantification window
+        mods_outside_window : int
+            Modifications outside of the quantification window
+        global_subs : int
+            Total subsitutions across all reads
+        """
+        total_mods = mods_in_window + mods_outside_window
+        if total_mods == 0:
+            return
+        if ((global_subs / total_mods) >= self.cutoff):
+            self.message = self.message + " Total modifications: {}, Substitutions: {}.".format(total_mods, global_subs)
+            self.messageHandler.display_warning('HighRateOfSubstitutionsGuardrail', self.message)
+            self.messageHandler.report_warning(self.message)
+
+
+class ShortSequenceGuardrail:
+    """Guardrail class: Check to make sure that sequences (amplicons and guides) are above a certain length"""
+    def __init__(self, messageHandler, cutoff, sequence_type):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        cutoff : int
+            Integer value to measure the length of the sequence
+        sequence_type : string
+            Amplicon or guide
+        """
+        self.messageHandler = messageHandler
+        self.cutoff = cutoff
+        self.message = f" {string.capwords(sequence_type)} length <{cutoff}: "
+
+    def safety(self, sequences):
+        """Safety check, comparison between sequence lengths and minimum lengths
+
+        Parameters:
+        -----------
+        sequences : dict
+            Dictionary with the name of the sequence as the key and the length of the sequence as the value
+        """
+        for name, length in sequences.items():
+            if length < self.cutoff:
+                sequence_message = self.message + name + ", Length: {}.".format(length)
+                self.messageHandler.display_warning('ShortSequenceGuardrail', sequence_message)
+                self.messageHandler.report_warning(sequence_message)
+
+
+class LongAmpliconShortReadsGuardrail:
+    """Guardrail class: Check to make sure that the reads are close in size to amplicons"""
+    def __init__(self, messageHandler, cutoff):
+        """Assign variables and create guardrail message
+
+        Parameters:
+        -----------
+        messageHandler : GuardrailMessagehandler
+            Guardrail message handler to create and display warnings
+        cutoff : float
+            The value multiplied by the read length to make sure the amplicon isn't too much longer than the reads.
+
+        """
+        self.messageHandler = messageHandler
+        self.cutoff = cutoff
+        self.message = " Amplicon length is greater than {}x the length of the reads: ".format(cutoff)
+
+    def safety(self, amplicons, read_len):
+        """Safety check, comparison between amplicon length and read length
+
+        Parameters:
+        -----------
+        amplicons : dict
+            Dictionary with the name of the amplicon as the key and the length of the sequence as the value
+        read_len : int
+            Average length of reads
+        """
+        for name, length in amplicons.items():
+            if length > (read_len * self.cutoff):
+                sequence_message = self.message + name + ", Amplicon length: {}, Read length: {}.".format(length, read_len)
+                self.messageHandler.display_warning('LongAmpliconShortReadsGuardrail', sequence_message)
+                self.messageHandler.report_warning(sequence_message)
diff --git a/CRISPResso2/CRISPRessoWGSCORE.py b/CRISPResso2/CRISPRessoWGSCORE.py
index 75d3ce43..5b24b034 100644
--- a/CRISPResso2/CRISPRessoWGSCORE.py
+++ b/CRISPResso2/CRISPRessoWGSCORE.py
@@ -19,8 +19,6 @@
 from CRISPResso2 import CRISPRessoShared
 from CRISPResso2 import CRISPRessoMultiProcessing
 from CRISPResso2.CRISPRessoReports import CRISPRessoReport
-from CRISPResso2 import CRISPRessoPlot
-
 
 import logging
 
@@ -322,33 +320,18 @@ def print_stacktrace_if_debug():
             ))
             sys.exit()
 
-        parser = CRISPRessoShared.getCRISPRessoArgParser(parser_title = 'CRISPRessoWGS Parameters', required_params=[],
-                    suppress_params=[
-                        'bam_input',
-                        'bam_chr_loc',
-                        'fastq_r1',
-                        'fastq_r2',
-                        'amplicon_seq',
-                        'amplicon_name',
-                        'split_interleaved_input',
-                    ])
-
-        #tool specific optional
-        parser.add_argument('-b', '--bam_file', type=str,  help='WGS aligned bam file', required=True, default='bam filename' )
-        parser.add_argument('-f', '--region_file', type=str,  help='Regions description file. A BED format  file containing the regions to analyze, one per line. The REQUIRED\
-        columns are: chr_id(chromosome name), bpstart(start position), bpend(end position), the optional columns are:name (an unique indentifier for the region), guide_seq, expected_hdr_amplicon_seq,coding_seq, see CRISPResso help for more details on these last 3 parameters)', required=True)
-        parser.add_argument('-r', '--reference_file', type=str, help='A FASTA format reference file (for example hg19.fa for the human genome)', default='', required=True)
-        parser.add_argument('--min_reads_to_use_region',  type=float, help='Minimum number of reads that align to a region to perform the CRISPResso analysis', default=10)
-        parser.add_argument('--skip_failed',  help='Continue with pooled analysis even if one sample fails', action='store_true')
-        parser.add_argument('--gene_annotations', type=str, help='Gene Annotation Table from UCSC Genome Browser Tables (http://genome.ucsc.edu/cgi-bin/hgTables?command=start), \
-        please select as table "knownGene", as output format "all fields from selected table" and as file returned "gzip compressed"', default='')
-        parser.add_argument('--crispresso_command', help='CRISPResso command to call', default='CRISPResso')
+        parser = CRISPRessoShared.getCRISPRessoArgParser("WGS", parser_title = 'CRISPRessoWGS Parameters')
 
         args = parser.parse_args()
 
+        if args.use_matplotlib or not CRISPRessoShared.is_C2Pro_installed():
+            from CRISPResso2 import CRISPRessoPlot
+        else:
+            from CRISPRessoPro import plot as CRISPRessoPlot
+
         CRISPRessoShared.set_console_log_level(logger, args.verbosity, args.debug)
 
-        crispresso_options = CRISPRessoShared.get_crispresso_options()
+        crispresso_options = CRISPRessoShared.get_core_crispresso_options()
         options_to_ignore = {'fastq_r1', 'fastq_r2', 'amplicon_seq', 'amplicon_name', 'output_folder', 'name', 'zip_output'}
         crispresso_options_for_wgs = list(crispresso_options-options_to_ignore)
 
@@ -364,7 +347,7 @@ def print_stacktrace_if_debug():
         except:
             warn('Folder %s already exists.' % OUTPUT_DIRECTORY)
 
-        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoWGS_status.txt')))
+        logger.addHandler(CRISPRessoShared.StatusHandler(_jp('CRISPRessoWGS_status.json')))
 
         info('Checking dependencies...')
 
