-
Notifications
You must be signed in to change notification settings - Fork 3
Commit
- Loading branch information
There are no files selected for viewing
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,7 +1,8 @@ | ||
*.old | ||
.idea | ||
tests/outputs/*yaml | ||
/docs/ ## do not check in - deploy directly | ||
__pycache__ | ||
downloads/ | ||
target/ | ||
*.old | ||
tests/outputs/*yaml | ||
venv | ||
__pycache__ | ||
/docs/ ## do not check in - deploy directly |
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,23 @@ | ||
|
||
# Subset: checklist | ||
|
||
|
||
A MIxS checklist. These can be combined with packages | ||
|
||
URI: [mixs.vocab:checklist](https://w3id.org/mixs/vocab/checklist) | ||
|
||
|
||
### Classes | ||
|
||
|
||
### Mixins | ||
|
||
|
||
### Slots | ||
|
||
|
||
### Types | ||
|
||
|
||
### Enums | ||
|
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,23 @@ | ||
|
||
# Subset: checklist_package_combination | ||
|
||
|
||
A combination of a checklist and a package | ||
|
||
URI: [mixs.vocab:checklist_package_combination](https://w3id.org/mixs/vocab/checklist_package_combination) | ||
|
||
|
||
### Classes | ||
|
||
|
||
### Mixins | ||
|
||
|
||
### Slots | ||
|
||
|
||
### Types | ||
|
||
|
||
### Enums | ||
|
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Large diffs are not rendered by default.
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,49 @@ | ||
|
||
# Slot: adapters | ||
|
||
|
||
Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters | ||
|
||
URI: [mixs.vocab:MIGS_bacteria_adapters](https://w3id.org/mixs/vocab/MIGS_bacteria_adapters) | ||
|
||
|
||
## Domain and Range | ||
|
||
[MIGSBacteria](MIGSBacteria.md) → <sub>0..1</sub> [String](types/String.md) | ||
|
||
## Parents | ||
|
||
* is_a: [adapters](adapters.md) | ||
|
||
## Children | ||
|
||
|
||
## Used by | ||
|
||
* [MIGSBacteria](MIGSBacteria.md) | ||
* [AirMIGSBacteria](AirMIGSBacteria.md) | ||
* [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md) | ||
* [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md) | ||
* [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md) | ||
* [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md) | ||
* [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md) | ||
* [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md) | ||
* [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md) | ||
* [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md) | ||
* [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md) | ||
* [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md) | ||
* [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md) | ||
* [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md) | ||
* [SedimentMIGSBacteria](SedimentMIGSBacteria.md) | ||
* [SoilMIGSBacteria](SoilMIGSBacteria.md) | ||
* [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md) | ||
* [WaterMIGSBacteria](WaterMIGSBacteria.md) | ||
|
||
## Other properties | ||
|
||
| | | | | ||
| --- | --- | --- | | ||
| **Mappings:** | | MIXS:0000048 | | ||
| **Comments:** | | Expected value: adapter A and B sequence | | ||
| **Examples:** | | Example(value='AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT', description=None) | | ||
|
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,49 @@ | ||
|
||
# Slot: annot | ||
|
||
|
||
Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter | ||
|
||
URI: [mixs.vocab:MIGS_bacteria_annot](https://w3id.org/mixs/vocab/MIGS_bacteria_annot) | ||
|
||
|
||
## Domain and Range | ||
|
||
[MIGSBacteria](MIGSBacteria.md) → <sub>0..1</sub> [String](types/String.md) | ||
|
||
## Parents | ||
|
||
* is_a: [annot](annot.md) | ||
|
||
## Children | ||
|
||
|
||
## Used by | ||
|
||
* [MIGSBacteria](MIGSBacteria.md) | ||
* [AirMIGSBacteria](AirMIGSBacteria.md) | ||
* [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md) | ||
* [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md) | ||
* [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md) | ||
* [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md) | ||
* [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md) | ||
* [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md) | ||
* [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md) | ||
* [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md) | ||
