gen-project for #14

cmungall · Jan 8, 2022 · 386d19d · 386d19d
1 parent 391489a
commit 386d19d
Show file tree

Hide file tree

Showing 2,662 changed files with 877,372 additions and 6 deletions.
diff --git a/.gitignore b/.gitignore
@@ -1,7 +1,8 @@
+*.old
 .idea
-tests/outputs/*yaml
+/docs/    ## do not check  in - deploy directly
+__pycache__
+downloads/
 target/
-*.old
+tests/outputs/*yaml
 venv
-__pycache__
-/docs/    ## do not check  in - deploy directly
diff --git a/Makefile b/Makefile
@@ -13,7 +13,7 @@ RUN = pipenv run
 SCHEMA_NAME = mixs
 SCHEMA_SRC = $(SCHEMA_DIR)/$(SCHEMA_NAME).yaml
 #PKG_TGTS = graphql json  jsonschema owl rdf jsonld shex
-PKG_TGTS = graphql json  jsonschema owl
+PKG_TGTS =  json  jsonschema owl
 TGTS = docs $(PKG_TGTS)
 
 # Global generation options
@@ -22,7 +22,8 @@ GEN_OPTS =
 # ----------------------------------------
 # TOP LEVEL TARGETS
 # ----------------------------------------
-all: env.lock gen unlock
+# all: env.lock gen unlock
+all: clean env.lock generated unlock
 
 # ---------------------------------------
 # env.lock:  set up pipenv
@@ -35,6 +36,9 @@ unlock:
 #	pipenv --rm
 	rm env.lock
 
+generated: model/schema/mixs.yaml
+	$(RUN) gen-project --dir $@ $< 2> generated.log
+
 # ---------------------------------------
 # GEN: run generator for each target
 # ---------------------------------------
@@ -45,6 +49,7 @@ gen: $(patsubst %,gen-%,$(TGTS))
 # ---------------------------------------
 clean:
 	rm -rf target/
+	rm -rf generated/
 	rm -f env.lock
 #	pipenv --rm
 .PHONY: clean

diff --git a/generated.log b/generated.log
diff --git a/generated/docs/Air.md b/generated/docs/Air.md
diff --git a/generated/docs/AirMIGSBacteria.md b/generated/docs/AirMIGSBacteria.md
diff --git a/generated/docs/AirMIGSEukaryote.md b/generated/docs/AirMIGSEukaryote.md
diff --git a/generated/docs/AirMIGSOrg.md b/generated/docs/AirMIGSOrg.md
diff --git a/generated/docs/AirMIGSPlant.md b/generated/docs/AirMIGSPlant.md
diff --git a/generated/docs/AirMIGSVirus.md b/generated/docs/AirMIGSVirus.md
diff --git a/generated/docs/AirMIMAG.md b/generated/docs/AirMIMAG.md
diff --git a/generated/docs/AirMIMARKSSpecimen.md b/generated/docs/AirMIMARKSSpecimen.md
diff --git a/generated/docs/AirMIMARKSSurvey.md b/generated/docs/AirMIMARKSSurvey.md
diff --git a/generated/docs/AirMIMS.md b/generated/docs/AirMIMS.md
diff --git a/generated/docs/AirMISAG.md b/generated/docs/AirMISAG.md
diff --git a/generated/docs/AirMIUVIG.md b/generated/docs/AirMIUVIG.md
diff --git a/generated/docs/BuiltEnvironment.md b/generated/docs/BuiltEnvironment.md
diff --git a/generated/docs/BuiltEnvironmentMIGSBacteria.md b/generated/docs/BuiltEnvironmentMIGSBacteria.md
diff --git a/generated/docs/BuiltEnvironmentMIGSEukaryote.md b/generated/docs/BuiltEnvironmentMIGSEukaryote.md
diff --git a/generated/docs/BuiltEnvironmentMIGSOrg.md b/generated/docs/BuiltEnvironmentMIGSOrg.md
diff --git a/generated/docs/BuiltEnvironmentMIGSPlant.md b/generated/docs/BuiltEnvironmentMIGSPlant.md
diff --git a/generated/docs/BuiltEnvironmentMIGSVirus.md b/generated/docs/BuiltEnvironmentMIGSVirus.md
diff --git a/generated/docs/BuiltEnvironmentMIMAG.md b/generated/docs/BuiltEnvironmentMIMAG.md
diff --git a/generated/docs/BuiltEnvironmentMIMARKSSpecimen.md b/generated/docs/BuiltEnvironmentMIMARKSSpecimen.md
diff --git a/generated/docs/BuiltEnvironmentMIMARKSSurvey.md b/generated/docs/BuiltEnvironmentMIMARKSSurvey.md
diff --git a/generated/docs/BuiltEnvironmentMIMS.md b/generated/docs/BuiltEnvironmentMIMS.md
diff --git a/generated/docs/BuiltEnvironmentMISAG.md b/generated/docs/BuiltEnvironmentMISAG.md