diff --git a/CRISPResso2/args.json b/CRISPResso2/args.json
new file mode 100644
index 00000000..b47cc570
--- /dev/null
+++ b/CRISPResso2/args.json
@@ -0,0 +1,844 @@
+{
+    "CRISPResso_args": {
+        "fastq_r1": {
+            "keys": ["-r1", "--fastq_r1"],
+            "help": "First fastq file",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Pooled"]
+        },
+        "fastq_r2": {
+            "keys": ["-r2", "--fastq_r2"],
+            "help": "Second fastq file for paired end reads",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Pooled"]
+        },
+        "amplicon_seq": {
+            "name": "Amplicon Sequence",
+            "keys": ["-a", "--amplicon_seq"],
+            "help": "Amplicon Sequence (can be comma-separated list of multiple sequences)",
+            "type": "str", 
+            "tools": ["Core", "Batch", "Pooled"]
+        },
+        "amplicon_name": {
+            "name": "Amplicon Name",
+            "keys": ["-an", "--amplicon_name"],
+            "help": "Amplicon Name (can be comma-separated list of multiple names, corresponding to amplicon sequences given in --amplicon_seq",
+            "type": "str",
+            "default": "Reference",
+            "tools": ["Core", "Batch", "Pooled"]
+        },
+        "amplicon_min_alignment_score": {
+            "keys": ["-amas", "--amplicon_min_alignment_score"],
+            "help": "Amplicon Minimum Alignment Score; score between 0 and 100; sequences must have at least this homology score with the amplicon to be aligned (can be comma-separated list of multiple scores, corresponding to amplicon sequences given in --amplicon_seq)",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "default_min_aln_score": {
+            "name": "Default Minimum Alignment Score",
+            "keys": ["--default_min_aln_score", "--min_identity_score"],
+            "help": "Default minimum homology score for a read to align to a reference amplicon",
+            "type": "int",
+            "default": 60,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "expand_ambiguous_alignments": {
+            "keys": ["--expand_ambiguous_alignments"],
+            "help": "If more than one reference amplicon is given, reads that align to multiple reference amplicons will count equally toward each amplicon. Default behavior is to exclude ambiguous alignments.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "assign_ambiguous_alignments_to_first_reference": {
+            "keys": ["--assign_ambiguous_alignments_to_first_reference"],
+            "help": "If more than one reference amplicon is given, ambiguous reads that align with the same score to multiple amplicons will be assigned to the first amplicon. Default behavior is to exclude ambiguous alignments.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "guide_seq": {
+            "keys": ["-g", "--guide_seq", "--sgRNA"],
+            "help": "sgRNA sequence, if more than one, please separate by commas. Note that the sgRNA needs to be input as the guide RNA sequence (usually 20 nt) immediately adjacent to but not including the PAM sequence (5' of NGG for SpCas9). If the PAM is found on the opposite strand with respect to the Amplicon Sequence, ensure the sgRNA sequence is also found on the opposite strand. The CRISPResso convention is to depict the expected cleavage position using the value of the parameter '--quantification_window_center' nucleotides from the 3' end of the guide. In addition, the use of alternate nucleases besides SpCas9 is supported. For example, if using the Cpf1 system, enter the sequence (usually 20 nt) immediately 3' of the PAM sequence and explicitly set the '--cleavage_offset' parameter to 1, since the default setting of -3 is suitable only for SpCas9.",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "guide_name": {
+            "keys": ["-gn", "--guide_name"],
+            "help": "sgRNA names, if more than one, please separate by commas.",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "flexiguide_seq": {
+            "keys": ["-fg", "--flexiguide_seq"],
+            "help": "sgRNA sequence (flexible) (can be comma-separated list of multiple flexiguides). The flexiguide sequence will be aligned to the amplicon sequence(s), as long as the guide sequence has homology as set by --flexiguide_homology.",
+            "type": "str",
+            "default": "None",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "flexiguide_homology": {
+            "keys": ["-fh", "--flexiguide_homology"],
+            "help": "flexiguides will yield guides in amplicons with at least this homology to the flexiguide sequence.",
+            "type": "int",
+            "default": 80,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "flexiguide_name": {
+            "keys": ["-fgn", "--flexiguide_name"],
+            "help": "flexiguide name",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "discard_guide_positions_overhanging_amplicon_edge": {
+            "keys": ["--discard_guide_positions_overhanging_amplicon_edge"],
+            "help": "If set, for guides that align to multiple positions, guide positions will be discarded if plotting around those regions would included bp that extend beyond the end of the amplicon.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "expected_hdr_amplicon_seq": {
+            "name": "Expected HDR Amplicon Sequence:",
+            "keys": ["-e", "--expected_hdr_amplicon_seq"],
+            "help": "Amplicon sequence expected after HDR",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "coding_seq": {
+            "name": "Exon Specification Coding Sequence/s:",
+            "keys": ["-c", "--coding_seq"],
+            "help": "Subsequence/s of the amplicon sequence covering one or more coding sequences for frameshift analysis. If more than one (for example, split by intron/s), please separate by commas.",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "config_file": {
+            "keys": ["--config_file"],
+            "help": "File path to JSON file with config elements",
+            "type": "str",
+            "default": "None",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "min_average_read_quality": {
+            "name": "Minimum Average Read Quality(phred33 Scale)",
+            "keys": ["-q", "--min_average_read_quality"],
+            "help": "Minimum average quality score (phred33) to keep a read",
+            "type": "int",
+            "default": 0,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "min_single_bp_quality": {
+            "name": "Minimum Single bp Quality(phred33 Scale)",
+            "keys": ["-s", "--min_single_bp_quality"],
+            "help": "Minimum single bp score (phred33) to keep a read",
+            "type": "int",
+            "default": 0,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "min_bp_quality_or_N": {
+            "name": "Minimum bp Quality or N(phred33 Scale)",
+            "keys": ["--min_bp_quality_or_N"],
+            "help": "Bases with a quality score (phred33) less than this value will be set to 'N'",
+            "type": "int",
+            "default": 0,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "file_prefix": {
+            "keys": ["--file_prefix"],
+            "help": "File prefix for output plots and tables",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "name": {
+            "name": "Sample Name",
+            "keys": ["-n", "--name"],
+            "help": "Output name of the report (default: the name is obtained from the filename of the fastq file/s used in input)",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "suppress_amplicon_name_truncation": {
+            "keys": ["--suppress_amplicon_name_truncation"],
+            "help": "If set, amplicon names will not be truncated when creating output filename prefixes. If not set, amplicon names longer than 21 characters will be truncated when creating filename prefixes.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "output_folder": {
+            "keys": ["-o", "--output_folder"],
+            "help": "Output folder to use for the analysis (default: current folder)",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "verbosity": {
+            "keys": ["-v", "--verbosity"],
+            "help": "Verbosity level of output to the console (1-4) 4 is the most verbose",
+            "type": "int",
+            "default": 3,
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "split_interleaved_input": {
+            "keys": ["--split_interleaved_input", "--split_paired_end"],
+            "help": "Splits a single fastq file containing paired end reads into two files before running CRISPResso",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled"]
+        },
+        "trim_sequences": {
+            "name": "Trimming Adapter",
+            "keys": ["--trim_sequences"],
+            "help": "Enable the trimming with fastp",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "trimmomatic_command": {
+            "keys": ["--trimmomatic_command"],
+            "help": "DEPRECATED in v2.3.0, use `--fastp_command`",
+            "type": "str",
+            "default": "None",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "trimmomatic_options_string": {
+            "keys": ["--trimmomatic_options_string"],
+            "help": "DEPRECATED in v2.3.0, use `--fastp_options_string`",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "flash_command": {
+            "keys": ["--flash_command"],
+            "help": "DEPRECATED in v2.3.0, use `--fastp_command`",
+            "type": "str",
+            "default": "None",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "fastp_command": {
+            "keys": ["--fastp_command"],
+            "help": "Command to run fastp",
+            "type": "str",
+            "default": "fastp",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "fastp_options_string": {
+            "keys": ["--fastp_options_string"],
+            "help": "Override options for fastp, e.g. `--length_required 70 --umi`",
+            "type": "str",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "min_paired_end_reads_overlap": {
+            "keys": ["--min_paired_end_reads_overlap"],
+            "help": "Parameter for the fastp read merging step. Minimum required overlap length between two reads to provide a confident overlap",
+            "type": "int",
+            "default": 10,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "max_paired_end_reads_overlap": {
+            "keys": ["--max_paired_end_reads_overlap"],
+            "help": "DEPRECATED in v2.3.0",
+            "type": "str",
+            "default": "None",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "stringent_flash_merging": {
+            "keys": ["--stringent_flash_merging"],
+            "help": "DEPRECATED in v2.3.0",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "force_merge_pairs": {
+            "keys": ["--force_merge_pairs"],
+            "action": "store_true",
+            "help": "SUPPRESS",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "quantification_window_size": {
+            "name": "Quantification Window Size",
+            "keys": ["-w", "--quantification_window_size", "--window_around_sgrna"],
+            "help": "Defines the size (in bp) of the quantification window extending from the position specified by the '--cleavage_offset' or '--quantification_window_center' parameter in relation to the provided guide RNA sequence(s) (--sgRNA). Mutations within this number of bp from the quantification window center are used in classifying reads as modified or unmodified. A value of 0 disables this window and indels in the entire amplicon are considered. Default is 1, 1bp on each side of the cleavage position for a total length of 2bp. Multiple quantification window sizes (corresponding to each guide specified by --guide_seq) can be specified with a comma-separated list.",
+            "type": "str",
+            "default": "1",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "quantification_window_center": {
+            "name": "Quantification Window Center",
+            "keys": ["-wc", "--quantification_window_center", "--cleavage_offset"],
+            "help": "Center of quantification window to use within respect to the 3' end of the provided sgRNA sequence. Remember that the sgRNA sequence must be entered without the PAM. For cleaving nucleases, this is the predicted cleavage position. The default is -3 and is suitable for the Cas9 system. For alternate nucleases, other cleavage offsets may be appropriate, for example, if using Cpf1 this parameter would be set to 1. For base editors, this could be set to -17 to only include mutations near the 5' end of the sgRNA. Multiple quantification window centers (corresponding to each guide specified by --guide_seq) can be specified with a comma-separated list.",
+            "type": "str",
+            "default": "-3",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "exclude_bp_from_left": {
+            "name": "Exclude bp From Left",
+            "keys": ["--exclude_bp_from_left"],
+            "help": "Exclude bp from the left side of the amplicon sequence for the quantification of the indels",
+            "type": "int",
+            "default": 15,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "exclude_bp_from_right": {
+            "name": "Exclude bp From Right",
+            "keys": ["--exclude_bp_from_right"],
+            "help": "Exclude bp from the right side of the amplicon sequence for the quantification of the indels",
+            "type": "int",
+            "default": 15,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "use_legacy_insertion_quantification": {
+            "keys": ["--use_legacy_insertion_quantification"],
+            "help": "If set, the legacy insertion quantification method will be used (i.e. with a 1bp quantification window, indels at the cut site and 1bp away from the cut site would be quantified). By default (if this parameter is not set) with a 1bp quantification window, only insertions at the cut site will be quantified.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "ignore_substitutions": {
+            "name": "Ignore Substitutions",
+            "keys": ["--ignore_substitutions"],
+            "help": "Ignore substitutions events for the quantification and visualization",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "ignore_insertions": {
+            "name": "Ignore Insertions",
+            "keys": ["--ignore_insertions"],
+            "help": "Ignore insertions events for the quantification and visualization",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "ignore_deletions": {
+            "name": "Ignore Deletions",
+            "keys": ["--ignore_deletions"],
+            "help": "Ignore deletions events for the quantification and visualization",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "discard_indel_reads": {
+            "keys": ["--discard_indel_reads"],
+            "help": "Discard reads with indels in the quantification window from analysis",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "needleman_wunsch_gap_open": {
+            "keys": ["--needleman_wunsch_gap_open"],
+            "help": "Gap open option for Needleman-Wunsch alignment",
+            "type": "int",
+            "default": -20,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "needleman_wunsch_gap_extend": {
+            "keys": ["--needleman_wunsch_gap_extend"],
+            "help": "Gap extend option for Needleman-Wunsch alignment",
+            "type": "int",
+            "default": -2,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "needleman_wunsch_gap_incentive": {
+            "keys": ["--needleman_wunsch_gap_incentive"],
+            "help": "Gap incentive value for inserting indels at cut sites",
+            "type": "int",
+            "default": 1,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "needleman_wunsch_aln_matrix_loc": {
+            "keys": ["--needleman_wunsch_aln_matrix_loc"],
+            "help": "Location of the matrix specifying substitution scores in the NCBI format (see ftp://ftp.ncbi.nih.gov/blast/matrices/)",
+            "type": "str",
+            "default": "EDNAFULL",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "aln_seed_count": {
+            "keys": ["--aln_seed_count"],
+            "help": "SUPPRESS",
+            "type": "int",
+            "default": 5,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "aln_seed_len": {
+            "keys": ["--aln_seed_len"],
+            "help": "SUPPRESS",
+            "type": "int",
+            "default": 10,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "aln_seed_min": {
+            "keys": ["--aln_seed_min"],
+            "help": "SUPPRESS",
+            "type": "int",
+            "default": 2,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "plot_histogram_outliers": {
+            "keys": ["--plot_histogram_outliers"],
+            "help": "If set, all values will be shown on histograms. By default (if unset), histogram ranges are limited to plotting data within the 99 percentile.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "plot_window_size": {
+            "name": "Plot Window Size",
+            "keys": ["--plot_window_size", "--offset_around_cut_to_plot"],
+            "type": "int",
+            "help": "Defines the size of the window extending from the quantification window center to plot. Nucleotides within plot_window_size of the quantification_window_center for each guide are plotted.",
+            "default": 20,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "min_frequency_alleles_around_cut_to_plot": {
+            "keys": ["--min_frequency_alleles_around_cut_to_plot"],
+            "type": "float",
+            "help": "Minimum %% reads required to report an allele in the alleles table plot.",
+            "default": 0.2,
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "expand_allele_plots_by_quantification": {
+            "keys": ["--expand_allele_plots_by_quantification"],
+            "help": "If set, alleles with different modifications in the quantification window (but not necessarily in the plotting window (e.g. for another sgRNA)) are plotted on separate lines, even though they may have the same apparent sequence. To force the allele plot and the allele table to be the same, set this parameter. If unset, all alleles with the same sequence will be collapsed into one row.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "allele_plot_pcts_only_for_assigned_reference": {
+            "keys": ["--allele_plot_pcts_only_for_assigned_reference"],
+            "help": "If set, in the allele plots, the percentages will show the percentage as a percent of reads aligned to the assigned reference. Default behavior is to show percentage as a percent of all reads.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "quantification_window_coordinates": {
+            "keys": ["-qwc", "--quantification_window_coordinates"],
+            "type": "str",
+            "help": "Bp positions in the amplicon sequence specifying the quantification window. This parameter overrides values of the '--quantification_window_center', '--cleavage_offset', '--window_around_sgrna' or '--window_around_sgrna' values. Any indels/substitutions outside this window are excluded. Indexes are 0-based, meaning that the first nucleotide is position 0. Ranges are separted by the dash sign (e.g. 'start-stop'), and multiple ranges can be separated by the underscore (_) (can be comma-separated list of values, corresponding to amplicon sequences given in --amplicon_seq e.g. 5-10,5-10_20-30 would specify the 6th-11th bp in the first reference and the 6th-11th and 21st-31st bp in the second reference). A value of 0 disables this filter for a particular amplicon (e.g. 0,90-110 This would disable the quantification window for the first amplicon and specify the quantification window of 90-110 for the second).Note that if there are multiple amplicons provided, and only one quantification window coordinate is provided, the same quantification window will be used for all amplicons and be adjusted to account for insertions/deletions.(default: None)",
+            "default": null,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "annotate_wildtype_allele": {
+            "keys": ["--annotate_wildtype_allele"],
+            "type": "str",
+            "help": "Wildtype alleles in the allele table plots will be marked with this string (e.g. **).",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "keep_intermediate": {
+            "keys": ["--keep_intermediate"],
+            "help": "Keep all the intermediate files",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "dump": {
+            "keys": ["--dump"],
+            "help": "Dump numpy arrays and pandas dataframes to file for debugging purposes",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "write_detailed_allele_table": {
+            "keys": ["--write_detailed_allele_table"],
+            "help": "If set, a detailed allele table will be written including alignment scores for each read sequence.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "fastq_output": {
+            "keys": ["--fastq_output"],
+            "help": "If set, a fastq file with annotations for each read will be produced.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "bam_output": {
+            "keys": ["--bam_output"],
+            "help": "If set, a bam file with alignments for each read will be produced.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "bowtie2_index": {
+            "keys": ["-x", "--bowtie2_index"],
+            "type": "str",
+            "help": "Basename of Bowtie2 index for the reference genome",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "zip_output": {
+            "keys": ["--zip_output"],
+            "help": "If set, the output will be placed in a zip folder.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "max_rows_alleles_around_cut_to_plot": {
+            "keys": ["--max_rows_alleles_around_cut_to_plot"],
+            "type": "int",
+            "help": "Maximum number of rows to report in the alleles table plot.",
+            "default": 50,
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "suppress_report": {
+            "keys": ["--suppress_report"],
+            "help": "Suppress output report",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "place_report_in_output_folder": {
+            "keys": ["--place_report_in_output_folder"],
+            "help": "If true, report will be written inside the CRISPResso output folder. By default, the report will be written one directory up from the report output.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "suppress_plots": {
+            "keys": ["--suppress_plots"],
+            "help": "Suppress output plots",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "write_cleaned_report": {
+            "keys": ["--write_cleaned_report"],
+            "help": "SUPPRESS",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "base_editor_output": {
+            "name": "Base Editor Output",
+            "keys": ["--base_editor_output"],
+            "help": "Outputs plots and tables to aid in analysis of base editor studies.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "conversion_nuc_from": {
+            "keys": ["--conversion_nuc_from"],
+            "type": "str",
+            "help": "For base editor plots, this is the nucleotide targeted by the base editor",
+            "default": "C",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "conversion_nuc_to": {
+            "keys": ["--conversion_nuc_to"],
+            "type": "str",
+            "help": "For base editor plots, this is the nucleotide produced by the base editor",
+            "default": "T",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_pegRNA_spacer_seq": {
+            "name": "Prime Editing Spacer Sequence",
+            "keys": ["--prime_editing_pegRNA_spacer_seq"],
+            "type": "str",
+            "help": "pegRNA spacer sgRNA sequence used in prime editing. The spacer should not include the PAM sequence. The sequence should be given in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the given sequence.",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_pegRNA_extension_seq": {
+            "name": "Prime Editing Extension Sequence",
+            "keys": ["--prime_editing_pegRNA_extension_seq"],
+            "type": "str",
+            "help": "Extension sequence used in prime editing. The sequence should be given in the RNA 5'->3' order, such that the sequence starts with the RT template including the edit, followed by the Primer-binding site (PBS).",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_pegRNA_extension_quantification_window_size": {
+            "name": "Prime Editing pegRNA Extension Quantification Window Size",
+            "keys": ["--prime_editing_pegRNA_extension_quantification_window_size"],
+            "type": "int",
+            "help": "Quantification window size (in bp) at flap site for measuring modifications anchored at the right side of the extension sequence. Similar to the --quantification_window parameter, the total length of the quantification window will be 2x this parameter. Default: 5bp (10bp total window size)",
+            "default": 5,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_pegRNA_scaffold_seq": {
+            "name": "Prime Editing pegRNA Scaffold Sequence",
+            "keys": ["--prime_editing_pegRNA_scaffold_seq"],
+            "type": "str",
+            "help": "If given, reads containing any of this scaffold sequence before extension sequence (provided by --prime_editing_extension_seq) will be classified as 'Scaffold-incorporated'. The sequence should be given in the 5'->3' order such that the RT template directly follows this sequence. A common value is 'GGCACCGAGUCGGUGC'.",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_pegRNA_scaffold_min_match_length": {
+            "name": "Prime Editing pegRNA Scaffold Min Match Length",
+            "keys": ["--prime_editing_pegRNA_scaffold_min_match_length"],
+            "type": "int",
+            "help": "Minimum number of bases matching scaffold sequence for the read to be counted as 'Scaffold-incorporated'. If the scaffold sequence matches the reference sequence at the incorporation site, the minimum number of bases to match will be minimally increased (beyond this parameter) to disambiguate between prime-edited and scaffold-incorporated sequences.",
+            "default": 1,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_nicking_guide_seq": {
+            "name": "Prime Editing Nicking Guide Sequence",
+            "keys": ["--prime_editing_nicking_guide_seq"],
+            "type": "str",
+            "help": "Nicking sgRNA sequence used in prime editing. The sgRNA should not include the PAM sequence. The sequence should be given in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the sequence",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_override_prime_edited_ref_seq": {
+            "name": "Prime Editing Override Prime Edited Reference Sequence",
+            "keys": ["--prime_editing_override_prime_edited_ref_seq"],
+            "type": "str",
+            "help": "If given, this sequence will be used as the prime-edited reference sequence. This may be useful if the prime-edited reference sequence has large indels or the algorithm cannot otherwise infer the correct reference sequence.",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_override_sequence_checks": {
+            "keys": ["--prime_editing_override_sequence_checks"],
+            "help": "If set, checks to assert that the prime editing guides and extension sequence are in the proper orientation are not performed. This may be useful if the checks are failing inappropriately, but the user is confident that the sequences are correct.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_gap_open_penalty": {
+            "keys": ["--prime_editing_gap_open_penalty"],
+            "type": "int",
+            "help": "SUPPRESS",
+            "default": -50,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "prime_editing_gap_extend_penalty": {
+            "keys": ["--prime_editing_gap_extend_penalty"],
+            "type": "int",
+            "help": "SUPPRESS",
+            "default": 0,
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "crispresso1_mode": {
+            "keys": ["--crispresso1_mode"],
+            "help": "Parameter usage as in CRISPResso 1",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "dsODN": {
+            "keys": ["--dsODN"],
+            "type": "str",
+            "help": "Label reads with the dsODN sequence provided",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "auto": {
+            "keys": ["--auto"],
+            "help": "Infer amplicon sequence from most common reads",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "debug": {
+            "keys": ["--debug"],
+            "help": "Show debug messages",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "no_rerun": {
+            "keys": ["--no_rerun"],
+            "help": "Don't rerun CRISPResso2 if a run using the same parameters has already been finished.",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "n_processes": {
+            "keys": ["-p", "--n_processes"],
+            "type": "str",
+            "help": "Specify the number of processes to use for analysis. Please use with caution since increasing this parameter will significantly increase the memory required to run CRISPResso. Can be set to 'max'.",
+            "default": "1",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "bam_input": {
+            "keys": ["--bam_input"],
+            "type": "str",
+            "help": "Aligned reads for processing in bam format",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled"]
+        },
+        "bam_chr_loc": {
+            "keys": ["--bam_chr_loc"],
+            "type": "str",
+            "help": "Chromosome location in bam for reads to process. For example: 'chr1:50-100' or 'chrX'.",
+            "default": "",
+            "tools": ["Core", "Batch", "Pooled"]
+        },
+        "save_also_png": {
+            "keys": ["--save_also_png"],
+            "action": "store_true",
+            "help": "SUPPRESS",
+            "tools": ["Core", "Batch", "Pooled", "WGS"]
+        },
+        "batch_settings": {
+            "keys": ["-bs", "--batch_settings"],
+            "help": "Settings file for batch. Must be tab-separated text file. The header row contains CRISPResso parameters (e.g., fastq_r1, fastq_r2, amplicon_seq, and other optional parameters). Each following row sets parameters for an additional batch.",
+            "type": "str",
+            "required": true,
+            "tools": ["Batch"]
+        },
+        "skip_failed": {
+            "keys": ["--skip_failed"],
+            "help": "Continue with batch analysis even if one sample fails",
+            "action":"store_true",
+            "tools": ["Batch", "Pooled", "WGS"]
+        },
+        "min_reads_for_inclusion": {
+            "keys": ["--min_reads_for_inclusion"],
+            "help": "Minimum number of reads for a batch to be included in the batch summary",
+            "type": "int",
+            "default": 0,
+            "tools": ["Batch"]
+        },
+        "batch_output_folder": {
+            "keys": ["-bo", "--batch_output_folder"],
+            "help": "Directory where batch analysis output will be stored",
+            "type": "str",
+            "default": "",
+            "tools": ["Batch"]
+        },
+        "suppress_batch_summary_plots": {
+            "keys": ["--suppress_batch_summary_plots"],
+            "help": "Suppress batch summary plots - e.g. if many samples are run at once, the summary plots of all sub-runs may be too large. This parameter suppresses the production of these plots.",
+            "action": "store_true",
+            "tools": ["Batch"]
+        },
+        "crispresso_command": {
+            "keys": ["--crispresso_command"],
+            "help": "CRISPResso command to call",
+            "type": "str",
+            "default": "CRISPResso",
+            "tools": ["Batch", "Pooled", "WGS", "Meta"]
+        },
+        "amplicons_file": {
+            "keys": ["-f", "--amplicons_file"],
+            "help": "Amplicons description file. This file is a tab-delimited text file with up to 14 columns (2 required): amplicon_name:  an identifier for the amplicon (must be unique). amplicon_seq:  amplicon sequence used in the experiment. guide_seq (OPTIONAL):  sgRNA sequence used for this amplicon without the PAM sequence. Multiple guides can be given separated by commas and not spaces. expected_hdr_amplicon_seq (OPTIONAL): expected amplicon sequence in case of HDR. coding_seq (OPTIONAL): Subsequence(s) of the amplicon corresponding to coding sequences. If more than one separate them by commas and not spaces. prime_editing_pegRNA_spacer_seq (OPTIONAL): pegRNA spacer sgRNA sequence used in prime editing. The spacer should not include the PAM sequence. The sequence should be given in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the given sequence. prime_editing_nicking_guide_seq (OPTIONAL): Nicking sgRNA sequence used in prime editing. The sgRNA should not include the PAM sequence. The sequence should be given in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the sequence. prime_editing_pegRNA_extension_seq (OPTIONAL): Extension sequence used in prime editing. The sequence should be given in the RNA 5'->3' order, such that the sequence starts with the RT template including the edit, followed by the Primer-binding site (PBS). prime_editing_pegRNA_scaffold_seq (OPTIONAL): If given, reads containing any of this scaffold sequence before extension sequence (provided by --prime_editing_extension_seq) will be classified as 'Scaffold-incorporated'. The sequence should be given in the 5'->3' order such that the RT template directly follows this sequence. A common value ends with 'GGCACCGAGUCGGUGC'. prime_editing_pegRNA_scaffold_min_match_length (OPTIONAL): Minimum number of bases matching scaffold sequence for the read to be counted as 'Scaffold-incorporated'. If the scaffold sequence matches the reference sequence at the incorporation site, the minimum number of bases to match will be minimally increased (beyond this parameter) to disambiguate between prime-edited and scaffold-incorporated sequences. prime_editing_override_prime_edited_ref_seq (OPTIONAL): If given, this sequence will be used as the prime-edited reference sequence. This may be useful if the prime-edited reference sequence has large indels or the algorithm cannot otherwise infer the correct reference sequence. quantification_window_coordinates (OPTIONAL): Bp positions in the amplicon sequence specifying the quantification window. This parameter overrides values of the '--quantification_window_center', '-- cleavage_offset', '--window_around_sgrna' or '-- window_around_sgrna' values. Any indels/substitutions outside this window are excluded. Indexes are 0-based, meaning that the first nucleotide is position 0. Ranges are separated by the dash sign like 'start-stop', and multiple ranges can be separated by the underscore (_). A value of 0 disables this filter. (can be comma-separated list of values, corresponding to amplicon sequences given in --amplicon_seq e.g. 5-10,5-10_20-30 would specify the 5th-10th bp in the first reference and the 5th-10th and 20th-30th bp in the second reference) (default: None) quantification_window_size (OPTIONAL): Defines the size (in bp) of the quantification window extending from the position specified by the '--cleavage_offset' or '--quantification_window_center' parameter in relation to the provided guide RNA sequence(s) (--sgRNA). Mutations within this number of bp from the quantification window center are used in classifying reads as modified or unmodified. A value of 0 disables this window and indels in the entire amplicon are considered. Default is 1, 1bp on each side of the cleavage position for a total length of 2bp. quantification_window_center (OPTIONAL): Center of quantification window to use within respect to the 3' end of the provided sgRNA sequence. Remember that the sgRNA sequence must be entered without the PAM. For cleaving nucleases, this is the predicted cleavage position. The default is -3 and is suitable for the Cas9 system. For alternate nucleases, other cleavage offsets may be appropriate, for example, if using Cpf1 this parameter would be set to 1. For base editors, this could be set to -17.",
+            "type": "str",
+            "default": "",
+            "tools": ["Pooled"]
+        },
+        "gene_annotations": {
+            "keys": ["--gene_annotations"],
+            "help": "Gene Annotation Table from UCSC Genome Browser Tables (http://genome.ucsc.edu/cgi-bin/hgTables?command=start), please select as table 'knownGene', as output format 'all fields from selected table' and as file returned 'gzip compressed'",
+            "type": "str",
+            "default": "",
+            "tools": ["WGS", "Pooled"]
+        },
+        "bowtie2_options_string": {
+            "keys": ["--bowtie2_options_string"],
+            "help": "Override options for the Bowtie2 alignment command. By default, this is ' --end-to-end -N 0 --np 0 -mp 3,2 --score-min L,-5,-3(1-H)' where H is the default homology score.",
+            "type": "str",
+            "default": "",
+            "tools": ["Pooled"]
+        },
+        "use_legacy_bowtie2_options_string": {
+            "keys": ["--use_legacy_bowtie2_options_string"],
+            "help": "Use legacy (more stringent) Bowtie2 alignment parameters: ' -k 1 --end-to-end -N 0 --np 0 '.",
+            "action": "store_true",
+            "tools": ["Pooled"]
+        },
+        "min_reads_to_use_region_pooled": {
+            "keys": ["--min_reads_to_use_region"],
+            "help": "Minimum number of reads that align to a region to perform the CRISPResso analysis",
+            "type": "float",
+            "default": 1000,
+            "tools": ["Pooled"]
+        },
+        "skip_reporting_problematic_regions": {
+            "keys": ["--skip_reporting_problematic_regions"],
+            "help": "Skip reporting of problematic regions. By default, when both amplicons (-f) and genome (-x) are provided, problematic reads that align to the genome but to positions other than where the amplicons align are reported as problematic",
+            "action": "store_true",
+            "tools": ["Pooled"]
+        },
+        "compile_postrun_references": {
+            "keys": ["--compile_postrun_references"],
+            "help": "If set, a file will be produced which compiles the reference sequences of frequent amplicons.",
+            "action": "store_true",
+            "tools": ["Pooled"]
+        },
+        "compile_postrun_reference_allele_cutoff": {
+            "keys": ["--compile_postrun_reference_allele_cutoff"],
+            "help": "Only alleles with at least this percentage frequency in the population will be reported in the postrun analysis. This parameter is given as a percent, so 30 is 30%%.",
+            "type": "float",
+            "default": "30",
+            "tools": ["Pooled"]
+        },
+        "alternate_alleles": {
+            "keys": ["--alternate_alleles"],
+            "help": "Path to tab-separated file with alternate allele sequences for pooled experiments. This file has the columns 'region_name','reference_seqs', and 'reference_names' and gives the reference sequences of alternate alleles that will be passed to CRISPResso for each individual region for allelic analysis. Multiple reference alleles and reference names for a given region name are separated by commas (no spaces).",
+            "type": "str",
+            "default": "",
+            "tools": ["Pooled"]
+        },
+        "limit_open_files_for_demux": {
+            "keys": ["--limit_open_files_for_demux"],
+            "help": "If set, only one file will be opened during demultiplexing of read alignment locations. This will be slightly slower as the reads must be sorted, but may be necessary if the number of amplicons is greater than the number of files that can be opened due to OS constraints.",
+            "action": "store_true",
+            "tools": ["Pooled"]
+        },
+        "aligned_pooled_bam": {
+            "keys": ["--aligned_pooled_bam"],
+            "help": "Path to aligned input for CRISPRessoPooled processing. If this parameter is specified, the alignments in the given bam will be used to demultiplex reads. If this parameter is not set (default), input reads provided by --fastq_r1 (and optionally --fastq_r2) will be aligned to the reference genome using bowtie2. If the input bam is given, the corresponding reference fasta must also be given to extract reference genomic sequences via the parameter --bowtie2_index. Note that if the aligned reads are paired-end sequenced, they should already be merged into 1 read (e.g. via Flash) before alignment.",
+            "type": "str",
+            "tools": ["Pooled"]
+        },
+        "demultiplex_only_at_amplicons": {
+            "keys": ["--demultiplex_only_at_amplicons"],
+            "help": "If set, and an amplicon file (--amplicons_file) and reference sequence (--bowtie2_index) are provided, reads overlapping alignment positions of amplicons will be demultiplexed and assigned to that amplicon. If this flag is not set, the entire genome will be demultiplexed and reads with the same start and stop coordinates as an amplicon will be assigned to that amplicon.",
+            "action": "store_true",
+            "tools": ["Pooled"]
+        },
+        "bam_file": {
+            "keys": ["-b", "--bam_file"],
+            "help": "WGS aligned bam file",
+            "type": "str",
+            "required": true,
+            "default": "bam filename",
+            "tools": ["WGS"]
+        },
+        "region_file": {
+            "keys": ["-f", "--region_file"],
+            "help": "Regions description file. A BED format file containing the regions to analyze, one per line. The REQUIRED columns are: chr_id(chromosome name), bpstart(start position), bpend(end position), the optional columns are:name (an unique indentifier for the region), guide_seq, expected_hdr_amplicon_seq, coding_seq, see CRISPResso help for more details on these last 3 parameters)",
+            "type": "str",
+            "required": true,
+            "tools": ["WGS"]
+        },
+        "reference_file": {
+            "keys": ["-r", "--reference_file"],
+            "help": "A FASTA format reference file (for example hg19.fa for the human genome)",
+            "type": "str",
+            "required": true,
+            "default": "",
+            "tools": ["WGS"]
+        },
+        "min_reads_to_use_region_wgs": {
+            "keys": ["--min_reads_to_use_region"],
+            "help": "Minimum number of reads that align to a region to perform the CRISPResso analysis for WGS",
+            "type": "float",
+            "default": 10,
+            "tools": ["WGS"]
+        },
+        "crispresso_output_folder_1": {
+            "keys": ["crispresso_output_folder_1"],
+            "help": "First output folder with CRISPResso analysis",
+            "type": "str",
+            "tools": ["Compare"]
+        },
+        "crispresso_output_folder_2": {
+            "keys": ["crispresso_output_folder_2"],
+            "help": "Second output folder with CRISPResso analysis",
+            "type": "str",
+            "tools": ["Compare"]
+        },
+        "sample_1_name": {
+            "keys": ["-n1", "--sample_1_name"],
+            "help": "Sample 1 name",
+            "tools": ["Compare"]
+        },
+        "sample_2_name": {
+            "keys": ["-n2", "--sample_2_name"],
+            "help": "Sample 2 name",
+            "tools": ["Compare"]
+        },
+        "reported_qvalue_cutoff": {
+            "keys": ["--reported_qvalue_cutoff"],
+            "help": "Q-value cutoff for significance in tests for differential editing. Each base position is tested (for insertions, deletions, substitutions, and all modifications) using Fisher's exact test, followed by Bonferroni correction. The number of bases with significance below this threshold in the quantification window are counted and reported in the output summary.",
+            "type": "float",
+            "default": 0.05,
+            "tools": ["Compare"]
+        },
+        "disable_guardrails":{
+            "keys": ["--disable_guardrails"],
+            "help": "Disable guardrail warnings",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        },
+        "use_matplotlib": {
+            "keys": ["--use_matplotlib"],
+            "help": "Use matplotlib for plotting instead of plotl/d3 when CRISPRessoPro is installed",
+            "action": "store_true",
+            "tools": ["Core", "Batch", "Pooled", "WGS", "Compare"]
+        }
+    },
+    "Sections": {
+        "Required": {
+            "Core": []
+        },
+        "Optional": {
+            "Prime Editing": []
+        }
+    }
+}
\ No newline at end of file
diff --git a/Dockerfile b/Dockerfile
index 699d26d1..5667580b 100644
--- a/Dockerfile
+++ b/Dockerfile
@@ -14,7 +14,7 @@ RUN apt-get update && apt-get install gcc g++ bowtie2 samtools libsys-hostname-l
   && rm -rf /var/lib/apt/lists/* \
   && rm -rf /usr/share/man/* \
   && rm -rf /usr/share/doc/* \
-  && conda install -c defaults -c conda-forge -c bioconda -y -n base --debug trimmomatic flash numpy cython jinja2 tbb=2020.2 pyparsing=2.3.1 scipy matplotlib-base pandas plotly\
+  && conda install -c defaults -c conda-forge -c bioconda -y -n base --debug fastp numpy cython jinja2 tbb=2020.2 pyparsing=2.3.1 scipy matplotlib-base pandas plotly\
   && conda clean --all --yes
 