* [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md) | ||
* [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md) | ||
* [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md) | ||
* [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md) | ||
* [SedimentMIGSBacteria](SedimentMIGSBacteria.md) | ||
* [SoilMIGSBacteria](SoilMIGSBacteria.md) | ||
* [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md) | ||
* [WaterMIGSBacteria](WaterMIGSBacteria.md) | ||
|
||
## Other properties | ||
|
||
| | | | | ||
| --- | --- | --- | | ||
| **Mappings:** | | MIXS:0000059 | | ||
| **Comments:** | | Expected value: name of tool or pipeline used, or annotation source description | | ||
| **Examples:** | | Example(value='prokka', description=None) | | ||
|
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,49 @@ | ||
|
||
# Slot: assembly_name | ||
|
||
|
||
Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community | ||
|
||
URI: [mixs.vocab:MIGS_bacteria_assembly_name](https://w3id.org/mixs/vocab/MIGS_bacteria_assembly_name) | ||
|
||
|
||
## Domain and Range | ||
|
||
[MIGSBacteria](MIGSBacteria.md) → <sub>0..1</sub> [String](types/String.md) | ||
|
||
## Parents | ||
|
||
* is_a: [assembly_name](assembly_name.md) | ||
|
||
## Children | ||
|
||
|
||
## Used by | ||
|
||
* [MIGSBacteria](MIGSBacteria.md) | ||
* [AirMIGSBacteria](AirMIGSBacteria.md) | ||
* [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md) | ||
* [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md) | ||
* [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md) | ||
* [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md) | ||
* [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md) | ||
* [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md) | ||
* [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md) | ||
* [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md) | ||
* [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md) | ||
* [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md) | ||
* [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md) | ||
* [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md) | ||
* [SedimentMIGSBacteria](SedimentMIGSBacteria.md) | ||
* [SoilMIGSBacteria](SoilMIGSBacteria.md) | ||
* [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md) | ||
* [WaterMIGSBacteria](WaterMIGSBacteria.md) | ||
|
||
## Other properties | ||
|
||
| | | | | ||
| --- | --- | --- | | ||
| **Mappings:** | | MIXS:0000057 | | ||
| **Comments:** | | Expected value: name and version of assembly | | ||
| **Examples:** | | Example(value='HuRef, JCVI_ISG_i3_1.0', description=None) | | ||
|
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,49 @@ | ||
|
||
# Slot: assembly_qual | ||
|
||
|
||
The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated | ||
|
||
URI: [mixs.vocab:MIGS_bacteria_assembly_qual](https://w3id.org/mixs/vocab/MIGS_bacteria_assembly_qual) | ||
|
||
|
||
## Domain and Range | ||
|
||
[MIGSBacteria](MIGSBacteria.md) → <sub>1..1</sub> [assembly_qual_enum](assembly_qual_enum.md) | ||
|
||
## Parents | ||
|
||
* is_a: [assembly_qual](assembly_qual.md) | ||
|
||
## Children | ||
|
||
|
||
## Used by | ||
|
||
* [MIGSBacteria](MIGSBacteria.md) | ||
* [AirMIGSBacteria](AirMIGSBacteria.md) | ||
* [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md) | ||
* [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md) | ||
* [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md) | ||
* [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md) | ||
* [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md) | ||
* [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md) | ||
* [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md) | ||
* [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md) | ||
* [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md) | ||
* [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md) | ||
* [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md) | ||
* [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md) | ||
* [SedimentMIGSBacteria](SedimentMIGSBacteria.md) | ||
* [SoilMIGSBacteria](SoilMIGSBacteria.md) | ||
* [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md) | ||
* [WaterMIGSBacteria](WaterMIGSBacteria.md) | ||