diff --git a/generated/docs/BuiltEnvironmentMIUVIG.md b/generated/docs/BuiltEnvironmentMIUVIG.md
diff --git a/generated/docs/Checklist.md b/generated/docs/Checklist.md
@@ -0,0 +1,23 @@
+
+# Subset: checklist
+
+
+A MIxS checklist. These can be combined with packages
+
+URI: [mixs.vocab:checklist](https://w3id.org/mixs/vocab/checklist)
+
+
+### Classes
+
+
+### Mixins
+
+
+### Slots
+
+
+### Types
+
+
+### Enums
+
diff --git a/generated/docs/ChecklistPackageCombination.md b/generated/docs/ChecklistPackageCombination.md
@@ -0,0 +1,23 @@
+
+# Subset: checklist_package_combination
+
+
+A combination of a checklist and a package
+
+URI: [mixs.vocab:checklist_package_combination](https://w3id.org/mixs/vocab/checklist_package_combination)
+
+
+### Classes
+
+
+### Mixins
+
+
+### Slots
+
+
+### Types
+
+
+### Enums
+
diff --git a/generated/docs/Core.md b/generated/docs/Core.md
diff --git a/generated/docs/Host-associated.md b/generated/docs/Host-associated.md
diff --git a/generated/docs/Host-associatedMIGSBacteria.md b/generated/docs/Host-associatedMIGSBacteria.md
diff --git a/generated/docs/Host-associatedMIGSEukaryote.md b/generated/docs/Host-associatedMIGSEukaryote.md
diff --git a/generated/docs/Host-associatedMIGSOrg.md b/generated/docs/Host-associatedMIGSOrg.md
diff --git a/generated/docs/Host-associatedMIGSPlant.md b/generated/docs/Host-associatedMIGSPlant.md
diff --git a/generated/docs/Host-associatedMIGSVirus.md b/generated/docs/Host-associatedMIGSVirus.md
diff --git a/generated/docs/Host-associatedMIMAG.md b/generated/docs/Host-associatedMIMAG.md
diff --git a/generated/docs/Host-associatedMIMARKSSpecimen.md b/generated/docs/Host-associatedMIMARKSSpecimen.md
diff --git a/generated/docs/Host-associatedMIMARKSSurvey.md b/generated/docs/Host-associatedMIMARKSSurvey.md
diff --git a/generated/docs/Host-associatedMIMS.md b/generated/docs/Host-associatedMIMS.md
diff --git a/generated/docs/Host-associatedMISAG.md b/generated/docs/Host-associatedMISAG.md
diff --git a/generated/docs/Host-associatedMIUVIG.md b/generated/docs/Host-associatedMIUVIG.md
diff --git a/generated/docs/Human-associated.md b/generated/docs/Human-associated.md
diff --git a/generated/docs/Human-associatedMIGSBacteria.md b/generated/docs/Human-associatedMIGSBacteria.md
diff --git a/generated/docs/Human-associatedMIGSEukaryote.md b/generated/docs/Human-associatedMIGSEukaryote.md
diff --git a/generated/docs/Human-associatedMIGSOrg.md b/generated/docs/Human-associatedMIGSOrg.md
diff --git a/generated/docs/Human-associatedMIGSPlant.md b/generated/docs/Human-associatedMIGSPlant.md
diff --git a/generated/docs/Human-associatedMIGSVirus.md b/generated/docs/Human-associatedMIGSVirus.md
diff --git a/generated/docs/Human-associatedMIMAG.md b/generated/docs/Human-associatedMIMAG.md
diff --git a/generated/docs/Human-associatedMIMARKSSpecimen.md b/generated/docs/Human-associatedMIMARKSSpecimen.md
diff --git a/generated/docs/Human-associatedMIMARKSSurvey.md b/generated/docs/Human-associatedMIMARKSSurvey.md
diff --git a/generated/docs/Human-associatedMIMS.md b/generated/docs/Human-associatedMIMS.md
diff --git a/generated/docs/Human-associatedMISAG.md b/generated/docs/Human-associatedMISAG.md
diff --git a/generated/docs/Human-associatedMIUVIG.md b/generated/docs/Human-associatedMIUVIG.md
diff --git a/generated/docs/Human-gut.md b/generated/docs/Human-gut.md
diff --git a/generated/docs/Human-gutMIGSBacteria.md b/generated/docs/Human-gutMIGSBacteria.md
diff --git a/generated/docs/Human-gutMIGSEukaryote.md b/generated/docs/Human-gutMIGSEukaryote.md
diff --git a/generated/docs/Human-gutMIGSOrg.md b/generated/docs/Human-gutMIGSOrg.md