 #install ms fonts
diff --git a/LICENSE.txt b/LICENSE.txt
index 84d707d9..298dcdf0 100644
--- a/LICENSE.txt
+++ b/LICENSE.txt
@@ -18,8 +18,7 @@ The Software Tool is free for your use subject to the terms and conditions set f
 MGH owns all right, title and interest in the Software Tool. MGH grants to you, the “Licensee,” a royalty-free, non-exclusive, non-transferable, revocable license to use the Software Tool for non-commercial research or academic purposes only; it is NOT made available here as a free tool or download for any commercial or clinical use. You may not copy or distribute the Software Tool in any form. This license is limited to the individual that accesses the Software Tool. No right to sublicense or assign this EULA is granted herein.
 
 The Software Tool optionally makes calls to unmodified versions of
-FLASh (https://ccb.jhu.edu/software/FLASH/) and
-Trimmomatic (http://www.usadellab.org/cms/?page=trimmomatic) software, both of which are covered under their own licenses (GPLv3).
+fastp <https://github.com/OpenGene/fastp> software, which is covered under its own license (MIT).
 
 By using this Software Tool, you agree to allow MGH the right to collect data and statistics (i) on system usage patterns and (ii) to improve this Software Tool.
 
diff --git a/MANIFEST.in b/MANIFEST.in
index ef6a51d3..07fd7902 100644
--- a/MANIFEST.in
+++ b/MANIFEST.in
@@ -1,2 +1,3 @@
 include CRISPResso2/EDNAFULL
+include CRISPResso2/args.json
 recursive-include CRISPResso2/CRISPRessoReports/templates *
diff --git a/README.md b/README.md
index a4bf4c9d..b4114e57 100644
--- a/README.md
+++ b/README.md
@@ -4,6 +4,7 @@
 [![install with bioconda](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg?style=flat)](http://bioconda.github.io/recipes/crispresso2/README.html)
 
 # CRISPResso2
+
 CRISPResso2 is a software pipeline designed to enable rapid and intuitive interpretation of genome editing experiments. A limited web implementation is available at: https://crispresso2.pinellolab.org/.
 
 Briefly, CRISPResso2:
@@ -13,6 +14,7 @@ Briefly, CRISPResso2:
 - summarizes editing results in intuitive plots and datasets
 
 ## What can I do with CRISPResso2?
+
 CRISPResso2 can be used to analyze genome editing outcomes using cleaving nucleases (e.g. Cas9 or Cpf1) or noncleaving nucleases (e.g. base editors). The following operations can be automatically performed:
 
 - filtering of low-quality reads
@@ -33,30 +35,44 @@ In addition, CRISPResso can be run as part of a larger tool suite:
 - [CRISPRessoAggregate](#crispressoaggregate) - for aggregating results from previously-run CRISPResso analyses
 
 ## CRISPResso2 processing
+
 ![CRISPResso2 Schematic](https://raw.githubusercontent.com/pinellolab/CRISPResso2/master/crispresso_schematic.png "CRISPResso2 Schematic")
 
 #### Quality filtering
+
 Input reads are first filtered based on the quality score (phred33) in order to remove potentially false positive indels. The filtering based on the phred33 quality score can be modulated by adjusting the optimal parameters (see additional notes below).
+
 #### Adapter trimming
-Next, adapters are trimmed from the reads. If no adapter are present, select 'No Trimming' under the 'Trimming adapter' heading in the optional parameters. If reads contain adapter sequences that need to be trimmed, select the adapters used for trimming under the ‘Trimming adapter’ heading in the optional parameters. Possible adapters include Nextera PE, TruSeq3 PE, TruSeq3 SE, TruSeq2 PE, and TruSeq2 SE. The adapters are trimmed from the reads using Trimmomatic.
+
+Next, adapters are trimmed from the reads. If no adapter are present, select 'No Trimming' under the 'Trimming adapter' heading in the optional parameters. If reads contain adapter sequences that need to be trimmed, select the adapters used for trimming under the ‘Trimming adapter’ heading in the optional parameters. Possible adapters include Nextera PE, TruSeq3 PE, TruSeq3 SE, TruSeq2 PE, and TruSeq2 SE. The adapters are trimmed from the reads using fastp.
+
 #### Read merging
-If paired-end reads are provided, reads are merged using FLASh . This produces a single read for alignment to the amplicon sequence, and reduces sequencing errors that may be present at the end of sequencing reads.
+
+If paired-end reads are provided, reads are merged using fastp. This produces a single read for alignment to the amplicon sequence, and reduces sequencing errors that may be present at the end of sequencing reads.
+
 #### Alignment
+
 The preprocessed reads are then aligned to the reference sequence with a global sequence alignment algorithm that takes into account our biological knowledge of nuclease function. If multiple alleles are present at the editing site, each allele can be passed to CRISPResso2 and sequenced reads will be assigned to the reference sequence or origin.
+
 #### Visualization and analysis
+
 Finally, after analyzing the aligned reads, a set of informative graphs are generated, allowing for the quantification and visualization of the position and type of outcomes within the amplicon sequence.
 
 ## How is CRISPResso2 different from CRISPResso?
+
 CRISPResso2 introduces four key innovations for the analysis of genome editing data:
-1) Comprehensive analysis of sequencing data from base editors. We have added additional analysis and visualization capabilities especially for experiments using base editors.
-2) Allele specific quantification of heterozygous references. If the targeted editing region has more than one allele, reads arising from each allele can be deconvoluted.
-3) A novel biologically-informed alignment algorithm. This algorithm incorporates knowledge about the mutations produced by gene editing tools to create more biologically-likely alignments.
-4) Ultra-fast processing time.
+
+1. Comprehensive analysis of sequencing data from base editors. We have added additional analysis and visualization capabilities especially for experiments using base editors.
+2. Allele specific quantification of heterozygous references. If the targeted editing region has more than one allele, reads arising from each allele can be deconvoluted.
+3. A novel biologically-informed alignment algorithm. This algorithm incorporates knowledge about the mutations produced by gene editing tools to create more biologically-likely alignments.
+4. Ultra-fast processing time.
 
 ## Installation
+
 CRISPResso2 can be installed using the [conda](http://conda.pydata.org/docs/intro.html) package manager [Bioconda](https://bioconda.github.io/), or it can be run using the [Docker](https://www.docker.com/) containerization system.
 
