Adapter sequences not removed from short SE data

[MafGal]

Dear fastp team,
First of all thank you for the tool, very nice!

I am running fastp on SE data from a smallRNAseq dataset of 50nt reads, provided the default adapter sequence "TGGAATTCTCGGGTGCCAAGGC" and minimum length 15.

Although fastp finds many of the adapter sequences, it is not removing them.

Why is this happening / how to get files with all adapter sequences/subsequences trimmed?

This is my code:
`Adapter2remov="TGGAATTCTCGGGTGCCAAGGC"

threads=4

fastp -w $threads -i "$file" -o "${file/.fastq.gz/_fastpadapt30_2.fastq.gz}" -h "${file/.fastq.gz/_fastpadapt30_2.html}" -j "${file/.fastq.gz/_fastpadapt30_2.json}" --low_complexity_filter --complexity_threshold 30 --average_qual 30 --qualified_quality_phred 30 -5 -3 -r --trim_poly_x --poly_x_min_len 6 --trim_poly_g --poly_g_min_len 6 -z 4 --adapter_sequence "$Adapter2remov"`

Thanks in advance for the help,
Mafalda.