feat: add optional column for adapters #419
Merged
Conversation
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
alethomas
requested changes
Dec 23, 2021
workflow/rules/common.smk
Outdated
Comment on lines
848
to
852
| if adapters == "revelo-rna-seq": | ||
| return "--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" | ||
| # https://www.nimagen.com/shop/products/rc-cov096/easyseq-sars-cov-2-novel-coronavirus-whole-genome-sequencing-kit | ||
| elif adapters == "nimagen-easy-seq": | ||
| return "--adapter_sequence GCGAATTTCGACGATCGTTGCATTAACTCGCGAA --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" |
There was a problem hiding this comment.
I'd still prefer to keep these in the config and not hard coded in the common.smk. Or am I missing something here?
There was a problem hiding this comment.
These hardcoded sequences are just used if you enter "revelo-rna-seq" or "nimagen-easy-seq" in the new adapter column. Else the sequences in the config file are used.
However, for generating the ref data set report, we will have to use this new column.
Co-authored-by: Alexander Thomas <[email protected]>
Co-authored-by: Alexander Thomas <[email protected]>
Co-authored-by: Alexander Thomas <[email protected]>
Co-authored-by: Alexander Thomas <[email protected]>
Co-authored-by: Alexander Thomas <[email protected]>
Co-authored-by: Alexander Thomas <[email protected]>
Co-authored-by: Alexander Thomas <[email protected]>
Co-authored-by: Alexander Thomas <[email protected]>
alethomas
approved these changes
Jan 3, 2022
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
Description
This PR adds the option to specify adapters sequence for trimming via the sample sheet. However, this is just an option. Per default the adapates specified in the config are used. Only for samples where the column
adaptersin the sample sheet these "custom adapters" are used.It also provides some "predefined" updates sequences, which can be used by speceifing
revelo-rna-seqornimagen-easy-seqin the sample sheet.Lastly, the docs are updated.
Related Issue
closes #356
Checklist
pre-commitif needed.CODE_OF_CONDUCT.mddocument.CONTRIBUTING.mdguide.