 ### Bioconda
+
 To install CRISPResso2 using Bioconda, download and install Anaconda Python, following the instructions at: https://www.anaconda.com/distribution/.
 
 Open a terminal and type:
@@ -95,7 +111,7 @@ CRISPResso -h
 
 If you would like to install CRISPResso using bioconda on a Mac with Apple silicon ([aren't sure?](https://support.apple.com/en-us/HT211814)), then there is a slight change you need to make. First, ensure that you have [Rosetta installed](https://support.apple.com/en-us/HT211861). Next, you must tell bioconda to install the Intel versions of the packages. If you would like to do this system wide, which we recommend, run the command:
 
-``` shell
+```shell
 conda config --add subdirs osx-64
 ```
 
@@ -103,13 +119,14 @@ Then you can proceed with the installation instructions above.
 
 If you would like to use the Intel versions in a single environment, then run:
 
-``` shell
+```shell
 CONDA_SUBDIR=osx-64 conda create -n crispresso2_env -c bioconda crispresso2
 ```
 
 If you choose to use the `CONDA_SUBDIR=osx-64` method, note that if you install additional packages into the environment you will need to add the `CONDA_SUBDIR=osx-64` to the beginning of each command. Alternatively, you could set this environment variable in your shell, but we recommend to use the `conda config --add subdirs osx-64` method because it is less error prone.
 
 ### Docker
+
 CRISPResso2 can be used via the Docker containerization system. This system allows CRISPResso2 to run on your system without configuring and installing additional packages. To run CRISPResso2, first download and install docker: https://docs.docker.com/engine/installation/
 
 Next, Docker must be configured to access your hard drive and to run with sufficient memory. These parameters can be found in the Docker settings menu. To allow Docker to access your hard drive, select 'Shared Drives' and make sure your drive name is selected. To adjust the memory allocation, select the 'Advanced' tab and allocate at least 4G of memory.
@@ -129,29 +146,98 @@ docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso -r1 sa
 ```
 
 ## CRISPResso2 usage
+
 CRISPResso2 is designed be run on a single amplicon. For experiments involving multiple amplicons in the same fastq, see the instructions for [CRISPRessoPooled](#crispressopooled) or [CRISPRessoWGS](#crispressoWGS) below.
 
 CRISPResso2 requires only two parameters: input sequences in the form of fastq files (given by the `--fastq_r1` and `--fastq_r2`) parameters, and the amplicon sequence to align to (given by the `--amplicon_seq` parameter). For example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPResso --fastq_r1 reads.fastq.gz --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fastq_r1 reads.fastq.gz --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT
 ```
 
+### Guardrails
+
+Guardrails automatically check the inputs and results of experiments against standardized values. The guardrail warnings that are triggered are printed in the commandline and at the top of generated reports. In order to turn off the guardrails, add the `--disable_guardrails` argument.
+
+TotalReadsGuardrail : Checks if the number of reads is lower than expected. (Default: 10000)
+OverallReadsAlignedGuardrail : Checks if the number of aligned reads is lower than expected. (Default: 90% of the total reads)
+DisproportionateReadsAlignedGuardrail : Checks if the number of reads aligned to an amplicon is higher or lower than expected proportionally. (Default: 30% more or less than expected)
+LowRatioOfModsInWindowToOutGuardrail : Checks if the ratio of modifications inside to outside the quantification window is lower than expected. (Default: 0.01)
+HighRateOfModificationAtEndsGuardrail : Checks if there is a high rate of modifications at the ends of the read. (Default: 0.01)
+HighRateOfSubstitutionsOutsideWindowGuardrail : Checks if there is a high rate of substitutions outside of the quantification windows. (Default: 0.002)
+HighRateOfSubstitutionsGuardrail : Checks if the proportion of substitutions to other modifications is higher than expected. (Default: 0.3)
+ShortSequenceGuardrail : Checks if the provided sequences (both Amplicons and Guides) are shorter than expected. (Amplicon Default: 50, Guide Default: 19)
+LongAmpliconShortReadsGuardrail : Checks if the rovided amplicon is more than <value> times the average length of read. (Default: 1.5)
+
+### CRISPRessoPro
+
+CRISPResso is an open source tool for free use by academics. However, for-profit organizations are required to purchase a license to use CRISPResso. As a part of this license, organizations gain access to the CRISPRessoPro package which supplements CRISPResso
+with several useful features:
+- Interactive and improved plots using D3 and Plotly
+- Customizable colors
+- Customizable warnings based on potential issues in results (guardrails)
+
+#### Installation
+
+To add CRISPRessoPro to CRISPResso contact Edilytics - support@edilytics.com
+
+#### D3 and Plotly
+
+If CRISPRessoPro is installed, by default reports will include interactive plots. To use matplotlib for figures add the `--use_matplotlib` argument.
+
+#### Customizable Colors and Guardrails
+
+If CRISPRessoPro is installed, by default the colors and guardrails will remain the same as CRISPResso. To alter this, use the `--custom_config` argument and a filepath to a `.json` file with the following format:
+
+'''
+"colors": {
+    'Substitution': '#0000FF',
+    'Insertion': '#008000',
+    'Deletion': '#FF0000',
+    'A': '#7FC97F',
+    'T': '#BEAED4',
+    'C': '#FDC086',
+    'G': '#FFFF99',
+    'N': '#C8C8C8',
+    '-': '#1E1E1E',
+},
+"guardrails": {
+    'min_total_reads': 10000,
+    'aligned_cutoff': 0.9,
+    'alternate_alignment': 0.3,
+    'min_ratio_of_mods_in_to_out': 0.01,
+    'modifications_at_ends': 0.01,
+    'outside_window_max_sub_rate': 0.002,
+    'max_rate_of_subs': 0.3,
+    'guide_len': 19,
+    'amplicon_len': 50,
+    'amplicon_to_read_length': 1.5
+}
+'''
+(These are the default values as an example).
+
+Change the values as desired to any color or guardrail specification.
+
 ### Example run: Non-homologous end joining (NHEJ)
+
 Download the test datasets [nhej.r1.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/nhej.r1.fastq.gz) and [nhej.r2.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/nhej.r2.fastq.gz) to your current directory. This is the first 25,000 sequences from a paired-end sequencing experiment. To analyze this experiment, run the command:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPResso --fastq_r1 nhej.r1.fastq.gz --fastq_r2 nhej.r2.fastq.gz --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT -n nhej
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fastq_r1 nhej.r1.fastq.gz --fastq_r2 nhej.r2.fastq.gz --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT -n nhej
 ```
@@ -159,14 +245,17 @@ docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fast
 This should produce a folder called 'CRISPResso_on_nhej'. Open the file called CRISPResso_on_nhej/CRISPResso2_report.html in a web browser, and you should see an output like this: [CRISPResso2_report.html](https://crispresso.pinellolab.partners.org/static/demo/CRISPResso_on_nhej/CRISPResso2_report.html).
 
 ### Example run: Multiple alleles
+
 Download the test dataset [allele_specific.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/allele_specific.fastq.gz) to your current directory. This is the first 25,000 sequences from a editing experiment targeting one allele. To analyze this experiment, run the following command:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPResso --fastq_r1 allele_specific.fastq.gz --amplicon_seq CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCACTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG,CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCCCTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG --amplicon_name P23H,WT --guide_seq GTGCGGAGCCACTTCGAGCAGC
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fastq_r1 allele_specific.fastq.gz --amplicon_seq CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCACTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG,CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCCCTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG --amplicon_name P23H,WT --guide_seq GTGCGGAGCCACTTCGAGCAGC
 ```
@@ -174,14 +263,17 @@ docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fast
 This should produce a folder called 'CRISPResso_on_allele_specific'. Open the file called CRISPResso_on_allele_specific/CRISPResso2_report.html in a web browser, and you should see an output like this: [CRISPResso2_report.html](https://crispresso.pinellolab.partners.org/static/demo/CRISPResso_on_allele_specific/CRISPResso2_report.html).
 
