Rosalind_Computing_GC_Content.ipynb

{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Problem\n",
    "\n",
    "The GC-content of a DNA string is given by the percentage of symbols in the string that are 'C' or 'G'. For example, the GC-content of \"AGCTATAG\" is 37.5%. Note that the reverse complement of any DNA string has the same GC-content.\n",
    "\n",
    "DNA strings must be labeled when they are consolidated into a database. A commonly used method of string labeling is called FASTA format. In this format, the string is introduced by a line that begins with '>', followed by some labeling information. Subsequent lines contain the string itself; the first line to begin with '>' indicates the label of the next string.\n",
    "\n",
    "In Rosalind's implementation, a string in FASTA format will be labeled by the ID \"Rosalind_xxxx\", where \"xxxx\" denotes a four-digit code between 0000 and 9999.\n",
    "\n",
    "Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).\n",
    "\n",
    "Return: The ID of the string having the highest GC-content, followed by the GC-content of that string. Rosalind allows for a default error of 0.001 in all decimal answers unless otherwise stated; please see the note on absolute error below.\n",
    "Sample Dataset\n",
    "\n",
    ">Rosalind_6404\n",
    "CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC\n",
    "TCCCACTAATAATTCTGAGG\n",
    ">Rosalind_5959\n",
    "CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT\n",
    "ATATCCATTTGTCAGCAGACACGC\n",
    ">Rosalind_0808\n",
    "CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC\n",
    "TGGGAACCTGCGGGCAGTAGGTGGAAT\n",
    "\n",
    "Sample Output\n",
    "\n",
    "Rosalind_0808\n",
    "60.919540\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "['>Rosalind_6404\\n', 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC\\n', 'TCCCACTAATAATTCTGAGG\\n', '>Rosalind_5959\\n', 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT\\n', 'ATATCCATTTGTCAGCAGACACGC\\n', '>Rosalind_0808\\n', 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC\\n', 'TGGGAACCTGCGGGCAGTAGGTGGAAT\\n']\n"
     ]
    }
   ],
   "source": [
    "f = open ('Inputs/Fasta_DNA.txt', 'r')\n",
    "print (f.readlines())"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      ">Rosalind_6404\n",
      "CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC\n",
      "TCCCACTAATAATTCTGAGG\n",
      ">Rosalind_5959\n",
      "CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT\n",
      "ATATCCATTTGTCAGCAGACACGC\n",
      ">Rosalind_0808\n",
      "CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC\n",
      "TGGGAACCTGCGGGCAGTAGGTGGAAT\n",
      "['', 'Rosalind_6404\\nCCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC\\nTCCCACTAATAATTCTGAGG\\n', 'Rosalind_5959\\nCCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT\\nATATCCATTTGTCAGCAGACACGC\\n', 'Rosalind_0808\\nCCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC\\nTGGGAACCTGCGGGCAGTAGGTGGAAT']\n"
     ]
    }
   ],
   "source": [
    "f = open ('Inputs/Fasta_DNA.txt', 'r')\n",
    "contents = f.read()\n",
    "no_lines = contents.strip(\"\\n\")\n",
    "print (no_lines)\n",
    "print (no_lines.split('>'))\n",
    "\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 19,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "['>Rosalind_6404\\n', 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC\\n', 'TCCCACTAATAATTCTGAGG\\n', '>Rosalind_5959\\n', 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT\\n', 'ATATCCATTTGTCAGCAGACACGC\\n', '>Rosalind_0808\\n', 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC\\n', 'TGGGAACCTGCGGGCAGTAGGTGGAAT\\n']\n"
     ]
    },
    {
     "ename": "NameError",
     "evalue": "name 'search' is not defined",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mNameError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-19-949ad2c70f4d>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[1;32m      4\u001b[0m \u001b[0;34m\u001b[0m\u001b[0m\n\u001b[1;32m      5\u001b[0m \u001b[0;32mfor\u001b[0m \u001b[0mx\u001b[0m \u001b[0;32min\u001b[0m \u001b[0mcontents\u001b[0m\u001b[0;34m:\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 6\u001b[0;31m     \u001b[0;32mif\u001b[0m \u001b[0msearch\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m'>'\u001b[0m\u001b[0;34m,\u001b[0m \u001b[0mcontents\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m:\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m\u001b[1;32m      7\u001b[0m         \u001b[0mprint\u001b[0m \u001b[0;34m(\u001b[0m\u001b[0mx\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n",
      "\u001b[0;31mNameError\u001b[0m: name 'search' is not defined"
     ]
    }
   ],
   "source": [
    "f = open ('Inputs/Fasta_DNA.txt', 'r')\n",
    "contents = f.readlines()\n",
    "print (contents)\n",
    "\n",
    "for x in contents:\n",
    "    if search('>', contents):\n",
    "        print (x)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "43\n",
      "80\n",
      "53.75\n"
     ]
    }
   ],
   "source": [
    "r_6404 = 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG'\n",
    "r_5959 = 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCTATATCCATTTGTCAGCAGACACGC'\n",
    "r_0808 = 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT'\n",
    "total1 = len(r_6404)\n",
    "gc1 = 0\n",
    "\n",
    "for i in r_6404:\n",
    "    if i == 'G':\n",
    "        gc1 = gc1 + 1\n",
    "    elif i == 'C':\n",
    "        gc1 = gc1 + 1\n",
    "print (gc1)\n",
    "print (total1)     \n",
    "gc1b = gc1 / total1\n",
    "print (gc1b * 100)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 13,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "43\n",
      "80\n",
      "53.75\n",
      "45\n",
      "84\n",
      "53.57142857142857\n",
      "53\n",
      "87\n",
      "60.91954022988506\n"
     ]
    }
   ],
   "source": [
    "r_6404 = 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG'\n",
    "r_5959 = 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCTATATCCATTTGTCAGCAGACACGC'\n",
    "r_0808 = 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT'\n",
    "total1 = len(r_6404)\n",
    "total2 = len(r_5959)\n",
    "total3 = len(r_0808)\n",
    "gc1 = 0\n",
    "gc2 = 0\n",
    "gc3 = 0\n",
    "\n",
    "for i in r_6404:\n",
    "    if i == 'G':\n",
    "        gc1 = gc1 + 1\n",
    "    elif i == 'C':\n",
    "        gc1 = gc1 + 1\n",
    "print (gc1)\n",
    "print (total1)     \n",
    "gc1b = gc1 / total1\n",
    "print (gc1b * 100)\n",
    "\n",
    "for i in r_5959:\n",
    "    if i == 'G':\n",
    "        gc2 = gc2 + 1\n",
    "    elif i == 'C':\n",
    "        gc2 = gc2 + 1\n",
    "print (gc2)\n",
    "print (total2)     \n",
    "gc2b = gc2 / total2\n",
    "print (gc2b * 100)\n",
    "\n",
    "for i in r_0808:\n",
    "    if i == 'G':\n",
    "        gc3 = gc3 + 1\n",
    "    elif i == 'C':\n",
    "        gc3 = gc3 + 1\n",
    "print (gc3)\n",
    "print (total3)     \n",
    "gc3b = gc3 / total3\n",
    "print (gc3b * 100)\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.7.3"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 2
}