|
||
## Other properties | ||
|
||
| | | | | ||
| --- | --- | --- | | ||
| **Mappings:** | | MIXS:0000056 | | ||
| **Comments:** | | Expected value: enumeration | | ||
| **Examples:** | | Example(value='High-quality draft genome', description=None) | | ||
|
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,49 @@ | ||
|
||
# Slot: assembly_software | ||
|
||
|
||
Tool(s) used for assembly, including version number and parameters | ||
|
||
URI: [mixs.vocab:MIGS_bacteria_assembly_software](https://w3id.org/mixs/vocab/MIGS_bacteria_assembly_software) | ||
|
||
|
||
## Domain and Range | ||
|
||
[MIGSBacteria](MIGSBacteria.md) → <sub>1..1</sub> [String](types/String.md) | ||
|
||
## Parents | ||
|
||
* is_a: [assembly_software](assembly_software.md) | ||
|
||
## Children | ||
|
||
|
||
## Used by | ||
|
||
* [MIGSBacteria](MIGSBacteria.md) | ||
* [AirMIGSBacteria](AirMIGSBacteria.md) | ||
* [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md) | ||
* [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md) | ||
* [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md) | ||
* [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md) | ||
* [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md) | ||
* [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md) | ||
* [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md) | ||
* [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md) | ||
* [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md) | ||
* [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md) | ||
* [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md) | ||
* [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md) | ||
* [SedimentMIGSBacteria](SedimentMIGSBacteria.md) | ||
* [SoilMIGSBacteria](SoilMIGSBacteria.md) | ||
* [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md) | ||
* [WaterMIGSBacteria](WaterMIGSBacteria.md) | ||
|
||
## Other properties | ||
|
||
| | | | | ||
| --- | --- | --- | | ||
| **Mappings:** | | MIXS:0000058 | | ||
| **Comments:** | | Expected value: name and version of software, parameters used | | ||
| **Examples:** | | Example(value='metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise', description=None) | | ||
|
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,49 @@ | ||
|
||
# Slot: associated resource | ||
|
||
|
||
A related resource that is referenced, cited, or otherwise associated to the sequence. | ||
|
||
URI: [mixs.vocab:MIGS_bacteria_associated_resource](https://w3id.org/mixs/vocab/MIGS_bacteria_associated_resource) | ||
|
||
|
||
## Domain and Range | ||
|
||
[MIGSBacteria](MIGSBacteria.md) → <sub>0..1</sub> [String](types/String.md) | ||
|
||
## Parents | ||
|
||
* is_a: [associated resource](associated_resource.md) | ||
|
||
## Children | ||
|
||
|
||
## Used by | ||
|
||
* [MIGSBacteria](MIGSBacteria.md) | ||
* [AirMIGSBacteria](AirMIGSBacteria.md) | ||
* [BuiltEnvironmentMIGSBacteria](BuiltEnvironmentMIGSBacteria.md) | ||
* [Host-associatedMIGSBacteria](Host-associatedMIGSBacteria.md) | ||
* [Human-associatedMIGSBacteria](Human-associatedMIGSBacteria.md) | ||
* [Human-gutMIGSBacteria](Human-gutMIGSBacteria.md) | ||
* [Human-oralMIGSBacteria](Human-oralMIGSBacteria.md) | ||
* [Human-skinMIGSBacteria](Human-skinMIGSBacteria.md) | ||
* [Human-vaginalMIGSBacteria](Human-vaginalMIGSBacteria.md) | ||
* [HydrocarbonResources-coresMIGSBacteria](HydrocarbonResources-coresMIGSBacteria.md) | ||
* [HydrocarbonResources-fluidsSwabsMIGSBacteria](HydrocarbonResources-fluidsSwabsMIGSBacteria.md) | ||
* [MicrobialMatBiofilmMIGSBacteria](MicrobialMatBiofilmMIGSBacteria.md) | ||
* [MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria](MiscellaneousNaturalOrArtificialEnvironmentMIGSBacteria.md) | ||
* [Plant-associatedMIGSBacteria](Plant-associatedMIGSBacteria.md) | ||
* [SedimentMIGSBacteria](SedimentMIGSBacteria.md) | ||
* [SoilMIGSBacteria](SoilMIGSBacteria.md) | ||
* [WastewaterSludgeMIGSBacteria](WastewaterSludgeMIGSBacteria.md) | ||
* [WaterMIGSBacteria](WaterMIGSBacteria.md) | ||
|
||
## Other properties | ||
|
||
| | | | | ||
| --- | --- | --- | | ||
| **Mappings:** | | MIXS:0000091 | | ||
| **Comments:** | | Expected value: reference to resource | | ||
| **Examples:** | | Example(value='http://www.earthmicrobiome.org/', description=None) | | ||
|