 ### Example run: Base editing experiment
+
 Download the test dataset [base_editor.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/base_editor.fastq.gz) to your current directory. This is the first 25,000 sequences from an editing experiment performed at the EMX1 locus. To analyze this experiment, run the following command:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPResso --fastq_r1 base_editor.fastq.gz --amplicon_seq GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG --guide_seq GAGTCCGAGCAGAAGAAGAA --quantification_window_size 10 --quantification_window_center -10 --base_editor_output
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fastq_r1 base_editor.fastq.gz --amplicon_seq GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG --guide_seq GAGTCCGAGCAGAAGAAGAA --quantification_window_size 10 --quantification_window_center -10 --base_editor_output
 ```
@@ -189,6 +281,7 @@ docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPResso --fast
 This should produce a folder called 'CRISPResso_on_base_editor'. Open the file called CRISPResso_on_base_editor/CRISPResso2_report.html in a web browser, and you should see an output like this: [CRISPResso2_report.html](https://crispresso.pinellolab.partners.org/static/demo/CRISPResso_on_base_editor/CRISPResso2_report.html).
 
 ### Parameter List
+
 -h or --help: show a help message and exit.
 
 -r1 or --fastq_r1: The first fastq file.
@@ -227,17 +320,11 @@ This should produce a folder called 'CRISPResso_on_base_editor'. Open the file c
 
 --min_bp_quality_or_N: Bases with a quality score (phred33) less than this value will be set to "N" (default: 0)
 
---trim_sequences: Enable the trimming of Illumina adapters with [Trimmomatic](http://www.usadellab.org/cms/?page=trimmomatic) (default: False)
-
---trimmomatic_command: Command to run [Trimmomatic](http://www.usadellab.org/cms/?page=trimmomatic). Alternate executables for Trimmomatic should be specified here. The default uses the conda-installed trimmomatic. (default: trimmomatic)
+--trim_sequences: Enable the trimming of Illumina adapters with fastp (default: False)
 
---trimmomatic_options_string: Override options for Trimmomatic (default: ). This parameter can be used to specify different adaptor sequences used in the experiment if you need to trim them. For example: ```ILLUMINACLIP:NexteraPE-PE.fa:0:90:10:0:true```, where NexteraPE-PE.fa is a file containing sequences of adapters to be trimmed.
+--fastp_options_string: Override options for fastp, e.g. `--length_required 70 --umi`
 
---min_paired_end_reads_overlap: Parameter for the FLASH read merging step. Minimum required overlap length between two reads to provide a confident overlap. (default: 10)
-
---max_paired_end_reads_overlap: Parameter for the FLASH merging step. Maximum overlap length expected in approximately 90% of read pairs.  Please see the FLASH manual for more information.  (default: 100)
-
---stringent_flash_merging: Use stringent parameters for flash merging. In the case where flash could merge R1 and R2 reads ambiguously, the expected overlap is calculated as 2\*average_read_length - amplicon_length. The flash parameters for --min-overlap and --max-overlap will be set to prefer merged reads with length within 10bp of the expected overlap. These values override the --min_paired_end_reads_overlap or --max_paired_end_reads_overlap CRISPResso parameters. (default: False)
+--min_paired_end_reads_overlap: Parameter for the fastp read merging step. Minimum required overlap length between two reads to provide a confident overlap. (default: 10)
 
 #### Quantification window parameters
 
@@ -278,6 +365,7 @@ This should produce a folder called 'CRISPResso_on_base_editor'. Open the file c
 --needleman_wunsch_aln_matrix_loc: Location of the matrix specifying substitution scores in the NCBI format (see ftp://ftp.ncbi.nih.gov/blast/matrices/) (default: EDNAFULL)
 
 #### Base editing parameters
+
 --base_editor_output: Outputs plots and tables to aid in analysis of base editor studies. If base editor output is selected, plots showing the frequency of substitutions in the quantification window are generated. The target and result bases can also be set to measure the rate of on-target conversion at bases in the quantification window. (default: False)
 
 --conversion_nuc_from: For base editor plots, this is the nucleotide targeted by the base editor (default: C)
@@ -290,7 +378,7 @@ This should produce a folder called 'CRISPResso_on_base_editor'. Open the file c
 
 --prime_editing_pegRNA_extension_seq: Extension sequence used in prime editing. The sequence should be given in the RNA 5'->3' order, such that the sequence starts with the RT template including the edit, followed by the Primer-binding site (PBS). (default: )
 
---prime_editing_pegRNA_extension_quantification_window_size: Quantification window size (in bp) at flap site for measuring modifications anchored at the right side of the extension sequence. Similar to the --quantification_window parameter, the total length of  the quantification window will be 2x this parameter. Default: 5bp (10bp total window size) (default: 5)
+--prime_editing_pegRNA_extension_quantification_window_size: Quantification window size (in bp) at flap site for measuring modifications anchored at the right side of the extension sequence. Similar to the --quantification_window parameter, the total length of the quantification window will be 2x this parameter. Default: 5bp (10bp total window size) (default: 5)
 
 --prime_editing_pegRNA_scaffold_seq: If given, reads containing any of this scaffold sequence before extension sequence (provided by --prime_editing_extension_seq) will be classified as 'Scaffold-incorporated'. The sequence should be given in the 5'->3' order such that the RT template directly follows this sequence. A common value ends with 'GGCACCGAGUCGGUGC'. (default: )
 
@@ -366,77 +454,82 @@ This should produce a folder called 'CRISPResso_on_base_editor'. Open the file c
 
 --bam_chr_loc BAM_CHR_LOC: Chromosome location in bam for reads to process. For example: "chr1:50-100" or "chrX". (default: )
 
+--disable_guardrails: Don't show the guardrail warnings.
+
 ## CRISPResso2 output
+
 The output of CRISPResso2 consists of a set of informative graphs that allow for the quantification and visualization of the position and type of outcomes within an amplicon sequence.
 
 ### Data file descriptions
-*CRISPResso2_report.html* is a summary report that can be viewed in a web browser containing all of the output plots and summary statistics.
 
-*Alleles_frequency_table.zip* can be unzipped to a tab-separated text file that shows all reads and alignments to references. The first column shows the aligned sequence of the sequenced read. The second column shows the aligned sequence of the reference sequence. Gaps in each of these columns represent insertions and deletions. The next column 'Reference_Name' shows the name of the reference that the read aligned to. The fourth column, 'Read_Status' shows whether the read was modified or unmodified. The fifth through seventh columns ('n_deleted', 'n_inserted', 'n_substituted') show the number of bases deleted, inserted, and substituted as compared to the reference sequence. The eighth column shows the number of reads having that sequence, and the ninth column shows the percentage of all reads having that sequence.
+_CRISPResso2_report.html_ is a summary report that can be viewed in a web browser containing all of the output plots and summary statistics.
+
+_Alleles_frequency_table.zip_ can be unzipped to a tab-separated text file that shows all reads and alignments to references. The first column shows the aligned sequence of the sequenced read. The second column shows the aligned sequence of the reference sequence. Gaps in each of these columns represent insertions and deletions. The next column 'Reference_Name' shows the name of the reference that the read aligned to. The fourth column, 'Read_Status' shows whether the read was modified or unmodified. The fifth through seventh columns ('n_deleted', 'n_inserted', 'n_substituted') show the number of bases deleted, inserted, and substituted as compared to the reference sequence. The eighth column shows the number of reads having that sequence, and the ninth column shows the percentage of all reads having that sequence.
 
-*CRISPResso_mapping_statistics.txt* is a tab-delimited text file showing the number of reads in the input ('READS IN INPUTS') the number of reads after filtering, trimming and merging (READS AFTER PREPROCESSING), the number of reads aligned (READS ALIGNED) and the number of reads for which the alignment had to be computed vs read from cache.
+_CRISPResso_mapping_statistics.txt_ is a tab-delimited text file showing the number of reads in the input ('READS IN INPUTS') the number of reads after filtering, trimming and merging (READS AFTER PREPROCESSING), the number of reads aligned (READS ALIGNED) and the number of reads for which the alignment had to be computed vs read from cache.
 
-*CRISPResso_quantification_of_editing_frequency.txt* is a tab-delimited text file showing the number of reads aligning to each reference amplicon, as well as the status (modified/unmodified, number of insertions, deletions, and/or substitutions) of those reads.
+_CRISPResso_quantification_of_editing_frequency.txt_ is a tab-delimited text file showing the number of reads aligning to each reference amplicon, as well as the status (modified/unmodified, number of insertions, deletions, and/or substitutions) of those reads.
 
-*CRISPResso_RUNNING_LOG.txt* is a text file and shows a log of the CRISPResso run.
+_CRISPResso_RUNNING_LOG.txt_ is a text file and shows a log of the CRISPResso run.
 
-*CRISPResso2_info.json* can be read by other CRISPResso tools and contains information about the run and results.
+_CRISPResso2_info.json_ can be read by other CRISPResso tools and contains information about the run and results.
 
 The remainder of the files are produced for each amplicon, and each file is prefixed by the name of the amplicon if more than one amplicon is given.
 
-*Alleles_frequency_table_around_sgRNA_NNNNN.txt* is a tab-separated text file that shows alleles and alignments to the specified reference for a subsequence around the sgRNA (here, shown by 'NNNNN'). This data report is produced for each amplicon when a guide is found in the amplicon sequence. A report is generated for each guide. The number of nucleotides shown in this report can be modified by changing the `--plot_window_size` parameter.
+_Alleles_frequency_table_around_sgRNA_NNNNN.txt_ is a tab-separated text file that shows alleles and alignments to the specified reference for a subsequence around the sgRNA (here, shown by 'NNNNN'). This data report is produced for each amplicon when a guide is found in the amplicon sequence. A report is generated for each guide. The number of nucleotides shown in this report can be modified by changing the `--plot_window_size` parameter.
 
-*Substitution_frequency_table_around_sgRNA_NNNNN.txt* is a tab-separated text file that shows the frequency of substitutions in the amplicon sequence around the sgRNA (here, shown by 'NNNNN'). The first row shows the reference sequence. The following rows show the number of substitutions to each base. For example, the first numeric value in the second row (marked ‘A’) shows the number of bases that have a substitution resulting in an A at the first basepair of the amplicon sequence. The number of unmodified bases at each position is now shown in this table (because they aren’t substitutions). Thus, if the first basepair of the amplicon sequence is an A, the first value in the first row will show 0. A report is generated for each guide. The number of nucleotides shown in this report can be modified by changing the `--plot_window_size` parameter.
+_Substitution_frequency_table_around_sgRNA_NNNNN.txt_ is a tab-separated text file that shows the frequency of substitutions in the amplicon sequence around the sgRNA (here, shown by 'NNNNN'). The first row shows the reference sequence. The following rows show the number of substitutions to each base. For example, the first numeric value in the second row (marked ‘A’) shows the number of bases that have a substitution resulting in an A at the first basepair of the amplicon sequence. The number of unmodified bases at each position is now shown in this table (because they aren’t substitutions). Thus, if the first basepair of the amplicon sequence is an A, the first value in the first row will show 0. A report is generated for each guide. The number of nucleotides shown in this report can be modified by changing the `--plot_window_size` parameter.
 
-*Substitution_frequency_table.txt* is a tab-separated text file that shows the frequency of substitutions in the amplicon sequence across the entire amplicon. The first row shows the reference sequence. The following rows show the number of substitutions to each base. For example, the first numeric value in the second row (marked ‘A’) shows the number of bases that have a substitution resulting in an A at the first basepair of the amplicon sequence. The number of unmodified bases at each position is now shown in this table (because they aren’t substitutions). Thus, if the first basepair of the AMPLICON sequence is an A, the first value in the first row will show 0.
+_Substitution_frequency_table.txt_ is a tab-separated text file that shows the frequency of substitutions in the amplicon sequence across the entire amplicon. The first row shows the reference sequence. The following rows show the number of substitutions to each base. For example, the first numeric value in the second row (marked ‘A’) shows the number of bases that have a substitution resulting in an A at the first basepair of the amplicon sequence. The number of unmodified bases at each position is now shown in this table (because they aren’t substitutions). Thus, if the first basepair of the AMPLICON sequence is an A, the first value in the first row will show 0.
 
-*Insertion_histogram.txt* is a tab-separated text file that shows a histogram of the insertion sizes in the amplicon sequence in the quantification window. Insertions outside of the quantification window are not included. The ins_size column shows the insertion length, and the fq column shows the number of reads having that insertion size.
+_Insertion_histogram.txt_ is a tab-separated text file that shows a histogram of the insertion sizes in the amplicon sequence in the quantification window. Insertions outside of the quantification window are not included. The ins_size column shows the insertion length, and the fq column shows the number of reads having that insertion size.
 
-*Deletion_histogram.txt* is a tab-separated text file that shows a histogram of the deletion sizes in the amplicon sequence in the quantification window. Deletions outside of the quantification window are not included. The del_size column shows length of the deletion, and the fq column shows the number of reads having that number of substitutions.
+_Deletion_histogram.txt_ is a tab-separated text file that shows a histogram of the deletion sizes in the amplicon sequence in the quantification window. Deletions outside of the quantification window are not included. The del_size column shows length of the deletion, and the fq column shows the number of reads having that number of substitutions.
 
-*Substitution_histogram.txt* is a tab-separated text file that shows a histogram of the number of substitutions in the amplicon sequence in the quantification window. Substitutions outside of the quantification window are not included. The sub_count column shows the number of substitutions, and the fq column shows the number of reads having that number of substitutions.
+_Substitution_histogram.txt_ is a tab-separated text file that shows a histogram of the number of substitutions in the amplicon sequence in the quantification window. Substitutions outside of the quantification window are not included. The sub_count column shows the number of substitutions, and the fq column shows the number of reads having that number of substitutions.
 
-*Effect_vector_insertion.txt* is a tab-separated text file with a one-row header that shows the percentage of reads with an insertion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a insertion at that location.
+_Effect_vector_insertion.txt_ is a tab-separated text file with a one-row header that shows the percentage of reads with an insertion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a insertion at that location.
 
-*Effect_vector_deletion.txt* is a tab-separated text file with a one-row header that shows the percentage of reads with a deletion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a deletion at that location.
+_Effect_vector_deletion.txt_ is a tab-separated text file with a one-row header that shows the percentage of reads with a deletion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a deletion at that location.
 
-*Effect_vector_substitution.txt* is a tab-separated text file with a one-row header that shows the percentage of reads with a substitution at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a substitution at that location.
+_Effect_vector_substitution.txt_ is a tab-separated text file with a one-row header that shows the percentage of reads with a substitution at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a substitution at that location.
 
-*Effect_vector_combined.txt* is a tab-separated text file with a one-row header that shows the percentage of reads with any modification (insertion, deletion, or substitution) at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a modification at that location.
+_Effect_vector_combined.txt_ is a tab-separated text file with a one-row header that shows the percentage of reads with any modification (insertion, deletion, or substitution) at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a modification at that location.
 
-*Modification_count_vectors.txt* is a tab-separated file showing the number of modifications for each position in the amplicon. The first row shows the amplicon sequence, and successive rows show the number of reads with insertions (row 2), insertions_left (row 3), deletions (row 4), substitutions (row 5) and the sum of all modifications (row 6). Additionally, the last row shows the number of reads aligned.
+_Modification_count_vectors.txt_ is a tab-separated file showing the number of modifications for each position in the amplicon. The first row shows the amplicon sequence, and successive rows show the number of reads with insertions (row 2), insertions_left (row 3), deletions (row 4), substitutions (row 5) and the sum of all modifications (row 6). Additionally, the last row shows the number of reads aligned.
 
 If an insertion occurs between bases 5 and 6, the insertions vector will be incremented at bases 5 and 6. However, the insertions_left vector will only be incremented at base 5 so the sum of the insertions_left row represents an accurate count of the number of insertions, whereas the sum of the insertions row will yield twice the number of insertions.
 
-*Quantification_window_modification_count_vectors.txt* is a tab-separated file showing the number of modifications for positions in the quantification window of the amplicon. The first row shows the amplicon sequence in the quantification window, and successive rows show the number of reads with insertions (row 2), insertions_left (row 3), deletions (row 4), substitutions (row 5) and the sum of all modifications (row 6). Additionally, the last row shows the number of reads aligned.
+_Quantification_window_modification_count_vectors.txt_ is a tab-separated file showing the number of modifications for positions in the quantification window of the amplicon. The first row shows the amplicon sequence in the quantification window, and successive rows show the number of reads with insertions (row 2), insertions_left (row 3), deletions (row 4), substitutions (row 5) and the sum of all modifications (row 6). Additionally, the last row shows the number of reads aligned.
 
-*Nucleotide_frequency_table.txt* is a tab-separated file showing the number of each residue at each position in the amplicon. The first row shows the amplicon sequence, and successive rows show the number of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
+_Nucleotide_frequency_table.txt_ is a tab-separated file showing the number of each residue at each position in the amplicon. The first row shows the amplicon sequence, and successive rows show the number of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
 
-*Quantification_window_nucleotide_frequency_table.txt* is a tab-separated file showing the number of each residue at positions in the quantification window of the amplicon. The first row shows the amplicon sequence in the quantification window, and successive rows show the number of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
+_Quantification_window_nucleotide_frequency_table.txt_ is a tab-separated file showing the number of each residue at positions in the quantification window of the amplicon. The first row shows the amplicon sequence in the quantification window, and successive rows show the number of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
 
-*Nucleotide_percentage_table.txt* is a tab-separated file showing the percentage of each residue at each position in the amplicon. The first row shows the amplicon sequence, and successive rows show the percentage of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
+_Nucleotide_percentage_table.txt_ is a tab-separated file showing the percentage of each residue at each position in the amplicon. The first row shows the amplicon sequence, and successive rows show the percentage of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
 
-*Quantification_window_nucleotide_percentage_table.txt* is a tab-separated file showing the percentage of each residue at positions in the quantification window of the amplicon. The first row shows the amplicon sequence in the quantification window, and successive rows show the percentage of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
+_Quantification_window_nucleotide_percentage_table.txt_ is a tab-separated file showing the percentage of each residue at positions in the quantification window of the amplicon. The first row shows the amplicon sequence in the quantification window, and successive rows show the percentage of reads with an A (row 2), C (row 3), G (row 4), T (row 5), N (row 6), or a deletion (-) (row 7) at each position.
 
 The following report files are produced when the base editor mode is enabled:
 
-*Selected_nucleotide_percentage_table_around_sgRNA_NNNNN.txt* is a tab-separated text file that shows the percentage of each base at selected nucleotides in the amplicon sequence around the sgRNA (here, shown by 'NNNNN'). If the base editing experiment targets cytosines (as set by the --base_editor_from parameter), each C in the quantification window will be numbered (e.g. C5 represents the cytosine at the 5th position in the selected nucleotides). The percentage of each base at these selected target cytosines is reported, with the first row showing the numbered cytosines, and the remainder of the rows showing the percentage of each nucleotide present at these locations. This file shows nucleotides within '--plot_window_size' bp of the position specified by the parameter '--quantification_window_center' relative to the 3' end of each guide.
+_Selected_nucleotide_percentage_table_around_sgRNA_NNNNN.txt_ is a tab-separated text file that shows the percentage of each base at selected nucleotides in the amplicon sequence around the sgRNA (here, shown by 'NNNNN'). If the base editing experiment targets cytosines (as set by the --base_editor_from parameter), each C in the quantification window will be numbered (e.g. C5 represents the cytosine at the 5th position in the selected nucleotides). The percentage of each base at these selected target cytosines is reported, with the first row showing the numbered cytosines, and the remainder of the rows showing the percentage of each nucleotide present at these locations. This file shows nucleotides within '--plot_window_size' bp of the position specified by the parameter '--quantification_window_center' relative to the 3' end of each guide.
 
-*Selected_nucleotide_frequency_table_around_sgRNA_NNNNN.txt* is a tab-separated text file that shows the frequency of each base at selected nucleotides in the amplicon sequence around the sgRNA (here, shown by 'NNNNN'). If the base editing experiment targets cytosines (as set by the --base_editor_from parameter), each C in the quantification window will be numbered (e.g. C5 represents the cytosine at the 5th position in the selected nucleotides). The frequency of each base at these selected target cytosines is reported, with the first row showing the numbered cytosines, and the remainder of the rows showing the frequency of each nucleotide present at these locations. This file shows nucleotides within '--plot_window_size' bp of the position specified by the parameter '--quantification_window_center' relative to the 3' end of each guide.
+_Selected_nucleotide_frequency_table_around_sgRNA_NNNNN.txt_ is a tab-separated text file that shows the frequency of each base at selected nucleotides in the amplicon sequence around the sgRNA (here, shown by 'NNNNN'). If the base editing experiment targets cytosines (as set by the --base_editor_from parameter), each C in the quantification window will be numbered (e.g. C5 represents the cytosine at the 5th position in the selected nucleotides). The frequency of each base at these selected target cytosines is reported, with the first row showing the numbered cytosines, and the remainder of the rows showing the frequency of each nucleotide present at these locations. This file shows nucleotides within '--plot_window_size' bp of the position specified by the parameter '--quantification_window_center' relative to the 3' end of each guide.
 
 The following report files are produced when the amplicon contains a coding sequence:
 
-*Frameshift_analysis.txt* is a text file describing the number of noncoding, in-frame, and frameshift mutations. This report file is produced when the amplicon contains a coding sequence.
+_Frameshift_analysis.txt_ is a text file describing the number of noncoding, in-frame, and frameshift mutations. This report file is produced when the amplicon contains a coding sequence.
 
-*Splice_sites_analysis.txt* is a text file describing the number of splicing sites that are unmodified and modified. This file report is produced when the amplicon contains a coding sequence.
+_Splice_sites_analysis.txt_ is a text file describing the number of splicing sites that are unmodified and modified. This file report is produced when the amplicon contains a coding sequence.
 
-*Effect_vector_insertion_noncoding.txt* is a tab-separated text file with a one-row header that shows the percentage of reads with a noncoding insertion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a noncoding insertion at that location. This report file is produced when amplicon contains a coding sequence.
+_Effect_vector_insertion_noncoding.txt_ is a tab-separated text file with a one-row header that shows the percentage of reads with a noncoding insertion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a noncoding insertion at that location. This report file is produced when amplicon contains a coding sequence.
 
-*Effect_vector_deletion_noncoding.txt* is a tab-separated text file with a one-row header that shows the percentage of reads with a noncoding deletion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a noncoding deletion at that location. This report file is produced when amplicon contains a coding sequence.
+_Effect_vector_deletion_noncoding.txt_ is a tab-separated text file with a one-row header that shows the percentage of reads with a noncoding deletion at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a noncoding deletion at that location. This report file is produced when amplicon contains a coding sequence.
 
-*Effect_vector_substitution_noncoding.txt* is a tab-separated text file with a one-row header that shows the percentage of reads with a noncoding substitution at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a noncoding substitution at that location. This report file is produced when amplicon contains a coding sequence.
+_Effect_vector_substitution_noncoding.txt_ is a tab-separated text file with a one-row header that shows the percentage of reads with a noncoding substitution at each base in the reference sequence. The first column shows the 1-based position of the amplicon, and the second column shows the percentage of reads with a noncoding substitution at that location. This report file is produced when amplicon contains a coding sequence.
 
 ## Troubleshooting
+
 Please check that your input file(s) are in FASTQ format (compressed fastq.gz also accepted).
 
 If you get an empty report, please double check that your amplicon sequence is correct and in the correct orientation. It can be helpful to inspect the first few lines of your FASTQ file - the start of the amplicon sequence should match the start of your sequences. If not, check to see if the files are trimmed (see point below).
@@ -450,14 +543,17 @@ If your amplicon sequence is longer than your sequenced read length, the R1 and
 Especially in repetitive regions, multiple alignments may have the best score. If you want to investigate alternate best-scoring alignments, you can view all alignments using this tool: http://rna.informatik.uni-freiburg.de/Teaching/index.jsp?toolName=Gotoh. As input, sequences from the 'Alleles_frequency_table.txt' can be used. Specifically, for a given row, the value in the 'Aligned_Sequence' should be entered into the 'Sequence a' box after removing any dashes, and the value in the 'Reference_Sequence' should be entered into the 'Sequence b' box after removing any dashes. The alternate alignments can be selected in the 'Results' panel in the Output section.
 
 ## Alternate running modes
+
 CRISPResso2 can be run for many fastqs ([CRISPRessoBatch](#crispressobatch)), for many amplicons in the same fastq ([CRISPRessoPooled](#crispressopooled)), or for whole-genome sequencing ([CRISPRessoWGS](#crispressowgs)).
 
 ### CRISPRessoBatch
+
 CRISPRessoBatch allows users to specify input files and other command line arguments in a single file, and then to run CRISPResso2 analysis on each file in parallel. Samples for which the amplicon and guide sequences are the same will be compared between batches, producing useful summary tables and coomparison plots.
 
 This flexible utility adds four additional parameters:
 
 --batch_settings: This parameter specifies the tab-separated batch file. The batch file consists of a header line listing the parameters specified, and then one line for each sample describing the parameters for that sample. Each of the parameters for CRISPResso2 given above can be specified for each sample. When CRISPRessoBatch is run, additional parameters can be specified that will be applied to all of the samples listed in the batch file. An example batch file looks like:
+
 ```
 name	fastq_r1
 sample1	sample1.fq
@@ -473,26 +569,28 @@ sample3	sample3.fq
 
 CRISPRessoBatch outputs several summary files and plots:
 
-*CRISPRessoBatch_quantification_of_editing_frequency* shows the number of reads that were modified for each amplicon in each sample.
+_CRISPRessoBatch_quantification_of_editing_frequency_ shows the number of reads that were modified for each amplicon in each sample.
 