diff --git a/generated/docs/Human-gutMIGSPlant.md b/generated/docs/Human-gutMIGSPlant.md
diff --git a/generated/docs/Human-gutMIGSVirus.md b/generated/docs/Human-gutMIGSVirus.md
diff --git a/generated/docs/Human-gutMIMAG.md b/generated/docs/Human-gutMIMAG.md
diff --git a/generated/docs/Human-gutMIMARKSSpecimen.md b/generated/docs/Human-gutMIMARKSSpecimen.md
diff --git a/generated/docs/Human-gutMIMARKSSurvey.md b/generated/docs/Human-gutMIMARKSSurvey.md
diff --git a/generated/docs/Human-gutMIMS.md b/generated/docs/Human-gutMIMS.md
diff --git a/generated/docs/Human-gutMISAG.md b/generated/docs/Human-gutMISAG.md
diff --git a/generated/docs/Human-gutMIUVIG.md b/generated/docs/Human-gutMIUVIG.md
diff --git a/generated/docs/Human-oral.md b/generated/docs/Human-oral.md
diff --git a/generated/docs/Human-oralMIGSBacteria.md b/generated/docs/Human-oralMIGSBacteria.md
diff --git a/generated/docs/Human-oralMIGSEukaryote.md b/generated/docs/Human-oralMIGSEukaryote.md
diff --git a/generated/docs/Human-oralMIGSOrg.md b/generated/docs/Human-oralMIGSOrg.md
diff --git a/generated/docs/Human-oralMIGSPlant.md b/generated/docs/Human-oralMIGSPlant.md
diff --git a/generated/docs/Human-oralMIGSVirus.md b/generated/docs/Human-oralMIGSVirus.md
diff --git a/generated/docs/Human-oralMIMAG.md b/generated/docs/Human-oralMIMAG.md
diff --git a/generated/docs/Human-oralMIMARKSSpecimen.md b/generated/docs/Human-oralMIMARKSSpecimen.md
diff --git a/generated/docs/Human-oralMIMARKSSurvey.md b/generated/docs/Human-oralMIMARKSSurvey.md
diff --git a/generated/docs/Human-oralMIMS.md b/generated/docs/Human-oralMIMS.md
diff --git a/generated/docs/Human-oralMISAG.md b/generated/docs/Human-oralMISAG.md
diff --git a/generated/docs/Human-oralMIUVIG.md b/generated/docs/Human-oralMIUVIG.md
diff --git a/generated/docs/Human-skin.md b/generated/docs/Human-skin.md
diff --git a/generated/docs/Human-skinMIGSBacteria.md b/generated/docs/Human-skinMIGSBacteria.md
diff --git a/generated/docs/Human-skinMIGSEukaryote.md b/generated/docs/Human-skinMIGSEukaryote.md
diff --git a/generated/docs/Human-skinMIGSOrg.md b/generated/docs/Human-skinMIGSOrg.md
diff --git a/generated/docs/Human-skinMIGSPlant.md b/generated/docs/Human-skinMIGSPlant.md
diff --git a/generated/docs/Human-skinMIGSVirus.md b/generated/docs/Human-skinMIGSVirus.md
diff --git a/generated/docs/Human-skinMIMAG.md b/generated/docs/Human-skinMIMAG.md
diff --git a/generated/docs/Human-skinMIMARKSSpecimen.md b/generated/docs/Human-skinMIMARKSSpecimen.md
diff --git a/generated/docs/Human-skinMIMARKSSurvey.md b/generated/docs/Human-skinMIMARKSSurvey.md
diff --git a/generated/docs/Human-skinMIMS.md b/generated/docs/Human-skinMIMS.md
diff --git a/generated/docs/Human-skinMISAG.md b/generated/docs/Human-skinMISAG.md
diff --git a/generated/docs/Human-skinMIUVIG.md b/generated/docs/Human-skinMIUVIG.md
diff --git a/generated/docs/Human-vaginal.md b/generated/docs/Human-vaginal.md
diff --git a/generated/docs/Human-vaginalMIGSBacteria.md b/generated/docs/Human-vaginalMIGSBacteria.md
diff --git a/generated/docs/Human-vaginalMIGSEukaryote.md b/generated/docs/Human-vaginalMIGSEukaryote.md
diff --git a/generated/docs/Human-vaginalMIGSOrg.md b/generated/docs/Human-vaginalMIGSOrg.md
diff --git a/generated/docs/Human-vaginalMIGSPlant.md b/generated/docs/Human-vaginalMIGSPlant.md
diff --git a/generated/docs/Human-vaginalMIGSVirus.md b/generated/docs/Human-vaginalMIGSVirus.md
diff --git a/generated/docs/Human-vaginalMIMAG.md b/generated/docs/Human-vaginalMIMAG.md
diff --git a/generated/docs/Human-vaginalMIMARKSSpecimen.md b/generated/docs/Human-vaginalMIMARKSSpecimen.md