-*CRISPRessoBatch_mapping_statistics.txt* aggregates the read mapping data from each sample.
+_CRISPRessoBatch_mapping_statistics.txt_ aggregates the read mapping data from each sample.
 
 For each amplicon, the following files are produced with the name of the amplicon as the filename prefix:
 
-*NUCLEOTIDE_FREQUENCY_SUMMARY.txt* and *NUCLEOTIDE_PERCENTAGE_SUMMARY.txt* aggregate the nucleotide counts and percentages at each position in the amplicon for each sample.
-
+_NUCLEOTIDE_FREQUENCY_SUMMARY.txt_ and _NUCLEOTIDE_PERCENTAGE_SUMMARY.txt_ aggregate the nucleotide counts and percentages at each position in the amplicon for each sample.
 
-*MODIFICATION_FREQUENCY_SUMMARY.txt* and *MODIFICATION_PERCENTAGE_SUMMARY.txt* aggregate the modification frequency and percentage at each position in the amplicon for each sample.
+_MODIFICATION_FREQUENCY_SUMMARY.txt_ and _MODIFICATION_PERCENTAGE_SUMMARY.txt_ aggregate the modification frequency and percentage at each position in the amplicon for each sample.
 
 #### Example run: Batch mode
+
 Download the test dataset files [SRR3305543.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/SRR3305543.fastq.gz), [SRR3305544.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/SRR3305544.fastq.gz), [SRR3305545.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/SRR3305545.fastq.gz), and [SRR3305546.fastq.gz](https://crispresso.pinellolab.partners.org/static/demo/SRR3305546.fastq.gz) to your current directory. These are files are the first 25,000 sequences from an editing experiment performed on several base editors. Also include a batch file that lists these files and the sample names: [batch.batch](https://crispresso.pinellolab.partners.org/static/demo/batch.batch) To analyze this experiment, run the following command:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoBatch --batch_settings batch.batch --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC -p 4 --base_editor_output -g GGAATCCCTTCTGCAGCACC -wc -10 -w 20
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoBatch --batch_settings batch.batch --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC -p 4 --base_editor_output -g GGAATCCCTTCTGCAGCACC -wc -10 -w 20
 ```
@@ -500,6 +598,7 @@ docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoBatch -
 This should produce a folder called 'CRISPRessoBatch_on_batch'. Open the file called CRISPRessoBatch_on_batch/CRISPResso2Batch_report.html in a web browser, and you should see an output like this: [CRISPResso2Batch_report.html](https://crispresso.pinellolab.partners.org/static/demo/CRISPRessoBatch_on_batch/CRISPResso2Batch_report.html).
 
 ### CRISPRessoPooled
+
 CRISPRessoPooled is a utility to analyze and quantify targeted sequencing CRISPR/Cas9 experiments involving pooled amplicon sequencing libraries. One common experimental strategy is to pool multiple amplicons (e.g. a single on-target site plus a set of potential off-target sites) into a single deep sequencing reaction (briefly, genomic DNA samples for pooled applications can be prepared by first amplifying the target regions for each gene/target of interest with
 regions of 150-400bp depending on the desired coverage. In a second round of PCR, with minimized cycle numbers, barcode and adaptors are added. With optimization, these two rounds of PCR can be merged into a single reaction. These reactions are then quantified, normalized, pooled, and undergo quality control before being sequenced).
 CRISPRessoPooled demultiplexes reads from multiple amplicons and runs the CRISPResso utility with appropriate reads for each amplicon separately.
@@ -527,64 +626,63 @@ To run the tool in this mode the user must provide:
     particular, this file, is a tab delimited text file with up to 12
     columns (first 2 columns required):
 
-- *AMPLICON\_NAME*: an identifier for the amplicon (*must be unique*).
-
-- *AMPLICON\_SEQUENCE*: amplicon sequence used in the design of
-    the experiment.
+- _AMPLICON_NAME_: an identifier for the amplicon (_must be unique_).
 
-- *sgRNA\_SEQUENCE (OPTIONAL)*: sgRNA sequence used for this amplicon
-    *without the PAM sequence.* If not available, enter *NA.*
+- _AMPLICON_SEQUENCE_: amplicon sequence used in the design of
+  the experiment.
 
-- *EXPECTED\_AMPLICON\_AFTER\_HDR (OPTIONAL)*: expected amplicon
-    sequence in case of HDR. If more than one, separate by commas *and
-    not spaces*. If not available, enter *NA.*
+- _sgRNA_SEQUENCE (OPTIONAL)_: sgRNA sequence used for this amplicon
+  _without the PAM sequence._ If not available, enter _NA._
 
-- *CODING\_SEQUENCE (OPTIONAL)*: Subsequence(s) of the amplicon
-    corresponding to coding sequences. If more than one, separate by
-    commas *and not spaces*. If not available, enter *NA.*
+- _EXPECTED_AMPLICON_AFTER_HDR (OPTIONAL)_: expected amplicon
+  sequence in case of HDR. If more than one, separate by commas _and
+  not spaces_. If not available, enter _NA._
 
+- _CODING_SEQUENCE (OPTIONAL)_: Subsequence(s) of the amplicon
+  corresponding to coding sequences. If more than one, separate by
+  commas _and not spaces_. If not available, enter _NA._
 
-- *PRIME\_EDITING\_PEGRNA\_SPACER\_SEQ (OPTIONAL)*: pegRNA spacer sgRNA sequence
-    used in prime editing. The spacer should not include the PAM sequence.
-    The sequence should be given in the RNA 5'->3' order, so for Cas9, the
-    PAM would be on the right side of the given sequence.
-    If not available, enter *NA.*
+- _PRIME_EDITING_PEGRNA_SPACER_SEQ (OPTIONAL)_: pegRNA spacer sgRNA sequence
+  used in prime editing. The spacer should not include the PAM sequence.
+  The sequence should be given in the RNA 5'->3' order, so for Cas9, the
+  PAM would be on the right side of the given sequence.
+  If not available, enter _NA._
 
-- *PRIME\_EDITING\_NICKING\_GUIDE\_SEQ (OPTIONAL)*: Nicking sgRNA sequence used in prime
-    editing. The sgRNA should not include the PAM sequence. The sequence should be given
-    in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the sequence.
-    If not available, enter *NA.*
+- _PRIME_EDITING_NICKING_GUIDE_SEQ (OPTIONAL)_: Nicking sgRNA sequence used in prime
+  editing. The sgRNA should not include the PAM sequence. The sequence should be given
+  in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the sequence.
+  If not available, enter _NA._
 
-- *PRIME\_EDITING\_PEGRNA\_EXTENSION\_SEQ (OPTIONAL)*: Extension sequence used in prime
-    editing. The sequence should be given in the RNA 5'->3' order, such that the sequence
-    starts with the RT template including the edit, followed by the Primer-binding site (PBS).
-    If not available, enter *NA.*
+- _PRIME_EDITING_PEGRNA_EXTENSION_SEQ (OPTIONAL)_: Extension sequence used in prime
+  editing. The sequence should be given in the RNA 5'->3' order, such that the sequence
+  starts with the RT template including the edit, followed by the Primer-binding site (PBS).
+  If not available, enter _NA._
 
-- *PRIME\_EDITING\_PEGRNA\_SCAFFOLD\_SEQ (OPTIONAL)*: If given, reads containing any of this scaffold sequence
-    before extension sequence (provided by --prime_editing_extension_seq) will be classified
-    as 'Scaffold-incorporated'. The sequence should be given in the 5'->3' order such that
-    the RT template directly follows this sequence. A common value ends with 'GGCACCGAGUCGGUGC'.
-    If not available, enter *NA.*
+- _PRIME_EDITING_PEGRNA_SCAFFOLD_SEQ (OPTIONAL)_: If given, reads containing any of this scaffold sequence
+  before extension sequence (provided by --prime*editing_extension_seq) will be classified
+  as 'Scaffold-incorporated'. The sequence should be given in the 5'->3' order such that
+  the RT template directly follows this sequence. A common value ends with 'GGCACCGAGUCGGUGC'.
+  If not available, enter \_NA.*
 
-- *PRIME\_EDITING\_PEGRNA\_SCAFFOLD\_MIN\_MATCH\_LENGTH (OPTIONAL)*: Minimum number of bases matching
-    scaffold sequence for the read to be counted as 'Scaffold-incorporated'. If the scaffold
-    sequence matches the reference sequence at the incorporation site, the minimum number of
-    bases to match will be minimally increased (beyond this parameter) to disambiguate between
-    prime-edited and scaffold-incorporated sequences. If not available, enter *NA.*
+- _PRIME_EDITING_PEGRNA_SCAFFOLD_MIN_MATCH_LENGTH (OPTIONAL)_: Minimum number of bases matching
+  scaffold sequence for the read to be counted as 'Scaffold-incorporated'. If the scaffold
+  sequence matches the reference sequence at the incorporation site, the minimum number of
+  bases to match will be minimally increased (beyond this parameter) to disambiguate between
+  prime-edited and scaffold-incorporated sequences. If not available, enter _NA._
 
-- *PRIME\_EDITING\_OVERRIDE\_PRIME\_EDITED\_REF\_SEQ (OPTIONAL)*:If given, this sequence will be used
-    as the prime-edited reference sequence. This may be useful if the prime-edited reference
-    sequence has large indels or the algorithm cannot otherwise infer the correct reference
-    sequence. If not available, enter *NA.*
+- _PRIME_EDITING_OVERRIDE_PRIME_EDITED_REF_SEQ (OPTIONAL)_:If given, this sequence will be used
+  as the prime-edited reference sequence. This may be useful if the prime-edited reference
+  sequence has large indels or the algorithm cannot otherwise infer the correct reference
+  sequence. If not available, enter _NA._
 
-- *QWC or QUANTIFICATION\_WINDOW\_COORDINATES (OPTIONAL)*: Bp positions in the amplicon sequence specifying the quantification window.
-    Any indels/substitutions outside this window are excluded. Indexes are 0-based, meaning that
-    the first nucleotide is position 0. Ranges are separated by the dash sign like "start-stop",
-    and multiple ranges can be separated by the underscore (_). A value of 0 disables this filter.
-    If not available, enter *NA.*
-- *W or QUANTIFICATION\_WINDOW\_SIZE (OPTIONAL)*: Defines the size (in bp) of the quantification window extending from the position specified by the "--cleavage_offset" or "--quantification_window_center" parameter in relation to the provided guide RNA sequence(s) (--sgRNA). Mutations within this number of bp from the quantification window center are used in classifying reads as modified or unmodified. A value of 0 disables this window and indels in the entire amplicon are considered. Default is 1, 1bp on each side of the cleavage position for a total length of 2bp. (default: 1) If not available, enter *NA.*
+- _QWC or QUANTIFICATION_WINDOW_COORDINATES (OPTIONAL)_: Bp positions in the amplicon sequence specifying the quantification window.
+  Any indels/substitutions outside this window are excluded. Indexes are 0-based, meaning that
+  the first nucleotide is position 0. Ranges are separated by the dash sign like "start-stop",
+  and multiple ranges can be separated by the underscore (\_). A value of 0 disables this filter.
+  If not available, enter _NA._
+- _W or QUANTIFICATION_WINDOW_SIZE (OPTIONAL)_: Defines the size (in bp) of the quantification window extending from the position specified by the "--cleavage_offset" or "--quantification_window_center" parameter in relation to the provided guide RNA sequence(s) (--sgRNA). Mutations within this number of bp from the quantification window center are used in classifying reads as modified or unmodified. A value of 0 disables this window and indels in the entire amplicon are considered. Default is 1, 1bp on each side of the cleavage position for a total length of 2bp. (default: 1) If not available, enter \_NA.\*
 
-- *WC or QUANTIFICATION\_WINDOW\_CENTER (OPTIONAL)*: Center of quantification window to use within respect to the 3' end of the provided sgRNA sequence. Remember that the sgRNA sequence must be entered without the PAM. For cleaving nucleases, this is the predicted cleavage position. The default is -3 and is suitable for the Cas9 system. For alternate nucleases, other cleavage offsets may be appropriate, for example, if using Cpf1 this parameter would be set to 1. For base editors, this could be set to -17. (default: -3) If not available, enter *NA.*
+- _WC or QUANTIFICATION_WINDOW_CENTER (OPTIONAL)_: Center of quantification window to use within respect to the 3' end of the provided sgRNA sequence. Remember that the sgRNA sequence must be entered without the PAM. For cleaving nucleases, this is the predicted cleavage position. The default is -3 and is suitable for the Cas9 system. For alternate nucleases, other cleavage offsets may be appropriate, for example, if using Cpf1 this parameter would be set to 1. For base editors, this could be set to -17. (default: -3) If not available, enter _NA._
 
 A file in the correct format should look like this:
 
@@ -594,48 +692,50 @@ Site2 GTCCTGGTTTTTGGTTTGGGAAATATAGTCATC NA GTCCTGGTTTTTGGTTTAAAAAAATATAGTCATC NA
 
 Site 3 TTTCTGGTTTTTGGTTTGGGAAATATAGTCATC NA NA GGAAATATA
 
-The user can easily create this file with *any text editor* or with
+The user can easily create this file with _any text editor_ or with
 spreadsheet software like Excel (Microsoft), Numbers (Apple) or Sheets
 (Google Docs) and then save it as tab delimited file.
 
 Example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoPooled -r1 SRR1046762_1.fastq.gz -r2 SRR1046762_2.fastq.gz -f AMPLICONS_FILE.txt --name ONLY_AMPLICONS_SRR1046762 --gene_annotations gencode_v19.gz
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoPooled -r1 SRR1046762_1.fastq.gz -r2 SRR1046762_2.fastq.gz -f AMPLICONS_FILE.txt --name ONLY_AMPLICONS_SRR1046762 --gene_annotations gencode_v19.gz
 ```
 
 The output of CRISPRessoPooled Amplicons mode consists of:
 
-1.  REPORT\_READS\_ALIGNED\_TO\_AMPLICONS.txt: this file contains the
+1.  REPORT_READS_ALIGNED_TO_AMPLICONS.txt: this file contains the
     same information provided in the input description file, plus some
     additional columns:
 
-    a.  *Demultiplexed\_fastq.gz\_filename*: name of the files
-        containing the raw reads for each amplicon.
+    a. _Demultiplexed_fastq.gz_filename_: name of the files
+    containing the raw reads for each amplicon.
 
-    b.  *n\_reads*: number of reads recovered for each amplicon.
+    b. _n_reads_: number of reads recovered for each amplicon.
 
 2.  A set of fastq.gz files, one for each amplicon.
 
 3.  A set of folders, one for each amplicon, containing a full
     CRISPResso report.
 
-4.  SAMPLES_QUANTIFICATION_SUMMARY.txt: this file contains a summary of the quantification and the alignment statistics for each          region analyzed (read counts and percentages for the various classes: Unmodified, NHEJ, point mutations, and HDR).
+4.  SAMPLES_QUANTIFICATION_SUMMARY.txt: this file contains a summary of the quantification and the alignment statistics for each region analyzed (read counts and percentages for the various classes: Unmodified, NHEJ, point mutations, and HDR).
 
-5.  *CRISPRessoPooled\_RUNNING\_LOG.txt*:  execution log and messages
+5.  _CRISPRessoPooled_RUNNING_LOG.txt_: execution log and messages
     for the external utilities called.
 
 **Genome mode:** In this mode the tool aligns each read to the best
 location in the genome. Then potential amplicons are discovered looking
 for regions with enough reads (the default setting is to have at least
 1000 reads, but the parameter can be adjusted with the option
-*--min\_reads\_to\_use\_region*). If a gene annotation file from UCSC is
+_--min_reads_to_use_region_). If a gene annotation file from UCSC is
 provided, the tool also reports the overlapping gene/s to the region. In
 this way it is possible to check if the amplified regions map to
 expected genomic locations and/or also to pseudogenes or other
@@ -650,7 +750,7 @@ To run the tool in this mode the user must provide:
     are also accepted)
 
 2.  The full path of the reference genome in bowtie2 format (e.g.
-    /genomes/human\_hg19/hg19). Instructions on how to build
+    /genomes/human_hg19/hg19). Instructions on how to build
     a custom index or precomputed index for human and mouse genome
     assembly can be downloaded from the bowtie2
     website: http://bowtie-bio.sourceforge.net/bowtie2/index.shtml.
@@ -659,48 +759,50 @@ To run the tool in this mode the user must provide:
     user can download this file from the UCSC Genome Browser (
     http://genome.ucsc.edu/cgi-bin/hgTables?command=start ) selecting as
     table "knownGene", as output format "all fields from selected table"
-    and as file returned "gzip compressed". (e.g. /genomes/human\_hg19/gencode\_v19.gz)
+    and as file returned "gzip compressed". (e.g. /genomes/human_hg19/gencode_v19.gz)
 
 Example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoPooled -r1 SRR1046762_1.fastq.gz -r2 SRR1046762_2.fastq.gz -x /GENOMES/hg19/hg19 --name ONLY_GENOME_SRR1046762 --gene_annotations gencode_v19.gz
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoPooled -r1 SRR1046762_1.fastq.gz -r2 SRR1046762_2.fastq.gz -x /GENOMES/hg19/hg19 --name ONLY_GENOME_SRR1046762 --gene_annotations gencode_v19.gz
 ```
 
 The output of CRISPRessoPooled Genome mode consists of:
 
-1.  REPORT\_READS\_ALIGNED\_TO\_GENOME\_ONLY.txt: this file contains the
+1.  REPORT_READS_ALIGNED_TO_GENOME_ONLY.txt: this file contains the
     list of all the regions discovered, one per line with the following
     information:
 
--   chr\_id: chromosome of the region in the reference genome.
+- chr_id: chromosome of the region in the reference genome.
 
--   bpstart: start coordinate of the region in the reference genome.
+- bpstart: start coordinate of the region in the reference genome.
 
--   bpend: end coordinate of the region in the reference genome.
+- bpend: end coordinate of the region in the reference genome.
 
--   fastq\_file: location of the fastq.gz file containing the reads
-    mapped to the region.
+- fastq_file: location of the fastq.gz file containing the reads
+  mapped to the region.
 
--   n\_reads: number of reads mapped to the region.
+- n_reads: number of reads mapped to the region.
 
--   sequence: the sequence, on the reference genome for the region.
+- sequence: the sequence, on the reference genome for the region.
 
-1.  MAPPED\_REGIONS (folder): this folder contains all the fastq.gz
+1.  MAPPED_REGIONS (folder): this folder contains all the fastq.gz
     files for the discovered regions.
 
 2.  A set of folders with the CRISPResso report on the regions with
     enough reads.
 
-3.  SAMPLES_QUANTIFICATION_SUMMARY.txt: this file contains a summary of the quantification and the alignment statistics for each          region analyzed (read counts and percentages for the various classes: Unmodified, NHEJ, point mutations, and HDR).
+3.  SAMPLES_QUANTIFICATION_SUMMARY.txt: this file contains a summary of the quantification and the alignment statistics for each region analyzed (read counts and percentages for the various classes: Unmodified, NHEJ, point mutations, and HDR).
 
-4.  *CRISPRessoPooled\_RUNNING\_LOG.txt*:  execution log and messages
+4.  _CRISPRessoPooled_RUNNING_LOG.txt_: execution log and messages
     for the external utilities called.
 
     This running mode is particularly useful to check for mapping
@@ -719,29 +821,31 @@ surviving regions.
 
 To run the tool in this mode the user must provide:
 
--   Paired-end reads (two files) or single-end reads (single file)
-    in [FASTQ
-    format ](http://en.wikipedia.org/wiki/FASTQ_format)(fastq.gz files
-    are also accepted)
+- Paired-end reads (two files) or single-end reads (single file)
+  in [FASTQ
+  format ](http://en.wikipedia.org/wiki/FASTQ_format)(fastq.gz files
+  are also accepted)
 
--   A description file containing the amplicon sequences used to enrich
-    regions in the genome and some additional information (as described
-    in the Amplicons mode section).
+- A description file containing the amplicon sequences used to enrich
+  regions in the genome and some additional information (as described
+  in the Amplicons mode section).
 
--   The reference genome in bowtie2 format (as described in Genome
-    mode section).
+- The reference genome in bowtie2 format (as described in Genome
+  mode section).
 
--   Optionally the gene annotations from UCSC (as described in Genome
-    mode section).
+- Optionally the gene annotations from UCSC (as described in Genome
+  mode section).
 
 Example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoPooled -r1 SRR1046762_1.fastq.gz -r2 SRR1046762_2.fastq.gz -f AMPLICONS_FILE.txt -x /GENOMES/hg19/hg19 --name AMPLICONS_AND_GENOME_SRR1046762 --gene_annotations gencode_v19.gz
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoPooled -r1 SRR1046762_1.fastq.gz -r2 SRR1046762_2.fastq.gz -f AMPLICONS_FILE.txt -x /GENOMES/hg19/hg19 --name AMPLICONS_AND_GENOME_SRR1046762 --gene_annotations gencode_v19.gz
 ```
@@ -749,36 +853,36 @@ docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoPooled
 The output of CRISPRessoPooled Mixed Amplicons + Genome mode consists of
 these files:
 
-1.  REPORT\_READS\_ALIGNED\_TO\_GENOME\_AND\_AMPLICONS.txt: this file
+1.  REPORT_READS_ALIGNED_TO_GENOME_AND_AMPLICONS.txt: this file
     contains the same information provided in the input description
     file, plus some additional columns:
 
-    a.  Amplicon\_Specific\_fastq.gz\_filename: name of the file
-        containing the raw reads recovered for the amplicon.
+    a. Amplicon_Specific_fastq.gz_filename: name of the file
+    containing the raw reads recovered for the amplicon.
 
-    b.  *n\_reads*: number of reads recovered for the amplicon.
+    b. _n_reads_: number of reads recovered for the amplicon.
 
-    c.  *Gene\_overlapping:* gene/s overlapping the amplicon region.
+    c. _Gene_overlapping:_ gene/s overlapping the amplicon region.
 
-    d.  chr\_id: chromosome of the amplicon in the reference genome.
+    d. chr_id: chromosome of the amplicon in the reference genome.
 
-    e.  bpstart: start coordinate of the amplicon in the
-        reference genome.
+    e. bpstart: start coordinate of the amplicon in the
+    reference genome.
 
-    f.  bpend: end coordinate of the amplicon in the reference genome.
+    f. bpend: end coordinate of the amplicon in the reference genome.
 
-    g.  Reference\_Sequence: sequence in the reference genome for the
-        region mapped for the amplicon.
+    g. Reference_Sequence: sequence in the reference genome for the
+    region mapped for the amplicon.
 
-2.  MAPPED\_REGIONS (folder): this folder contains all the fastq.gz
+2.  MAPPED_REGIONS (folder): this folder contains all the fastq.gz
     files for the discovered regions.
 
 3.  A set of folders with the CRISPResso report on the amplicons with
     enough reads.
 
-4.  SAMPLES_QUANTIFICATION_SUMMARY.txt: this file contains a summary of the quantification and the alignment statistics for each          region analyzed (read counts and percentages for the various classes: Unmodified, NHEJ, point mutations, and HDR).
+4.  SAMPLES_QUANTIFICATION_SUMMARY.txt: this file contains a summary of the quantification and the alignment statistics for each region analyzed (read counts and percentages for the various classes: Unmodified, NHEJ, point mutations, and HDR).
 
-5.  *CRISPRessoPooled\_RUNNING\_LOG.txt*:   execution log and messages
+5.  _CRISPRessoPooled_RUNNING_LOG.txt_: execution log and messages
     for the external utilities called.
 
 The Mixed mode combines the benefits of the two previous running modes.
@@ -799,13 +903,14 @@ his may be time consuming). Finally the Amplicon mode is the fastest,
 although the least reliable in terms of quantification accuracy.
 
 #### Parameter List
+
 -f or --amplicons_file: Amplicons description file (default: ''). This file is a tab-delimited text file with up to 14 columns (2 required):
 
---amplicon_name:  an identifier for the amplicon (must be unique)
+--amplicon_name: an identifier for the amplicon (must be unique)
 
---amplicon_seq:  amplicon sequence used in the experiment
+--amplicon_seq: amplicon sequence used in the experiment
 
---guide_seq (OPTIONAL):  sgRNA sequence used for this amplicon without the PAM sequence. Multiple guides can be given separated by commas and not spaces.
+--guide_seq (OPTIONAL): sgRNA sequence used for this amplicon without the PAM sequence. Multiple guides can be given separated by commas and not spaces.
 
 --expected_hdr_amplicon_seq (OPTIONAL): expected amplicon sequence in case of HDR.
 
@@ -865,38 +970,39 @@ are more suitable, and identified regions can be analyzed and visualized using
 CRISPRessoWGS.
 
 #### Usage
+
 To run CRISPRessoWGS you must provide:
 
-1.  A genome aligned *BAM* file. To align reads from a WGS experiment to
+1.  A genome aligned _BAM_ file. To align reads from a WGS experiment to
     the genome there are many options available, we suggest using either
     **Bowtie2 (**<http://bowtie-bio.sourceforge.net/bowtie2/>) or **BWA
     (**<http://bio-bwa.sourceforge.net/>**).**
 
-2.  A *FASTA* file containing the reference sequence used to align the
+2.  A _FASTA_ file containing the reference sequence used to align the
     reads and create the BAM file (the reference files for the most
     common organism can be download from
-    UCSC: http://hgdownload.soe.ucsc.edu/downloads.html. *Download and
-    uncompress only the file ending with .fa.gz*, for example for the
-    last version of the human genome download and *uncompress* the
+    UCSC: http://hgdownload.soe.ucsc.edu/downloads.html. _Download and
+    uncompress only the file ending with .fa.gz_, for example for the
+    last version of the human genome download and _uncompress_ the
     file hg38.fa.gz)
 
 3.  Descriptions file containing the coordinates of the regions to
     analyze and some additional information. In particular, this file is
     a tab delimited text file with up to 7 columns (4 required):
 
-    -   chr\_id: chromosome of the region in the reference genome.
+    - chr_id: chromosome of the region in the reference genome.
 
-    -   bpstart: start coordinate of the region in the reference genome.
+    - bpstart: start coordinate of the region in the reference genome.
 
-    -   bpend: end coordinate of the region in the reference genome.
+    - bpend: end coordinate of the region in the reference genome.
 
-    -   *REGION\_NAME*: an identifier for the region (*must be unique*).
+    - _REGION_NAME_: an identifier for the region (_must be unique_).
 
-    -   *sgRNA\_SEQUENCE (OPTIONAL)*: sgRNA sequence used for this genomic segment *without the PAM sequence.* If not available, enter *NA.*
+    - _sgRNA_SEQUENCE (OPTIONAL)_: sgRNA sequence used for this genomic segment _without the PAM sequence._ If not available, enter _NA._
 
-    -   *EXPECTED\_SEGMENT\_AFTER\_HDR (OPTIONAL)*: expected genomic segment sequence in case of HDR. If more than one, separate by commas *and not spaces*. If not available, enter *NA.*
+    - _EXPECTED_SEGMENT_AFTER_HDR (OPTIONAL)_: expected genomic segment sequence in case of HDR. If more than one, separate by commas _and not spaces_. If not available, enter _NA._
 
-    -   *CODING\_SEQUENCE (OPTIONAL)*: Subsequence(s) of the genomic segment corresponding to coding sequences. If more than one, separate by commas *and not spaces*. If not available, enter *NA.*
+    - _CODING_SEQUENCE (OPTIONAL)_: Subsequence(s) of the genomic segment corresponding to coding sequences. If more than one, separate by commas _and not spaces_. If not available, enter _NA._
 
 A file in the correct format should look like this (column entries must be separated by tabs):
 
@@ -906,8 +1012,8 @@ chr1 65118211 65118261 R1 CTACAGAGCCCCAGTCCTGG NA NA
 chr6 51002798 51002820 R2 NA NA NA
 ```
 
-Note: *no column titles should be entered.* As you may have noticed this
-file is just a *BED* file with extra columns. For this reason a normal
+Note: _no column titles should be entered._ As you may have noticed this
+file is just a _BED_ file with extra columns. For this reason a normal
 BED file with 4 columns, is also **accepted** by this utility.
 
 4.  Optionally the full path of a gene annotations file from UCSC. You
@@ -915,58 +1021,60 @@ BED file with 4 columns, is also **accepted** by this utility.
     Browser (http://genome.ucsc.edu/cgi-bin/hgTables?command=start)
     selecting as table "knownGene", as output format "all fields from
     selected table" and as file returned "gzip compressed". (something
-    like: /genomes/human\_hg19/gencode\_v19.gz)
+    like: /genomes/human_hg19/gencode_v19.gz)
 
 Example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoWGS -b WGS/50/50_sorted_rmdup_fixed_groups.bam -f WGS_TEST.txt -r /GENOMES/mm9/mm9.fa --gene_annotations ensemble_mm9.txt.gz --name CRISPR_WGS_SRR1542350
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoWGS -b WGS/50/50_sorted_rmdup_fixed_groups.bam -f WGS_TEST.txt -r /GENOMES/mm9/mm9.fa --gene_annotations ensemble_mm9.txt.gz --name CRISPR_WGS_SRR1542350
 ```
 
 The output from these files will consist of:
 
-1.  REPORT\_READS\_ALIGNED\_TO\_SELECTED\_REGIONS\_WGS.txt: this file
+1.  REPORT_READS_ALIGNED_TO_SELECTED_REGIONS_WGS.txt: this file
     contains the same information provided in the input description
     file, plus some additional columns:
 
-    a.  sequence: sequence in the reference genome for the
-        region specified.
+    a. sequence: sequence in the reference genome for the
+    region specified.
 
-    b.  *gene\_overlapping:* gene/s overlapping the region specified.
+    b. _gene_overlapping:_ gene/s overlapping the region specified.
 
-    c.  *n\_reads*: number of reads recovered for the region.
+    c. _n_reads_: number of reads recovered for the region.
 
-    d.  bam\_file\_with\_reads\_in\_region: file containing only the
-        subset of the reads that overlap, also partially, with
-        the region. This file is indexed and can be easily loaded for
-        example on IGV for visualization of single reads or for the
-        comparison of two conditions. For example, in the figure below
-        (fig X) we show reads mapped to a region inside the coding
-        sequence of the gene Crygc subjected to
-        NHEJ (CRISPR\_WGS\_SRR1542350) vs reads from a control
-        experiment (CONTROL\_WGS\_SRR1542349).
+    d. bam_file_with_reads_in_region: file containing only the
+    subset of the reads that overlap, also partially, with
+    the region. This file is indexed and can be easily loaded for
+    example on IGV for visualization of single reads or for the
+    comparison of two conditions. For example, in the figure below
+    (fig X) we show reads mapped to a region inside the coding
+    sequence of the gene Crygc subjected to
+    NHEJ (CRISPR_WGS_SRR1542350) vs reads from a control
+    experiment (CONTROL_WGS_SRR1542349).
 
-    e.  fastq.gz\_file\_trimmed\_reads\_in\_region: file containing only
-        the subset of reads fully covering the specified regions, and
-        trimmed to match the sequence in that region. These reads are
-        used for the subsequent analysis with CRISPResso.
+    e. fastq.gz_file_trimmed_reads_in_region: file containing only
+    the subset of reads fully covering the specified regions, and
+    trimmed to match the sequence in that region. These reads are
+    used for the subsequent analysis with CRISPResso.
 
-2.  ANALYZED\_REGIONS (folder): this folder contains all the BAM and
+2.  ANALYZED_REGIONS (folder): this folder contains all the BAM and
     FASTQ files, one for each region analyzed.
 
 3.  A set of folders with the CRISPResso report on the regions provided
     in input with enough reads (the default setting is to have at least
     10 reads, but the parameter can be adjusted with the option
 
-    *--min\_reads\_to\_use\_region*).
+    _--min_reads_to_use_region_).
 
-4.  *CRISPRessoPooled\_RUNNING\_LOG.txt*:   execution log and messages
+4.  _CRISPRessoPooled_RUNNING_LOG.txt_: execution log and messages
     for the external utilities called.
 