diff --git a/generated/docs/Human-vaginalMIMARKSSurvey.md b/generated/docs/Human-vaginalMIMARKSSurvey.md
diff --git a/generated/docs/Human-vaginalMIMS.md b/generated/docs/Human-vaginalMIMS.md
diff --git a/generated/docs/Human-vaginalMISAG.md b/generated/docs/Human-vaginalMISAG.md
diff --git a/generated/docs/Human-vaginalMIUVIG.md b/generated/docs/Human-vaginalMIUVIG.md
diff --git a/generated/docs/HydrocarbonResources-cores.md b/generated/docs/HydrocarbonResources-cores.md
diff --git a/generated/docs/HydrocarbonResources-coresMIGSBacteria.md b/generated/docs/HydrocarbonResources-coresMIGSBacteria.md
diff --git a/generated/docs/HydrocarbonResources-coresMIGSEukaryote.md b/generated/docs/HydrocarbonResources-coresMIGSEukaryote.md
diff --git a/generated/docs/HydrocarbonResources-coresMIGSOrg.md b/generated/docs/HydrocarbonResources-coresMIGSOrg.md
diff --git a/generated/docs/HydrocarbonResources-coresMIGSPlant.md b/generated/docs/HydrocarbonResources-coresMIGSPlant.md
diff --git a/generated/docs/HydrocarbonResources-coresMIGSVirus.md b/generated/docs/HydrocarbonResources-coresMIGSVirus.md
diff --git a/generated/docs/HydrocarbonResources-coresMIMAG.md b/generated/docs/HydrocarbonResources-coresMIMAG.md
diff --git a/generated/docs/HydrocarbonResources-coresMIMARKSSpecimen.md b/generated/docs/HydrocarbonResources-coresMIMARKSSpecimen.md
diff --git a/generated/docs/HydrocarbonResources-coresMIMARKSSurvey.md b/generated/docs/HydrocarbonResources-coresMIMARKSSurvey.md
diff --git a/generated/docs/HydrocarbonResources-coresMIMS.md b/generated/docs/HydrocarbonResources-coresMIMS.md
diff --git a/generated/docs/HydrocarbonResources-coresMISAG.md b/generated/docs/HydrocarbonResources-coresMISAG.md
diff --git a/generated/docs/HydrocarbonResources-coresMIUVIG.md b/generated/docs/HydrocarbonResources-coresMIUVIG.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabs.md b/generated/docs/HydrocarbonResources-fluidsSwabs.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIGSBacteria.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIGSBacteria.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIGSEukaryote.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIGSEukaryote.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIGSOrg.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIGSOrg.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIGSPlant.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIGSPlant.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIGSVirus.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIGSVirus.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIMAG.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIMAG.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIMARKSSpecimen.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIMARKSSpecimen.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIMARKSSurvey.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIMARKSSurvey.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIMS.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIMS.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMISAG.md b/generated/docs/HydrocarbonResources-fluidsSwabsMISAG.md
diff --git a/generated/docs/HydrocarbonResources-fluidsSwabsMIUVIG.md b/generated/docs/HydrocarbonResources-fluidsSwabsMIUVIG.md
diff --git a/generated/docs/MIGSBacteria.md b/generated/docs/MIGSBacteria.md
diff --git a/generated/docs/MIGSEukaryote.md b/generated/docs/MIGSEukaryote.md
diff --git a/generated/docs/MIGSOrg.md b/generated/docs/MIGSOrg.md
diff --git a/generated/docs/MIGSPlant.md b/generated/docs/MIGSPlant.md
diff --git a/generated/docs/MIGSVirus.md b/generated/docs/MIGSVirus.md
diff --git a/generated/docs/MIGS_bacteria_adapters.md b/generated/docs/MIGS_bacteria_adapters.md
@@ -0,0 +1,49 @@
+
+# Slot: adapters
+
+
+Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
+
+URI: [mixs.vocab:MIGS_bacteria_adapters](https://w3id.org/mixs/vocab/MIGS_bacteria_adapters)
+
+
+## Domain and Range
+
+[MIGSBacteria](MIGSBacteria.md) &#8594;  <sub>0..1</sub> [String](types/String.md)
+
+## Parents
+
+ *  is_a: [adapters](adapters.md)
+
+## Children
+
+
+## Used by
+
+ * [MIGSBacteria](MIGSBacteria.md)
+ * [AirMIGSBacteria](AirMIGSBacteria.md)
+ * [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md)
+ * [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md)
+ * [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md)
+ * [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md)
+ * [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md)
+ * [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md)
+ * [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md)
+ * [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md)
+ * [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md)
+ * [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md)
+ * [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md)
+ * [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md)
+ * [SedimentMIGSBacteria](SedimentMIGSBacteria.md)
+ * [SoilMIGSBacteria](SoilMIGSBacteria.md)
+ * [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md)
+ * [WaterMIGSBacteria](WaterMIGSBacteria.md)
+
+## Other properties
+
+|  |  |  |
+| --- | --- | --- |
+| **Mappings:** | | MIXS:0000048 |
+| **Comments:** | | Expected value: adapter A and B sequence |
+| **Examples:** | | Example(value='AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT', description=None) |
+
diff --git a/generated/docs/MIGS_bacteria_annot.md b/generated/docs/MIGS_bacteria_annot.md
@@ -0,0 +1,49 @@
+
+# Slot: annot
+
+
+Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
+
+URI: [mixs.vocab:MIGS_bacteria_annot](https://w3id.org/mixs/vocab/MIGS_bacteria_annot)
+
+
+## Domain and Range
+
+[MIGSBacteria](MIGSBacteria.md) &#8594;  <sub>0..1</sub> [String](types/String.md)
+
+## Parents
+
+ *  is_a: [annot](annot.md)
+
+## Children
+
+
+## Used by
+
+ * [MIGSBacteria](MIGSBacteria.md)
+ * [AirMIGSBacteria](AirMIGSBacteria.md)
+ * [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md)
+ * [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md)
+ * [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md)
+ * [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md)
+ * [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md)
+ * [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md)
+ * [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md)
+ * [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md)
+ * [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md)
+ * [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md)
+ * [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md)
+ * [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md)
+ * [SedimentMIGSBacteria](SedimentMIGSBacteria.md)
+ * [SoilMIGSBacteria](SoilMIGSBacteria.md)
+ * [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md)
+ * [WaterMIGSBacteria](WaterMIGSBacteria.md)
+
+## Other properties
+
+|  |  |  |
+| --- | --- | --- |
+| **Mappings:** | | MIXS:0000059 |
+| **Comments:** | | Expected value: name of tool or pipeline used, or annotation source description |
+| **Examples:** | | Example(value='prokka', description=None) |
+
diff --git a/generated/docs/MIGS_bacteria_assembly_name.md b/generated/docs/MIGS_bacteria_assembly_name.md
@@ -0,0 +1,49 @@
+
+# Slot: assembly_name
+
+
+Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
+
+URI: [mixs.vocab:MIGS_bacteria_assembly_name](https://w3id.org/mixs/vocab/MIGS_bacteria_assembly_name)
+
+
+## Domain and Range
+
+[MIGSBacteria](MIGSBacteria.md) &#8594;  <sub>0..1</sub> [String](types/String.md)
+
+## Parents
+
+ *  is_a: [assembly_name](assembly_name.md)
+
+## Children
+
+
+## Used by
+
+ * [MIGSBacteria](MIGSBacteria.md)
+ * [AirMIGSBacteria](AirMIGSBacteria.md)
+ * [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md)
+ * [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md)
+ * [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md)
+ * [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md)
+ * [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md)
+ * [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md)
+ * [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md)
+ * [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md)
+ * [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md)
+ * [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md)
+ * [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md)
+ * [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md)
+ * [SedimentMIGSBacteria](SedimentMIGSBacteria.md)
+ * [SoilMIGSBacteria](SoilMIGSBacteria.md)
+ * [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md)
+ * [WaterMIGSBacteria](WaterMIGSBacteria.md)
+
+## Other properties
+
+|  |  |  |
+| --- | --- | --- |
+| **Mappings:** | | MIXS:0000057 |
+| **Comments:** | | Expected value: name and version of assembly |
+| **Examples:** | | Example(value='HuRef, JCVI_ISG_i3_1.0', description=None) |
+
diff --git a/generated/docs/MIGS_bacteria_assembly_qual.md b/generated/docs/MIGS_bacteria_assembly_qual.md
@@ -0,0 +1,49 @@
+
+# Slot: assembly_qual
+
+
+The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
+
+URI: [mixs.vocab:MIGS_bacteria_assembly_qual](https://w3id.org/mixs/vocab/MIGS_bacteria_assembly_qual)
+
+
+## Domain and Range
+
+[MIGSBacteria](MIGSBacteria.md) &#8594;  <sub>1..1</sub> [assembly_qual_enum](assembly_qual_enum.md)
+
+## Parents
+
+ *  is_a: [assembly_qual](assembly_qual.md)
+
+## Children
+
+
+## Used by
+
+ * [MIGSBacteria](MIGSBacteria.md)
+ * [AirMIGSBacteria](AirMIGSBacteria.md)
+ * [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md)
+ * [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md)
+ * [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md)
+ * [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md)
+ * [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md)
+ * [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md)
+ * [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md)
+ * [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md)
+ * [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md)
+ * [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md)
+ * [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md)
+ * [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md)
+ * [SedimentMIGSBacteria](SedimentMIGSBacteria.md)
+ * [SoilMIGSBacteria](SoilMIGSBacteria.md)
+ * [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md)
+ * [WaterMIGSBacteria](WaterMIGSBacteria.md)
+
+## Other properties
+
+|  |  |  |
+| --- | --- | --- |
+| **Mappings:** | | MIXS:0000056 |
+| **Comments:** | | Expected value: enumeration |
+| **Examples:** | | Example(value='High-quality draft genome', description=None) |
+
diff --git a/generated/docs/MIGS_bacteria_assembly_software.md b/generated/docs/MIGS_bacteria_assembly_software.md
@@ -0,0 +1,49 @@
+
+# Slot: assembly_software
+
+
+Tool(s) used for assembly, including version number and parameters
+
+URI: [mixs.vocab:MIGS_bacteria_assembly_software](https://w3id.org/mixs/vocab/MIGS_bacteria_assembly_software)
+
+
+## Domain and Range
+
+[MIGSBacteria](MIGSBacteria.md) &#8594;  <sub>1..1</sub> [String](types/String.md)
+
+## Parents
+
+ *  is_a: [assembly_software](assembly_software.md)
+
+## Children
+
+
+## Used by
+
+ * [MIGSBacteria](MIGSBacteria.md)
+ * [AirMIGSBacteria](AirMIGSBacteria.md)
+ * [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md)
+ * [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md)
+ * [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md)
+ * [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md)
+ * [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md)
+ * [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md)
+ * [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md)
+ * [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md)
+ * [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md)
+ * [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md)
+ * [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md)
+ * [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md)
+ * [SedimentMIGSBacteria](SedimentMIGSBacteria.md)
+ * [SoilMIGSBacteria](SoilMIGSBacteria.md)
+ * [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md)
+ * [WaterMIGSBacteria](WaterMIGSBacteria.md)
+
+## Other properties
+
+|  |  |  |
+| --- | --- | --- |
+| **Mappings:** | | MIXS:0000058 |
+| **Comments:** | | Expected value: name and version of software, parameters used |
+| **Examples:** | | Example(value='metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise', description=None) |
+
diff --git a/generated/docs/MIGS_bacteria_associated_resource.md b/generated/docs/MIGS_bacteria_associated_resource.md
@@ -0,0 +1,49 @@
+
+# Slot: associated resource
+
+
+A related resource that is referenced, cited, or otherwise associated to the sequence.
+
+URI: [mixs.vocab:MIGS_bacteria_associated_resource](https://w3id.org/mixs/vocab/MIGS_bacteria_associated_resource)
+
+
+## Domain and Range
+
+[MIGSBacteria](MIGSBacteria.md) &#8594;  <sub>0..1</sub> [String](types/String.md)
+
+## Parents
+
+ *  is_a: [associated resource](associated_resource.md)
+
+## Children
+
+
+## Used by
+
+ * [MIGSBacteria](MIGSBacteria.md)
+ * [AirMIGSBacteria](AirMIGSBacteria.md)
+ * [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md)
+ * [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md)
+ * [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md)
+ * [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md)
+ * [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md)
+ * [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md)
+ * [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md)
+ * [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md)
+ * [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md)
+ * [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md)
+ * [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md)
+ * [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md)
+ * [SedimentMIGSBacteria](SedimentMIGSBacteria.md)
+ * [SoilMIGSBacteria](SoilMIGSBacteria.md)
+ * [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md)
+ * [WaterMIGSBacteria](WaterMIGSBacteria.md)
+
+## Other properties
+
+|  |  |  |
+| --- | --- | --- |
+| **Mappings:** | | MIXS:0000091 |
+| **Comments:** | | Expected value: reference to resource |
+| **Examples:** | | Example(value='http://www.earthmicrobiome.org/', description=None) |
+