 This utility is particular useful to investigate and quantify mutation
@@ -995,29 +1103,32 @@ CRISPRessoCompare is a utility for the comparison of a pair of CRISPResso analys
 
 To run CRISPRessoCompare you must provide:
 
-1.	Two output folders generated with CRISPResso using the same reference amplicon and settings but on different datasets.
-2.	Optionally a name for each condition to use for the plots, and the name of the output folder
+1. Two output folders generated with CRISPResso using the same reference amplicon and settings but on different datasets.
+2. Optionally a name for each condition to use for the plots, and the name of the output folder
 
 Example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoCompare -n1 "VEGFA CRISPR" -n2 "VEGFA CONTROL"  -n VEGFA_Site_1_SRR10467_VS_SRR1046787 CRISPResso_on_VEGFA_Site_1_SRR1046762/ CRISPResso_on_VEGFA_Site_1_SRR1046787/
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoCompare -n1 "VEGFA CRISPR" -n2 "VEGFA CONTROL"  -n VEGFA_Site_1_SRR10467_VS_SRR1046787 CRISPResso_on_VEGFA_Site_1_SRR1046762/ CRISPResso_on_VEGFA_Site_1_SRR1046787/
 ```
 
 The output will consist of:
 
-1.	Comparison_Efficiency.pdf: a figure containing a comparison of the edit frequencies for each category (NHEJ, MIXED NHEJ-HDR and HDR) and as well the net effect subtracting the second sample (second folder in the command line) provided in the analysis from the first sample (first folder in the command line).
-2.	Comparison_Combined_Insertion_Deletion_Substitution_Locations.pdf: a figure showing the average profile for the mutations for the two samples in the same scale and their difference with the same convention used in the previous figure (first sample – second sample).
-3.	CRISPRessoCompare_significant_base_counts.txt: a text file reporting the number of bases for each amplicon and in the quantification window for each amplicon that were significantly enriched for Insertions, Deletions, and Substitutions, as well as All Modifications (Fisher's exact test, Bonferonni corrected p-values).
-4.	CRISPRessoCompare_RUNNING_LOG.txt: detailed execution log.
+1. Comparison_Efficiency.pdf: a figure containing a comparison of the edit frequencies for each category (NHEJ, MIXED NHEJ-HDR and HDR) and as well the net effect subtracting the second sample (second folder in the command line) provided in the analysis from the first sample (first folder in the command line).
+2. Comparison_Combined_Insertion_Deletion_Substitution_Locations.pdf: a figure showing the average profile for the mutations for the two samples in the same scale and their difference with the same convention used in the previous figure (first sample – second sample).
+3. CRISPRessoCompare_significant_base_counts.txt: a text file reporting the number of bases for each amplicon and in the quantification window for each amplicon that were significantly enriched for Insertions, Deletions, and Substitutions, as well as All Modifications (Fisher's exact test, Bonferonni corrected p-values).
+4. CRISPRessoCompare_RUNNING_LOG.txt: detailed execution log.
 
 #### Parameter List
+
 crispresso_output_folder_1: First output folder with CRISPResso analysis (Required)
 crispresso_output_folder_2: Second output folder with CRISPResso analysis (Required)
 
@@ -1035,32 +1146,36 @@ crispresso_output_folder_2: Second output folder with CRISPResso analysis (Requi
 
 CRISPRessoPooledWGSCompare is an extension of the CRIPRessoCompare utility allowing the user to run and summarize multiple CRISPRessoCompare analyses where several regions are analyzed in two different conditions, as in the case of the CRISPRessoPooled or CRISPRessoWGS utilities.
 
-
 #### Usage
 
 To run CRISPRessoPooledWGSCompare you must provide:
-1.	Two output folders generated with CRISPRessoPooled or CRISPRessoWGS using the same reference amplicon and settings but on different datasets.
-2.	Optionally a name for each condition to use for the plots, and the name of the output folder
+
+1. Two output folders generated with CRISPRessoPooled or CRISPRessoWGS using the same reference amplicon and settings but on different datasets.
+2. Optionally a name for each condition to use for the plots, and the name of the output folder
 
 Example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoPooledWGSCompare CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046762/ CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046787/ -n1 SRR1046762 -n2 SRR1046787 -n AMPLICONS_AND_GENOME_SRR1046762_VS_SRR1046787
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoPooledWGSCompare CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046762/ CRISPRessoPooled_on_AMPLICONS_AND_GENOME_SRR1046787/ -n1 SRR1046762 -n2 SRR1046787 -n AMPLICONS_AND_GENOME_SRR1046762_VS_SRR1046787
 ```
 
 The output from these files will consist of:
-1.	COMPARISON_SAMPLES_QUANTIFICATION_SUMMARIES.txt: this file contains a summary of the quantification for each of the two conditions for each region and their difference (read counts and percentages for the various classes: Unmodified, NHEJ, MIXED NHEJ-HDR  and HDR).
-2.	A set of folders with CRISPRessoCompare reports on the common regions with enough reads in both conditions.
-3.	CRISPRessoPooledWGSCompare_significant_base_count_summary.txt: a text file summarizing for each sample and amplicon in both conditions the number of bases for each amplicon and in the quantification window for each amplicon that were significantly enriched for Insertions, Deletions, and Substitutions, as well as All Modifications (Fisher's exact test, Bonferonni corrected p-values).
-4.	CRISPRessoPooledWGSCompare_RUNNING_LOG.txt: detailed execution log.
+
+1. COMPARISON_SAMPLES_QUANTIFICATION_SUMMARIES.txt: this file contains a summary of the quantification for each of the two conditions for each region and their difference (read counts and percentages for the various classes: Unmodified, NHEJ, MIXED NHEJ-HDR and HDR).
+2. A set of folders with CRISPRessoCompare reports on the common regions with enough reads in both conditions.
+3. CRISPRessoPooledWGSCompare_significant_base_count_summary.txt: a text file summarizing for each sample and amplicon in both conditions the number of bases for each amplicon and in the quantification window for each amplicon that were significantly enriched for Insertions, Deletions, and Substitutions, as well as All Modifications (Fisher's exact test, Bonferonni corrected p-values).
+4. CRISPRessoPooledWGSCompare_RUNNING_LOG.txt: detailed execution log.
 
 #### Parameter List
+
 crispresso_pooled_wgs_output_folder_1: First output folder with CRISPRessoPooled or CRISPRessoWGS analysis (Required)
 crispresso_pooled_wgs_output_folder_2: Second output folder with CRISPRessoPooled or CRISPRessoWGS analysis (Required)
 
@@ -1101,12 +1216,14 @@ To run CRISPRessoCompare you must provide the --name parameter, and CRISPResso f
 
 Example:
 
-*Using Bioconda:*
+_Using Bioconda:_
+
 ```
 CRISPRessoAggregate --name "VEGFA" --prefix CRISPRessoRuns/VEGFA/
 ```
 
-*Using Docker:*
+_Using Docker:_
+
 ```
 docker run -v ${PWD}:/DATA -w /DATA -i pinellolab/crispresso2 CRISPRessoAggregate --name "VEGFA" --prefix CRISPRessoRuns/VEGFA/
 ```
diff --git a/scripts/plotAmbiguous.py b/scripts/plotAmbiguous.py
index ee7c24f1..3b01dc3b 100644
--- a/scripts/plotAmbiguous.py
+++ b/scripts/plotAmbiguous.py
@@ -9,7 +9,7 @@
 import numpy as np
 import pandas as pd
 import zipfile
-from CRISPResso2 import CRISPRessoPlot
+
 from CRISPResso2 import CRISPRessoShared
 
 def main():
@@ -21,8 +21,17 @@ def main():
     parser.add_argument("--plot_cut_point",help="If set, a line at the cut point will be plotted.",action="store_true")
     parser.add_argument("--save_png",help="If set, pngs will also be produced (as well as pdfs).",action="store_true")
 
+    #CRISPRessoPro params
+    parser.add_argument('--use_matplotlib', action='store_true',
+                        help='Use matplotlib for plotting instead of plotly/d3 when CRISPRessoPro is installed')
+
     args = parser.parse_args()
 
+    if args.use_matplotlib or not CRISPRessoShared.is_C2Pro_installed():
+        from CRISPResso2 import CRISPRessoPlot
+    else:
+        from CRISPRessoPro import plot as CRISPRessoPlot
+
     plot_ambiguous_alleles_tables_from_folder(args.CRISPResso2_folder,args.output_root,MIN_FREQUENCY=args.min_freq,MAX_N_ROWS=args.max_rows,SAVE_ALSO_PNG=args.save_png,plot_cut_point=args.plot_cut_point)
 
 def arrStr_to_arr(val):
@@ -109,7 +118,7 @@ def plot_ambiguous_alleles_tables_from_folder(crispresso_output_folder,fig_filen
             for (int_start, int_end) in refs[ref_name]['sgRNA_intervals']:
                 new_sgRNA_intervals += [(int_start - new_sel_cols_start - 1,int_end - new_sel_cols_start - 1)]
             fig_filename_root = fig_filename_root+"_"+ref_name+"_"+sgRNA_label
-            CRISPRessoPlot.plot_alleles_table(ref_seq_around_cut,df_alleles=df_alleles_around_cut,fig_filename_root=fig_filename_root, MIN_FREQUENCY=MIN_FREQUENCY,MAX_N_ROWS=MAX_N_ROWS,SAVE_ALSO_PNG=SAVE_ALSO_PNG,plot_cut_point=plot_cut_point,sgRNA_intervals=new_sgRNA_intervals,sgRNA_names=sgRNA_names,sgRNA_mismatches=sgRNA_mismatches,annotate_wildtype_allele=crispresso2_info['running_info']['args'].annotate_wildtype_allele)
+            CRISPRessoPlot.plot_alleles_table(ref_seq_around_cut,df_alleles=df_alleles_around_cut,fig_filename_root=fig_filename_root,custom_colors=custom_colors,MIN_FREQUENCY=MIN_FREQUENCY,MAX_N_ROWS=MAX_N_ROWS,SAVE_ALSO_PNG=SAVE_ALSO_PNG,plot_cut_point=plot_cut_point,sgRNA_intervals=new_sgRNA_intervals,sgRNA_names=sgRNA_names,sgRNA_mismatches=sgRNA_mismatches,annotate_wildtype_allele=crispresso2_info['running_info']['args'].annotate_wildtype_allele)
 
             plot_count += 1
     print('Plotted ' + str(plot_count) + ' plots')
diff --git a/scripts/plotCustomAllelePlot.py b/scripts/plotCustomAllelePlot.py
index 7eb32207..a3094158 100644
--- a/scripts/plotCustomAllelePlot.py
+++ b/scripts/plotCustomAllelePlot.py
@@ -9,7 +9,6 @@
 import numpy as np
 import pandas as pd
 import zipfile
-from CRISPResso2 import CRISPRessoPlot
 from CRISPResso2 import CRISPRessoShared
 import seaborn as sns
 import matplotlib
@@ -29,9 +28,17 @@ def main():
     parser.add_argument("--plot_left",help="Number of bases to plot to the left of the cut site",type=int,default=20)
     parser.add_argument("--plot_right",help="Number of bases to plot to the right of the cut site",type=int,default=20)
     parser.add_argument("--plot_center",help="Center of plot. If set, plots for guide RNAs will not be generated -- only a plot centered at this position will be plotted.",type=int,default=None)
-
+    
+    # CRISPRessoPro params
+    parser.add_argument('--use_matplotlib', action='store_true',
+                        help='Use matplotlib for plotting instead of plotly/d3 when CRISPRessoPro is installed')
 
     args = parser.parse_args()
+    if args.use_matplotlib or not CRISPRessoShared.is_C2Pro_installed():
+        from CRISPResso2 import CRISPRessoPlot
+    else:
+        from CRISPRessoPro import plot as CRISPRessoPlot
+
     plot_alleles_tables_from_folder(args.CRISPResso2_folder,args.output_root,MIN_FREQUENCY=args.min_freq,MAX_N_ROWS=args.max_rows,SAVE_ALSO_PNG=args.save_png,plot_cut_point=args.plot_cut_point,plot_left=args.plot_left,plot_right=args.plot_right,plot_center=args.plot_center)
 
 def arrStr_to_arr(val):
@@ -126,7 +133,7 @@ def plot_alleles_tables_from_folder(crispresso_output_folder,fig_filename_root,p
                 new_sgRNA_intervals += [(int_start - new_sel_cols_start - 1,int_end - new_sel_cols_start - 1)]
 
             fig_filename_root = fig_filename_root+"_"+ref_name+"_"+sgRNA_label
-            plot_alleles_table(ref_seq_around_cut,df_alleles=df_alleles_around_cut,fig_filename_root=fig_filename_root,cut_point_ind=cut_point-new_sel_cols_start, MIN_FREQUENCY=MIN_FREQUENCY,MAX_N_ROWS=MAX_N_ROWS,SAVE_ALSO_PNG=SAVE_ALSO_PNG,plot_cut_point=plot_cut_point,sgRNA_intervals=new_sgRNA_intervals,sgRNA_names=sgRNA_names,sgRNA_mismatches=sgRNA_mismatches,annotate_wildtype_allele=crispresso2_info['running_info']['args'].annotate_wildtype_allele)
+            plot_alleles_table(ref_seq_around_cut,df_alleles=df_alleles_around_cut,fig_filename_root=fig_filename_root,cut_point_ind=cut_point-new_sel_cols_start,custom_colors=custom_colors,MIN_FREQUENCY=MIN_FREQUENCY,MAX_N_ROWS=MAX_N_ROWS,SAVE_ALSO_PNG=SAVE_ALSO_PNG,plot_cut_point=plot_cut_point,sgRNA_intervals=new_sgRNA_intervals,sgRNA_names=sgRNA_names,sgRNA_mismatches=sgRNA_mismatches,annotate_wildtype_allele=crispresso2_info['running_info']['args'].annotate_wildtype_allele)
 
             plot_count += 1
         else:
@@ -155,12 +162,12 @@ def plot_alleles_tables_from_folder(crispresso_output_folder,fig_filename_root,p
                     new_sgRNA_intervals += [(int_start - new_sel_cols_start - 1,int_end - new_sel_cols_start - 1)]
 
                 fig_filename_root = fig_filename_root+"_"+ref_name+"_"+sgRNA_label
-                plot_alleles_table(ref_seq_around_cut,df_alleles=df_alleles_around_cut,fig_filename_root=fig_filename_root,cut_point_ind=cut_point-new_sel_cols_start, MIN_FREQUENCY=MIN_FREQUENCY,MAX_N_ROWS=MAX_N_ROWS,SAVE_ALSO_PNG=SAVE_ALSO_PNG,plot_cut_point=plot_cut_point,sgRNA_intervals=new_sgRNA_intervals,sgRNA_names=sgRNA_names,sgRNA_mismatches=sgRNA_mismatches,annotate_wildtype_allele=crispresso2_info['running_info']['args'].annotate_wildtype_allele)
+                plot_alleles_table(ref_seq_around_cut,df_alleles=df_alleles_around_cut,fig_filename_root=fig_filename_root,cut_point_ind=cut_point-new_sel_cols_start,custom_colors=custom_colors,MIN_FREQUENCY=MIN_FREQUENCY,MAX_N_ROWS=MAX_N_ROWS,SAVE_ALSO_PNG=SAVE_ALSO_PNG,plot_cut_point=plot_cut_point,sgRNA_intervals=new_sgRNA_intervals,sgRNA_names=sgRNA_names,sgRNA_mismatches=sgRNA_mismatches,annotate_wildtype_allele=crispresso2_info['running_info']['args'].annotate_wildtype_allele)
 
                 plot_count += 1
     print('Plotted ' + str(plot_count) + ' plots')
 
-def plot_alleles_table(reference_seq,df_alleles,fig_filename_root,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,cut_point_ind=None,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,custom_colors=None,annotate_wildtype_allele='****',):
+def plot_alleles_table(reference_seq,df_alleles,fig_filename_root,custom_colors,MIN_FREQUENCY=0.5,MAX_N_ROWS=100,SAVE_ALSO_PNG=False,plot_cut_point=True,cut_point_ind=None,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,annotate_wildtype_allele='****',):
     """
     plots an allele table for a dataframe with allele frequencies
     input:
@@ -183,9 +190,9 @@ def plot_alleles_table(reference_seq,df_alleles,fig_filename_root,MIN_FREQUENCY=
         for ix, is_ref in enumerate(is_reference):
             if is_ref:
                 y_labels[ix] += annotate_wildtype_allele
-    plot_alleles_heatmap(reference_seq,fig_filename_root,X,annot,y_labels,insertion_dict,per_element_annot_kws,SAVE_ALSO_PNG,plot_cut_point,cut_point_ind,sgRNA_intervals,sgRNA_names,sgRNA_mismatches,custom_colors)
+    plot_alleles_heatmap(reference_seq,fig_filename_root,X,annot,y_labels,insertion_dict,per_element_annot_kws,custom_colors,SAVE_ALSO_PNG,plot_cut_point,cut_point_ind,sgRNA_intervals,sgRNA_names,sgRNA_mismatches)
 
-def plot_alleles_heatmap(reference_seq,fig_filename_root,X,annot,y_labels,insertion_dict,per_element_annot_kws,SAVE_ALSO_PNG=False,plot_cut_point=True,cut_point_ind=None,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None,custom_colors=None):
+def plot_alleles_heatmap(reference_seq,fig_filename_root,X,annot,y_labels,insertion_dict,per_element_annot_kws,custom_colors,SAVE_ALSO_PNG=False,plot_cut_point=True,cut_point_ind=None,sgRNA_intervals=None,sgRNA_names=None,sgRNA_mismatches=None):
     """
     Plots alleles in a heatmap (nucleotides color-coded for easy visualization)
     input: